In-vitro angiogenesis model based on visual blood vessel organs and construction method of in-vitro angiogenesis model

Abstract

The invention provides an in-vitro angiogenesis model based on visual vascular organs and a construction method thereof, and belongs to the technical field of biological in-vitro model construction. According to the double-report cell line provided by the invention, an embryonic stem cell line is taken as a basic biological material, and PECAM1-mRuby3-sec Nluc is designed and successfully constructed; according to an ACTA2-EGFP double-report system, the obtained system can accurately mark endothelial cells and smooth muscle cells with fluorescence for imaging, complex immunofluorescent staining is not needed, and the defect that in the prior art, a model is difficult to apply to drug screening is overcome. On the basis of the prepared double-report cell line, morphological information of angiogenesis is converted into bioluminescence readings, large-scale detection and quantification can be performed through bioluminescence, and an in-vitro angiogenesis model adaptive to high-throughput drug screening is successfully constructed; and a reliable in-vitro model and a convenient detection system are provided for targeted angiogenesis drug screening.

Description

Technical Field

[0001] The present invention relates to the technical field of biological in vitro model construction, and in particular to an in vitro angiogenesis model based on visualized vascular organoids and a construction method thereof. Background Art

[0002] Angiogenesis describes the biological process by which new blood vessels are formed from existing capillaries. This process is regulated by a balance of pro-angiogenic factors and anti-angiogenic factors. Angiogenesis is strictly regulated in physiological processes such as tissue repair and embryonic development, while pathological angiogenesis exists in many diseases such as rheumatoid arthritis, diabetic retinopathy, and atherosclerosis, and this pathological phenomenon accelerates the deterioration of the disease. In addition, pathological angiogenesis also plays a key role in the progression of malignant tumors. Therefore, targeting angiogenesis for drug development has broad clinical application prospects.

[0003] Drug development requires a large number of screenings to obtain compounds that can effectively intervene in the corresponding biological processes. Therefore, reliable in vitro angiogenesis models are needed to assist drug screening. Currently, the commonly used angiogenesis models are: endothelial cell tube formation experiment, fibrin bead experiment and aortic ring experiment. The endothelial cell tube formation experiment uses human primary umbilical vein endothelial cells to be inoculated on a surface coated with matrix gel, and applies proteins such as vascular endothelial growth factor to induce endothelial cell migration and form a lumen-like structure. The defect of this experiment is that there is no participation of smooth muscle cells or pericytes in the system, and most blood vessels in the body are composed of endothelial cells and smooth muscle cells. Therefore, the system complexity is low and it is difficult to restore the physiological conditions in vivo. The fibrin bead experiment induces angiogenesis by coating endothelial cells on the surface of fibrin beads, and the experiment can add smooth muscle cells to the culture system to increase the complexity of the cells, but the characterization of this experiment depends on morphological observation and staining, and it is difficult to screen a large number of drugs in a short time. It can only be used to evaluate the response to a single stimulus. The aortic ring experiment requires the isolation of the aorta of rats or mice for experimentation, and cannot be simulated using human cells. There are differences between humans and mice, and the experimental process is relatively cumbersome, making it also difficult to apply to drug screening.

[0004] With the continuous development of the organoid field, studies in recent years have reported that human pluripotent stem cells are first induced into embryoid bodies, further specialized into the mesoderm and vascular lineage to obtain vascular organoids, and then the vascular organoids are further embedded in hydrogels and growth factors are applied to induce angiogenesis, thereby simulating the angiogenesis process in vitro. Existing experiments use human cells. Due to the continuous proliferation of stem cells, a large amount of raw materials can be provided for in vitro simulation, solving the problem of cell source, but its characterization also relies on morphological observation and staining, which cannot meet the screening needs. Summary of the invention

[0005] The purpose of the present invention is to provide an in vitro angiogenesis model based on visualized vascular organoids and a construction method thereof.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a method for constructing a dual-reporter cell line, comprising the following steps:

[0008] The CRISPR donor plasmid 1 and the Cas9 / gRNA recombinant vector 1 were co-transfected into embryonic stem cell lines, and single reporter cell lines were screened;

[0009] Co-transfecting the CRISPR donor plasmid 2 and the Cas9 / gRNA recombinant vector 2 into the single reporter cell line, and screening to obtain the dual reporter cell line;

[0010] The CRISPR donor plasmid 1 is used to insert the mRuby3 reporter gene and the secNluc reporter gene into the PECAM1 gene;

[0011] The Cas9 / gRNA recombinant vector 1 is used to express Cas9 and gRNA targeting PECAM1;

[0012] The CRISPR donor plasmid 2 is used to insert the eGFP reporter gene into the ACTA2 gene;

[0013] The Cas9 / gRNA recombinant vector 2 is used to express Cas9 and gRNA targeting ACTA2.

[0014] Preferably, the CRISPR donor plasmid 1 contains a PECAM1 left homology arm sequence, an mRuby3 gene, a secNluc gene and a PECAM1 right homology arm sequence.

[0015] Preferably, the nucleotide sequence of the gRNA targeting PECAM1 is shown in SEQ ID NO.1.

[0016] Preferably, the CRISPR donor plasmid 2 contains the ACTA2 left homology arm sequence, the P2A gene, the eGFP gene, the PGK promoter, the PuroR gene, and the ACTA2 right homology arm sequence.

[0017] Preferably, the Cas9 / gRNA recombinant vector 2 is pU6-ACTA2_gRNA1-SpCas9-T2A-GFP.

[0018] The present invention also provides a dual-reporter cell line prepared by the above construction method.

[0019] The present invention also provides the use of the dual reporter cell line in preparing an in vitro angiogenesis model.

[0020] The present invention also provides a method for preparing an in vitro angiogenesis model, comprising the following steps:

[0021] The dual reporter cell line is subjected to vascular organoid differentiation induction culture to obtain vascular organoids;

[0022] mixing the vascular organoid with a hydrogel to obtain a mixture;

[0023] The mixture is mixed with angiogenesis medium and induced to form a vascular network to obtain an in vitro angiogenesis model.

[0024] The present invention also provides an in vitro angiogenesis model prepared by the preparation method.

[0025] The present invention also provides the use of the in vitro angiogenesis model in the screening of angiogenesis-promoting drugs and / or angiogenesis-inhibiting drugs.

[0026] Beneficial effects of the present invention:

[0027] The dual reporter cell line provided by the present invention uses embryonic stem cell line as basic biological material, designs and successfully constructs PECAM1-mRuby3-secNluc; ACTA2-EGFP dual reporter system, and the obtained system can accurately mark endothelial cells and smooth muscle cells with fluorescence for imaging without complicated immunofluorescence staining.

[0028] The present invention is based on the prepared dual-reporter cell line, which converts the morphological information of angiogenesis into bioluminescence readings, can perform large-scale detection and quantification through bioluminescence, and successfully constructs an in vitro angiogenesis model that can be adapted to high-throughput drug screening, providing a reliable in vitro model and a convenient detection system for the screening of targeted angiogenesis drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 constructing a design for a dual-reporter cell line;

[0030] Figure 2 Photo of the differentiated vascular organoids;

[0031] Figure 3 This is the imaging result of the vascular network;

[0032] Figure 4 This is a graph showing the changes on the third day of high-throughput screening using bioluminescence;

[0033] Figure 5 This is a graph showing the changes on the fifth day of high-throughput screening using bioluminescence;

[0034] Figure 6 This is the result of vascular network morphology imaging after drug stimulation;

[0035] Figure 7 This is the backbone map of the T2A-secNluc-PGK-Puro-floxed-BB-mClover3 plasmid. DETAILED DESCRIPTION

[0036] The present invention provides a method for constructing a dual-reporter cell line, comprising the following steps:

[0037] The CRISPR donor plasmid 1 and the Cas9 / gRNA recombinant vector 1 were co-transfected into embryonic stem cell lines, and single reporter cell lines were screened;

[0038] Co-transfecting the CRISPR donor plasmid 2 and the Cas9 / gRNA recombinant vector 2 into the single reporter cell line, and screening to obtain the dual reporter cell line;

[0039] The CRISPR donor plasmid 1 is used to insert the mRuby3 reporter gene and the secNluc reporter gene into the PECAM1 gene;

[0040] The Cas9 / gRNA recombinant vector 1 is used to express Cas9 and gRNA targeting PECAM1;

[0041] The CRISPR donor plasmid 2 is used to insert the eGFP reporter gene into the ACTA2 gene;

[0042] The Cas9 / gRNA recombinant vector 2 is used to express Cas9 and gRNA targeting ACTA2.

[0043] In the present invention, the CRISPR donor plasmid 1 is used to insert the mRuby3 reporter gene and the secNluc reporter gene into the PECAM1 gene. Preferably, the CRISPR donor plasmid 1 contains the PECAM1 left homology arm sequence, the mRuby3 gene, the secNluc gene and the PECAM1 right homology arm sequence. In a specific embodiment of the present invention, the CRISPR donor plasmid 1 uses the plasmid backbone T2A-secNluc-PGK-Puro-floxed-BB-mClover3 as the starting vector to prepare the donor plasmid PECAM1-mRuby3-secNluc.

[0044] In the present invention, the Cas9 / gRNA recombinant vector 1 is used to express Cas9 and gRNA targeting PECAM1. Preferably, the nucleotide sequence of the gRNA targeting PECAM1 is as shown in SEQ ID NO.1, and the sequence of the gRNA is identical to the 20 base pair sequence near the PECAM1 stop codon.

[0045] In the present invention, the CRISPR donor plasmid 2 is used to insert the eGFP reporter gene into the ACTA2 gene. Preferably, the eGFP reporter gene is inserted into the end of the ACTA2 gene. In the present invention, the CRISPR donor plasmid 2 preferably contains the ACTA2 left homology arm sequence, the P2A gene, the eGFP gene, the PGK promoter, the PuroR gene, and the ACTA2 right homology arm sequence. In a specific embodiment of the present invention, the CRISPR donor plasmid 2 adopts the commercially available donor plasmid Addgene number: 126705.

[0046] In the present invention, the Cas9 / gRNA recombinant vector 2 is used to express Cas9 and gRNA targeting ACTA2. Preferably, the Cas9 / gRNA recombinant vector 2 is pU6-ACTA2_gRNA1-SpCas9-T2A-GFP. In a specific embodiment of the present invention, the Cas9 / gRNA recombinant vector 2 uses the commercially available gRNA plasmid Addgene number: 126706.

[0047] The present invention also provides a dual-reporter cell line prepared by the above construction method.

[0048] The present invention also provides the use of the dual reporter cell line in preparing an in vitro angiogenesis model.

[0049] The present invention also provides a method for preparing an in vitro angiogenesis model, comprising the following steps:

[0050] The dual reporter cell line is subjected to vascular organoid differentiation induction culture to obtain vascular organoids;

[0051] mixing the vascular organoid with a hydrogel to obtain a mixture;

[0052] The mixture is mixed with angiogenesis medium and induced to form a vascular network to obtain an in vitro angiogenesis model.

[0053] In the present invention, the dual reporter cell line is preferably first subjected to subculture differentiation to obtain mesodermal progenitor cells, and then the mesodermal progenitor cells are digested and resuspended, and induced to culture to obtain vascular organoids.

[0054] In the present invention, the diameter of the vascular organoid is about 100-200 μm; the hydrogel is preferably obtained by mixing basement membrane matrix and type I collagen in a volume ratio of 2 to 4:1; in the present invention, the mixing of the vascular organoid and the hydrogel preferably includes the following steps: allowing the hydrogel to stand and solidify, resuspending the vascular organoid with the hydrogel, adding it to the upper layer of the solidified hydrogel, and obtaining a mixture after solidification again.

[0055] In the present invention, the angiogenesis medium refers to a medium that can induce organoids to generate vascular networks. In a specific embodiment of the present invention, the angiogenesis medium comprises the following components: StemPro-34SFM, Supplement, FBS, Pen / Strep, FGF2 and VEGFA.

[0056] The present invention also provides an in vitro angiogenesis model prepared by the above preparation method, wherein the in vitro angiogenesis model can accurately label endothelial cells and smooth muscle cells by fluorescence, clearly observe the morphological characteristics of the network, and demonstrate the interaction between endothelial cells and smooth muscle cells.

[0057] The present invention also provides the use of the above-mentioned in vitro angiogenesis model in the screening of pro-angiogenesis drugs and / or anti-angiogenesis drugs. Specifically, the drugs that promote or inhibit angiogenesis can be identified by observing the area of ​​the vascular network, the fluorescent signals of endothelial cells and smooth muscle cells after the application of the drugs.

[0058] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0059] Example

[0060] In the present invention, the design diagram of the dual reporter cell line construction is as follows Figure 1 The specific construction method is as follows:

[0061] 1. Construction of corresponding gRNA and donor plasmid

[0062] 1.1 Construction of plasmids expressing Cas9 and PECAM1 site gRNA

[0063] 1) Obtain linearized vector: Starting with the plasmid backbone pSpCas9(BB)-2A-Puro(PX459)V2.0, the backbone was digested with the IIS type restriction endonuclease BbsI to obtain the linearized vector after digestion. Prepare the following reaction system in a PCR tube: 3μg pSpCas9(BB)-2A-Puro(PX459)V2.0, 1.5μl BbsI-HF (10 units / μl), 4μl 4×rCutSmart Buffer, and fill to 40μl with double-distilled water (ddH2O), vortex mix and centrifuge for a short time, then react in a thermal cycler at 37°C for 30min. After the reaction, purify the reaction product with a DNA purification kit (column purification method) to obtain a linearized vector. The left sticky end of the vector is GGTG (5'-3'), and the right sticky end is GTTT (5'-3').

[0064] 2) Obtain oligo DNA by annealing a 20-base pair gRNA sequence identical to the sequence near the PECAM1 stop codon and a primer with a base sequence complementary to the sticky end. The gRNA sequence used is: 5'-TTGATGGAACTTAGACAGCA-3' (as shown in SEQ ID NO.1). The sequence of the targeted endogenous PECAM1 gene is 5'-TTGATGGAACTTAGACAGCAAGG-3' (as shown in SEQ ID NO.2), wherein the terminal AGG is the PAM sequence. Prepare the following reaction system in a PCR tube: 1 μl forward primer (100 μM / μl), 1 μl reverse primer (100 μM / μl), 1 μl 10×T4 DNA ligase reaction buffer, 7 μl ddH2O. Vortex to mix and centrifuge briefly, then react in a thermal cycler at 95°C for 5 min, 95°C for 12 min (-0.1°C / s) to obtain the target oligo DNA.

[0065] 3) Connect the linearized vector to oligo DNA: Prepare the following reaction system in a PCR tube: 1 μl T4 DNA ligase (400 units / μl), 1 μl 10×T4 DNA ligase reaction buffer, 1 μl oligo DNA (100 μM / μl), 1 μl linearized vector (75 ng / μl), 6 μl ddH2O, vortex to mix and centrifuge briefly, then react in a thermal cycler at 25°C for 30 min.

[0066] 4) Plasmid transformation and single clone screening: After the vector is connected, add 10μl of the reaction solution to 100μl of DH5α competent E. coli, flick to mix, place at room temperature for 2 minutes, and evenly spread 100μl of the bacterial solution on a 10cm solid lysogeny broth (Lysogeny Broth, LB) culture plate with ampicillin resistance. Incubate inverted at 37°C in a constant temperature incubator overnight. The next day, about 100 single colonies grew in the culture plate. Use a 200μl sterilized pipette tip to pick up the single colony into 2ml of LB liquid culture medium with ampicillin resistance. After culturing on a constant temperature shaker at 37°C 250rpm for 4-5h, extract the plasmid for Sanger sequencing to verify whether the plasmid sequence is correct.

[0067] 1.2 Construction of donor plasmid PECAM1-mRuby3-secNluc

[0068] 1) Obtain linearized vector: plasmid backbone

[0069] Starting from T2A-secNluc-PGK-Puro-floxed-BB-mClover3, the map of the plasmid backbone is shown as follows Figure 7 As shown. The backbone has the sequence of T2A-secNluc, i.e., secretory nanoluciferase, and also has a constitutively expressed enhanced green fluorescent protein gene (Enhanced Green Fluorescence Protein, EGFP) and a puromycin resistance gene (PuroR) for monoclonal screening. The backbone is digested with restriction endonuclease HpaI to obtain a linearized vector with blunt ends after digestion. Prepare the reaction system in a PCR tube: 3 μg

[0070] T2A-secNluc-PGK-Puro-floxed-BB-mClover3, 1.5μl HpaI (5 units / μl), 4μl 4×rCutSmart Buffer, and fill to 40μl with double-distilled water (ddH2O), vortex mix and centrifuge briefly, and then react in a thermal cycler at 37°C for 30min. After the reaction, purify the reaction product with a DNA purification kit (column purification method) to obtain a linearized vector.

[0071] 2) Obtaining PECAM1 homology arm sequence: Using embryonic stem cell genome as PCR template, amplify PECAM1 homology arm sequence with forward primer PECAM1-GF: 5'-GGGTGCTTGATGAAGTTACTTGG-3' (as shown in SEQ ID NO.3) and reverse primer PECAM1-GR: 5'-ACTGATGGCCGTTCAC GC-3' (as shown in SEQ ID NO.4) under the action of high-fidelity DNA polymerase. Prepare the following reaction system in a PCR tube: 12.5μl 2× PrimeStar Max Premix, 1μl forward primer, 1μl reverse primer, 50ng PCR template, and fill to 25μl with ddH2O. Perform the reaction in a thermal cycler with a PCR program of 98℃2min, 35 cycles (98℃15s, 60℃5s, 72℃15s), and 72℃2min. After adding 5×DNA gel electrophoresis loading buffer to the PCR reaction product, 1.5% agarose gel electrophoresis was performed to separate the bands, and the target band was cut under blue light. After the reaction, the reaction product was purified using a DNA purification kit (column purification method) to obtain the target product. Further, 50 ng of the target product was used as a PCR template and the same PCR reaction system and thermal cycle program as above were used to amplify the left homology arm and the right homology arm sequence. The forward primer used to amplify the left homology arm was PECAM1-HAL-F: 5'-GGTACCGAGCTCGTTCCAACAT GTATGCAGGGACAGA-3' (as shown in SEQ ID NO.5), and the reverse primer was PECAM1-HAL-R: 5'-ACCAGAACCACCACCAGAACCACCAGTTCCATCAAGGG AGCCTT-3' (as shown in SEQ ID NO.6). The forward primer used to amplify the right homology arm was PEC AM1-HAR-F: 5'-AGGCGCGCCTACAATACAGCAAGGCCAGATGCAC-3' (as shown in SEQ ID NO.7), and the reverse primer was PECAM1-HAR-R: 5'-TCGAAATGTTTGAATGAACATCTGTGCTTGTTCCACC-3' (as shown in SEQ ID NO.8).

[0072] 3) Obtaining the sequence of mRuby3: mRuby3 was stored in a pUC19 vector by gene synthesis, and the sequence of mRuby3 was ATGGTGAGCAAGGGCGAGGAGCTGATCAAGGAGAAC (as shown in SEQ ID NO.9). The above vector was used as a PCR template, and the fragment was amplified according to the reaction steps described in 2). The forward primer used was mRuby3-F: 5'-GGTGGTGGTTCTGGTGTGAGCAAGGGCGAGGAG-3' (as shown in SEQ ID NO.10), and the reverse primer was mRuby3-R: 5'-TCCTCTGCCCTCGTTCTTGTACAGCTC GTCCATGC-3' (as shown in SEQ ID NO.11).

[0073] 4) Connect the vector by Gibson Assembly: Mix the linearized vector with the left homology arm sequence amplified in 2) and perform the ligation reaction under the mixed enzyme system of 5' exonuclease, Phusion DNA polymerase and Taq DNA ligase. Prepare the following reaction system in a PCR tube: 152.5ng linearized plasmid backbone, 12ng left homology arm sequence, 14ng mRuby3 sequence, 5μl 2×ClonExpress Mix, and fill to 10μl with ddH2O. Perform the reaction in a thermal cycler with a PCR program at 50℃ for 15min. After the reaction, the product was cloned and screened according to the operating steps of 4) in 1.1 to obtain the target vector with the correct sequence.

[0074] 5) The vector obtained in 3) was further digested with restriction endonuclease SspI according to the above method, and then the right homology arm was connected according to the method described in 4) to obtain the donor plasmid PECAM1-mRuby3-secNluc.

[0075] 2. Stem cell culture and construction of reporter cell lines

[0076] 2.1 Stem cell culture

[0077] Stem cells were cultured using Matrigel and serum-free stem cell culture medium mTeSR1. When the cell density reached 80%-90%, the cells were digested with EDTA for passage to maintain the normal morphology and function of the stem cells.

[0078] 2.1.1 Preparation of stem cell maintenance medium

[0079] Table 1 Preparation of stem cell maintenance medium

[0080] Total volume Final concentration 500ml 100ml 50ml mTeSR1 Basal Medium - 400ml 80ml 40ml mTeSR1 Supplement (5×) 1× 100ml 20ml 10ml Pen / Strep(100-×) 0.2× 1ml 200 μl 100μl

[0081] 2.1.2 Stem Cell Medium Replacement

[0082] Every 24 h, the culture medium in the 6-well plate was discarded and replaced with 2 ml of stem cell maintenance medium per well.

[0083] 2.1.3 Passaging of stem cells

[0084] 1) Dilute the Matrigel Matrix stock solution into DMEM / F12 at 1:500 and mix well. Add 1 ml of the diluted Matrigel Matrix to each well of a 6-well plate and coat the plate at room temperature for 30 minutes.

[0085] 2) The medium in the 6-well plate containing stem cells was discarded, 2 ml of 1×PBS was added to each well for washing, and the 6-well plate was gently shaken to wash away the dead cells in the wells, and then the PBS was discarded.

[0086] 3) Add 0.5 mM EDTA at 1 ml per well and place the cells back into a 37°C 5% CO2 cell culture incubator.

[0087] 4) After 6 min, remove the cells, discard the EDTA in the wells, add 1 ml of stem cell maintenance medium to each well and blow the cells to make them fall off, collect the cell suspension into a 15 ml centrifuge tube, and fill it up to 12 ml with 6 ml of stem cell maintenance medium. At the same time, add Y27632 with a final concentration of 5 μM to the cell suspension, and invert the centrifuge tube to mix the cells.

[0088] 5) Discard the DMEM / F12 in the coated culture plate, add 2 ml of the cell suspension in 4) to each well of the 6-well plate, move the culture plate up and down and left and right 10 times to evenly spread the cells in the wells, and culture the cells in a 37°C 5% CO2 cell culture incubator.

[0089] 2.2 Plasmid electroporation

[0090] 1) Add 1 ml of diluted Matrigel Matrix to one well of a 6-well plate and coat the plate at room temperature for 30 minutes.

[0091] 2) Discard the culture medium in the 6-well plate containing stem cells, take cells from one well, add 2 ml 1×PBS for washing, gently shake the 6-well plate to wash away dead cells in the well, and then discard the PBS.

[0092] 3) Add 1 ml of 0.5 mM EDTA and place the cells back into a 37°C 5% CO2 cell culture incubator.

[0093] 4) After 6 minutes, remove the cells, gently blow to remove the cells and form a uniform cell suspension, add 1 ml of DMEM / F12 to terminate digestion, transfer the cells to a centrifuge tube, and centrifuge at 300g for 3 minutes.

[0094] 5) Discard the supernatant in the centrifuge tube, resuspend the cells with 2 ml of 1× PBS, and centrifuge at 300 g for 3 minutes.

[0095] 6) Add 100 μl stem cell maintenance medium to resuspend and transfer the cells to a 1.5 μl EP tube, add 1 μg of the sgRNA plasmid constructed in 1.1 and 2 μg of the donor plasmid constructed in 1.2 and mix well.

[0096] 7) Add the mixed cell suspension to the electroporation cup and call the program B-016 in the Lonza electroporator (model: Nucleofector2B) for electroporation. After the electroporation is completed, add 200 μl of stem cell maintenance medium to the electroporation cup. Discard the DMEM / F12 in the coated culture plate, transfer the cells to the well, add stem cell maintenance medium to make the final volume 2 ml, and add Y27632 with a final concentration of 5 μM. Move the culture plate up and down and left and right 10 times to evenly spread the cells in the well, and culture the cells in a 37°C 5% CO2 cell culture incubator.

[0097] 2.3 Drug screening and monoclonal screening

[0098] 1) 24 hours after electroporation, discard the culture medium in the wells and add 2 ml of stem cell maintenance medium.

[0099] 2) 48 h after electroporation, the culture medium in the wells was discarded and supplemented with 2 ml of stem cell maintenance medium, and puromycin was additionally added at a final concentration of 1 μg / ml for drug screening.

[0100] 3) Repeat the steps in 2) every 24 hours 72-108 hours after electroporation.

[0101] 4) After drug screening, cells with negative green fluorescence were sorted by flow cytometry, and 5 ml of diluted Matrigel Matrix was added to the 10-cm cell culture dish to coat the culture plate for 30 min at room temperature.

[0102] 5) Discard the culture medium in the wells of the sorted cells, wash once with 2 ml 1×PBS, add 1 ml 1×TrypLEExpress, and put the cells back into a 37°C 5% CO2 cell culture incubator. Take them out after 3 minutes, gently blow to remove the cells and form a uniform cell suspension, add 1 ml DMEM / F12 to terminate digestion, and transfer the cells to a centrifuge tube. Centrifuge at 300g for 3 minutes in a centrifuge.

[0103] 6) Discard the supernatant in the centrifuge tube, resuspend the cells with 4 ml 1×PBS, filter with a 40 μl single cell filter, take 10 μl and add it to a hemocytometer for counting.

[0104] 7) Discard the DMEM / F12 in the coated culture dish and add 8 ml of stem cell maintenance medium. According to the counting results in 6), take 3000 single cells and add them to the culture dish. At the same time, add Y27632 with a final concentration of 5 μM. Move the culture dish up and down and left and right 10 times to evenly spread the cells in the wells. Culture the cells in a 37°C 5% CO2 cell culture incubator.

[0105] 8) Every 3 days thereafter, discard the old culture medium in the culture dish and add 8 ml of stem cell maintenance medium.

[0106] 9) After about 7-10 days, cell clones of moderate size can be observed.

[0107] 10) Add 300 μl of the diluted Matrigel Matrix to each of the 8 wells in a 24-well plate for coating the culture plate and coat at room temperature for 30 minutes.

[0108] 11) Discard the DMEM / F12 in the coated culture plate and add 500 μl stem cell maintenance medium to each well. Take out the 10-cm culture dish containing the single clone, pick the clone into a 24-well plate with a 200 μl pipette under a microscope, add Y27632 at a final concentration of 5 μM, move the culture dish up and down and left and right 10 times to evenly spread the cells in the wells, and culture the cells in a 37°C 5% CO2 cell culture incubator.

[0109] 12) When the cell density reaches 80-90%, perform stem cell passaging according to the method described in 2.1.3.

[0110] 2.4 Resistance gene excision

[0111] 1) Electroporation of stem cells was performed according to the method in 2.2, and the nucleic acid used was mRNA expressing Cre recombinase, with a dosage of 3 μg.

[0112] 2) 72 hours after electroporation, perform monoclonal screening according to steps 5)-12) in 2.3 to obtain the excised cell line.

[0113] 2.5 Construction of dual reporter cell lines

[0114] After completing steps 2.1-2.4, a stem cell line carrying PECAM1-mRuby3-secNluc editing was obtained, and steps 2.2-2.4 were further repeated on this single reporter cell line using the ACTA2-EGFP related plasmid (donor plasmid Addgene number: 126705, gRNA plasmid Addgene number: 126706) to obtain the PECAM1-mRuby3-secNluc; ACTA2-EGFP dual reporter cell line.

[0115] 3. Construction of an in vitro visual angiogenesis model using dual reporter cell lines

[0116] 3.1 Differentiation of vascular organoids and induction of angiogenesis

[0117] 1) Stem cells were seeded into 6-well plates as described in 2.1.3, with a seeding density of 5×10 5 per hole.

[0118] 2) Prepare the stage 1 vascular organoid differentiation medium as described in Table 2. Replace 2 ml of stage 1 vascular organoid differentiation medium per well 24 hours after passage, and then replace all the medium every day for 3 days. After 96 hours of passage, the differentiated cells are mesodermal progenitor cells.

[0119] Table 2 Stage 1 Vascular Organoid Differentiation Medium Preparation

[0120] Total volume Final concentration 500ml 100ml 50ml Advanced DMEM / F12 - 488ml 97ml 49ml GlutaMAX(100×) 1× 5ml 1ml 500μl Vc (30mg / ml) 60μg / ml 1 ml 0.2ml 0.1ml ITS-X(100×) 1× 5ml 1ml 500μl Pen / Strep(100×) 0.2× 1ml 200 μl 100μl CHIR99021(20mM) 6μM 150μl 30μl 15μl

[0121] 3) Prepare the stage 2 vascular organoid differentiation medium as described in Table 3, digest the mesodermal progenitor cells with 1×TrypLEExpress to form a single cell suspension, resuspend with stage 2 vascular organoid differentiation medium and add to a 6-well plate without surface treatment at a seeding density of 1,000,000 cells / ml, 4 ml per well. Place the 6-well plate on a horizontal shaker and culture at a speed of 130 rpm. After that, half of the medium was replaced daily, and differentiation continued for a total of 3 days. Vascular organoids with a diameter of approximately 100-200 μm were obtained 72 hours after the mesodermal progenitor cells were seeded, such as Figure 2 shown.

[0122] Table 3 Stage 2 Vascular Organoid Differentiation Medium Preparation

[0123]

[0124]

[0125] 4) Prepare angiogenesis medium as described in Table 4, and prepare hydrogel obtained by mixing type I collagen and Matrigel (volume ratio of 3:1). Add 100 μl of hydrogel to one well of a 48-well plate and place in a 37°C carbon dioxide incubator for 2 hours.

[0126] Table 4 Angiogenesis medium preparation

[0127] Total volume Final concentration 500ml 100ml 50ml StemPro-34SFM - 413ml 83ml 41ml Supplement(50×) 1× 10ml 2ml 1ml FBS 15％ 75ml 15ml 7.5ml Pen / Strep(100×) 0.2× 1ml 200 μl 100μl FGF2 (100 μg / ml) 100ng / ml 500μl 100μl 50μl VEGFA (100 μg / ml) 100ng / ml 500μl 100μl 50μl

[0128] 5) After the hydrogel solidifies, add about 20 vascular organoids into a 1.5 ml EP tube, resuspend with 100 μl of hydrogel, add to the solidified hydrogel layer, and place in a 37°C carbon dioxide incubator for 2 h.

[0129] 6) After the hydrogel solidifies again, 200 μl of angiogenesis medium is added to each well to induce the vascular organoids to form a vascular network in the hydrogel, and the cells are returned to the carbon dioxide incubator for culture. The entire angiogenesis medium is then replaced every 2 days for a total of 5 days.

[0130] 3.2 Imaging of vascular networks

[0131] 1) After 5 days of vascular network formation, the culture medium was discarded, 200 μl of 4% paraformaldehyde was added, and fixed at room temperature for 30 minutes.

[0132] 2) Discard the paraformaldehyde, add 200 μl PBS, and store at 4 degrees.

[0133] 3) During imaging, the pancake-shaped hydrogel containing the vascular network was transferred to a confocal dish using tweezers, and observed and photographed using a confocal microscope. Figure 3 Demonstrated the use of

[0134] The vascular network obtained by the PECAM1-mRuby3-secNluc; ACTA2-EGFP dual reporter system shows that fluorescence accurately labels endothelial cells and smooth muscle cells, and the morphological characteristics of the network can be clearly observed. The yellow arrows show the interaction between endothelial cells and smooth muscle cells, indicating that the model highly restores the real structure of blood vessels in vivo.

[0135] 4. High-throughput drug screening using bioluminescence

[0136] 1) Obtain vascular organoids embedded in hydrogel as described in 3.1 and add angiogenesis medium and culture for 24 hours.

[0137] 2) After 24 hours, the culture supernatant was collected and stored in a -80℃ refrigerator, and replaced with 200μl angiogenesis medium containing different drugs. The drugs and concentrations used were Repsox (1μM), Futibatinib (10μM), SU16f (10μM), SB431542 (5μM), Wnt-C59 (2μM), DAPT (25μM), SU5416 (5μM), PHA-665752 (10μM), Verteporfin (0.5μM), LDN193189 (10μM), and CHIR99021 (6μM). The control group was stimulated with an equal volume of DMSO, recorded as DMSO.

[0138] 3) After 48 h of replacing the angiogenesis medium containing different drugs, the culture supernatant was collected and stored in a -80°C refrigerator (recorded as day 3), and the same medium was replaced again.

[0139] 4) After 48 hours, the culture supernatant was collected and stored in a -80°C refrigerator (recorded as day 5). The vascular network in the hydrogel was fixed and imaged as described in 3.2.

[0140] 5) Thaw and mix the culture supernatant collected above, add 20 μl of supernatant of each group, 80 μl ddH2O and 100 μl 50 μM Furimazine to the ELISA plate, shake well and let stand at room temperature in the dark for 10 min.

[0141] 6) After 10 minutes, bioluminescence detection was performed using an ELISA instrument, and the obtained values ​​were statistically analyzed. Figures 4-5 As shown, SU5416, PHA-665752, Verteporfin, LDN193189 and CHIR99021 have an inhibitory effect on angiogenesis, while Repsox has a promoting effect on angiogenesis.

[0142] 7) Further verification is performed based on the fluorescence images after stimulation of the vascular network, such as Figure 6 As shown, after the application of Repsox, the area of ​​the vascular network was larger than that of the group without stimulation, and the fluorescence signals of endothelial cells and smooth muscle cells were not affected. However, after the application of PHA-665752, the vascular network disappeared, indicating that this high-throughput screening system can identify potential drugs that promote or inhibit angiogenesis.

[0143] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A method for constructing a dual reporter cell line, characterized in that: The following steps are involved: The CRISPR donor plasmid 1 and the Cas9 / gRNA recombinant vector 1 were co-transfected into embryonic stem cell lines, and single reporter cell lines were screened; Co-transfecting the CRISPR donor plasmid 2 and the Cas9 / gRNA recombinant vector 2 into the single reporter cell line, and screening to obtain the dual reporter cell line; The CRISPR donor plasmid 1 is used to insert the mRuby3 reporter gene and the secNluc reporter gene c into the PECAM1 gene; The Cas9 / gRNA recombinant vector 1 is used to express Cas9 and gRNA targeting PECAM1; The CRISPR donor plasmid 2 is used to insert the eGFP reporter gene into the ACTA2 gene; The Cas9 / gRNA recombinant vector 2 is used to express Cas9 and gRNA targeting ACTA2.

2. The method for constructing a dual reporter cell line according to claim 1, characterized in that: The CRISPR donor plasmid 1 contains the PECAM1 left homology arm sequence, the mRuby3 gene, the secNluc gene and the PECAM1 right homology arm sequence.

3. The method for constructing a dual reporter cell line according to claim 1, characterized in that: The nucleotide sequence of the gRNA targeting PECAM1 is shown in SEQ ID NO.

1.

4. The method for constructing a dual reporter cell line according to claim 1, characterized in that: The CRISPR donor plasmid 2 contains the ACTA2 left homology arm sequence, the P2A gene, the eGFP gene, the PGK promoter, the PuroR gene, and the ACTA2 right homology arm sequence.

5. The method for constructing a dual reporter cell line according to claim 1, characterized in that: The Cas9 / gRNA recombinant vector 2 is pU6-ACTA2_gRNA1-SpCas9-T2A-GFP.

6. A dual reporter cell line obtained by the construction method according to any one of claims 1 to 5.

7. Use of the dual reporter cell line according to claim 6 in preparing an in vitro angiogenesis model.

8. A method for preparing an in vitro angiogenesis model, characterized in that: The following steps are involved: Carrying out vascular organoid differentiation induction culture on the dual reporter cell line of claim 6 to obtain vascular organoids; mixing the vascular organoid with a hydrogel to obtain a mixture; The mixture is mixed with angiogenesis medium and induced to form a vascular network to obtain an in vitro angiogenesis model.

9. An in vitro angiogenesis model prepared by the preparation method according to claim 8.

10. Use of the in vitro angiogenesis model according to claim 9 in screening of pro-angiogenesis drugs and / or anti-angiogenesis drugs.

Images