Application of miR1850 in regulation and control of resistance of rice to rice serrated leaf dwarf virus

Abstract

The invention discloses application of miR1850 in regulation and control of resistance of rice to rice serrated leaf dwarf virus, and discloses induction of RRSV to miR1850, a function of miR1850 in interaction of rice and RRSV, and virus resistance of rice can be changed by controlling accumulation of miR1850. On the basis, the low-abundance miR1850 can be used as a screening index of the rice anti-virus variety, and the discovery provides a basis for screening an anti-virus target gene at the downstream of the miR1850, so that the anti-virus screening range is favorably narrowed, and the cultivation of a multi-target anti-virus variety based on MIR1850 mediation is accelerated.

Description

Technical Field

[0001] The invention relates to the field of plant genetic engineering and biotechnology, and in particular to application of miR1850 in regulating rice resistance to rice sawtooth leaf dwarf virus. Background Art

[0002] Rice is an important food crop in my country and occupies a pivotal position among my country's food crops. Its high and stable yield is directly related to the national economy, people's livelihood and social stability. However, rice faces many threats during its growth, including biological factors such as bacteria, fungi, and viruses, as well as abiotic factors such as extreme temperature, saline ions, and heavy metals. Among them, rice virus disease is one of the main diseases. Once it breaks out, there is a lack of economical and efficient control measures. At present, rice varieties in production generally lack the ability to resist viral diseases, and relatively few antiviral gene resources have been identified. In the application of antiviral genes, the rational use of antiviral germplasm resources and the cultivation of antiviral varieties are key strategies for effective prevention and control of viral diseases. However, there are many challenges in cultivating new rice varieties with high yield, stable yield and antiviral properties. For example, high expression of major antiviral proteins may bring serious developmental costs, making it difficult to balance development and immunity at the same time, and the application is greatly hindered. Therefore, finding more dominant or recessive antiviral-related gene resources has important practical value and significance.

[0003] Rice ragged stunt virus (RRSV) was first discovered in Southeast Asia in 1976. It is a common viral disease in rice production. It belongs to the genus Oryzavirus of the family Reoviridae and is mainly transmitted by the virus vector brown planthopper. Rice infected with RRSV shows dwarfing, increased tillering, curled leaf tips, dark green leaves, serrated notches on the leaf margins, and abnormal or no fruiting. RRSV has successively spread to Japan, India, Vietnam, the Philippines and other places. It currently poses a serious threat to rice production in Guangdong, Guangxi, Fujian and Taiwan in my country, and poses a great harm to agricultural production.

[0004] RNA interference (RNAi) is a conservative and efficient antiviral strategy. Using its principle to silence the viral components of RRSV in rice significantly improves the resistance of rice to RRSV. Therefore, the rational transformation of the RNAi antiviral pathway has important application potential in the cultivation of rice antiviral germplasm. In the RNAi process, small RNA (sRNA) plays a key role. sRNA binds to AGO protein and guides the RNA-induced silencing complex to recognize the target nucleic acid sequence of the virus or host, thereby affecting the resistance of plants to viruses by inducing the degradation of mRNA or inhibiting translation. MicroRNA (miRNA) is a type of sRNA, which usually acts as a negative regulator of functional proteins and widely regulates the growth and development of plants. The functional loss of MIRNA often leads to enhanced function of the target protein. Therefore, by screening MIRNA functional loss mutants through antiviral phenotypes, antiviral genes can be discovered and antiviral varieties can be cultivated. Studies have shown that the MIR528 functional loss mutant increases the content of rice ascorbate oxidase, positively regulates the accumulation of reactive oxygen species, and enhances the resistance of rice to viruses. The target of miR168 is AGO1, a key component of the RNAi pathway, which negatively regulates rice's resistance to viruses. AGO18, as a protective factor of AGO1, enhances rice's resistance to viruses by consuming the content of miR168. At present, the functional research of miRNA is mostly focused on conservative miRNAs. The background expression abundance of non-conservative miRNAs is generally low, and the regulation by biotic and abiotic stresses is more specific, resulting in a large number of non-conservative miRNAs in the interaction between rice and viruses. In previous studies, we found through high-throughput sequencing that the accumulation of miR1850 in rice infected with RRSV increased significantly, but its specific function in the interaction between rice and viruses is still unclear. MIR1850 is located on chromosome 5 of rice and is mainly expressed in spikelets, stems, inflorescences, leaves and seeds. At present, there is little research on miR1850, and its function and regulatory mechanism need to be further explored. In-depth research on the functions and mechanisms of these miRNAs will provide an important theoretical basis for breeding antiviral rice.

[0005] The length of mature miRNA is generally 21-24nt, and it can complete recognition and function without completely matching the target, so one miRNA can target multiple genes. Therefore, the use of miRNA to screen new antiviral genes can improve the screening efficiency. miR1850 is a non-conservative miRNA, which is induced by RRSV and its accumulation amount increases significantly, but its function and mechanism in the interaction between rice and RRSV are not yet clear. The present invention uses Agrobacterium-mediated genetic transformation technology to create rice materials with enhanced and weakened functions of MIR1850, and uses group inoculation to reveal its function in the interaction between rice and viruses. This has important practical significance and application prospects for discovering new antiviral sites and accelerating the excavation and improvement of rice antiviral resources. Summary of the invention

[0006] In view of this, the object of the present invention is to propose a method for implementing and applying miR1850 which is reliable, flexible and can regulate rice resistance to rice serrated leaf dwarf virus and to use the miR1850 in regulating rice resistance to rice serrated leaf dwarf virus.

[0007] In order to achieve the above technical objectives, the technical solution adopted by the present invention is:

[0008] A miRNA, designated as miR1850, has a nucleotide sequence as shown in SEQ ID NO.1.

[0009] This solution also provides a miRNA precursor, which is set as Pre-miR1850, and its nucleotide sequence is shown in SEQ ID NO.7.

[0010] This solution also provides the use of regulating the expression or accumulation of miRNA and / or miRNA precursor in enhancing the resistance of rice to sawtooth leaf dwarf virus. The nucleotide sequence of the miRNA is shown in SEQ ID NO.1; the nucleotide sequence of the miRNA precursor is shown in SEQ ID NO.7.

[0011] The present solution also provides the use of miRNA or miRNA precursor biological materials in enhancing the resistance of rice to sawtooth leaf dwarf virus. The nucleotide sequence of the miRNA is shown in SEQ ID NO.1; the nucleotide sequence of the miRNA precursor is shown in SEQ ID NO.7.

[0012] As a possible optional implementation, further, the biomaterial described in this solution is any one of the following A1) to A12):

[0013] A1) a nucleic acid molecule encoding the miRNA according to claim 1 or the miRNA precursor according to claim 2;

[0014] A2) an expression cassette containing the nucleic acid molecule described in A1);

[0015] A3) a recombinant vector containing the nucleic acid molecule described in A1);

[0016] A4) a recombinant vector containing the expression cassette described in A2);

[0017] A5) a recombinant microorganism containing the nucleic acid molecule described in A1);

[0018] A6) a recombinant microorganism containing the expression cassette described in A2);

[0019] A7) a recombinant microorganism containing the recombinant vector described in A3);

[0020] A8) a recombinant microorganism containing the recombinant vector described in A4);

[0021] A9) a transgenic plant cell line containing the nucleic acid molecule described in A1);

[0022] A10) a transgenic plant cell line containing the expression cassette described in A2);

[0023] A11) a transgenic plant cell line containing the recombinant vector described in A3);

[0024] A12) A transgenic plant cell line containing the recombinant vector described in A4).

[0025] By adopting the above technical scheme, the present invention has the following beneficial effects compared with the prior art: the scheme discloses the induction of miR1850 by RRSV and reveals the function of miR1850 in the interaction between rice and RRSV; the resistance of rice to the virus is changed by manipulating the accumulation of miR1850, which provides a basis for screening antiviral target genes downstream of miR1850 and also provides a reference for the cultivation of multi-target antiviral varieties mediated by miR1850. Low-abundance miR1850 can be used as a screening indicator for antiviral rice varieties, narrowing the scope of antiviral screening and accelerating the selection and breeding process of antiviral germplasm resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0027] Figure 1qRT-PCR was used to detect the accumulation of miR1850 in rice infected with the virus; Mock represented rice that was not infected with RRSV after being fed by brown planthoppers, and RRSV represented rice that acquired RRSV after being fed by brown planthoppers; compared with Mock, the accumulation of miR1850 in rice was significantly increased after infection with RRSV, indicating that RRSV induced the accumulation of miR1850.

[0028] Figure 2 The accumulation of mature miR1850 in transgenic rice OX1850, MIM1850 and mir1850 was detected by qRT-PCR; OX1850 represents transgenic rice overexpressing MIR1850, MIM1850 represents transgenic rice overexpressing MIR1850 mimic target to achieve silencing of miR1850 function; mir1850 represents transgenic rice edited with MIR1850 precursor sequence using CRISPR / Cas9 technology. As shown in the figure, compared with wild-type ZH11, the accumulation of miR1850 in OX1850 was significantly increased; while the accumulation of miR1850 in MIM1850 and mir1850 was significantly reduced, indicating that transgenic rice with altered miR1850 accumulation was obtained.

[0029] Figure 3 The figures show the symptoms of wild-type rice and transgenic rice expressing MIR1850 infected with RRSV; Mock represents the phenotype of ZH11 rice that is not infected with RRSV; the picture results show that the plant height of OX1850 infected with RRSV is shorter than that of ZH11 infected with RRSV, while the plant height of MIM1850 and mir1850 infected with RRSV is higher than that of ZH11 infected with RRSV, indicating that rice with reduced miR1850 accumulation shows milder symptoms after infection with RRSV.

[0030] Figure 4 qRT-PCR was used to detect the nucleic acid accumulation of the coat protein encoding gene CP in wild-type rice and transgenic rice of MIR1850 after infection with RRSV; the accumulation of RRSV in ZH11 was taken as 1. In comparison, the accumulation of RRSV coat protein gene in OX1850 was greater than 1, while the expression levels of RRSV coat protein gene in MIM1850 and mir1850 were lower than 1, indicating that reducing the accumulation of miR1850 significantly reduced the accumulation of RRSV in rice.

[0031] Figure 5Western blot was used to detect the accumulation of viral protein of coat protein in wild-type rice and MIR1850 transgenic rice after infection with RRSV. Under the condition of nearly the same accumulation level of ACTIN internal reference protein, the accumulation of RRSV coat protein in OX1850 was more than that in ZH11, while the accumulation of RRSV coat protein in MIM1850 and mir1850 was less than that in ZH11, indicating that reducing the accumulation of miR1850 significantly reduced the accumulation of RRSV coat protein in rice. DETAILED DESCRIPTION

[0032] The present invention will be further described in detail below in conjunction with the accompanying drawings and examples. It is particularly noted that the following examples are only used to illustrate the present invention, but are not intended to limit the scope of the present invention. Similarly, the following examples are only partial embodiments of the present invention rather than all embodiments, and all other embodiments obtained by those of ordinary skill in the art without creative work are within the scope of protection of the present invention.

[0033] Unless otherwise specified, the experimental methods used in the following examples of this scheme are all conventional methods.

[0034] Among them, the method for constructing the MIM vector of miRNA refers to Yan, J., Gu, Y., Jia, X., Kang, W., Pan, S., Tang, X., Chen, X., and Tang, G. (2012). Effective small RNA destruction by the expression of a short tandem target mimic in Arabidopsis. Plant cell 24, 415-427.

[0035] The construction of miRNA gene editing vector was based on Ma, X., Zhang, Q., Zhu, Q., Liu, W., Chen, Y., Qiu, R., Wang, B., Yang, Z., Li, H., Lin, Y., Xie, Y., Shen, R., Chen, S., Wang, Z., Chen, Y., Guo, J., Chen, L., Zhao, X., Dong, Z., and Liu, Y. (2015). A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Mol Plant 8, 1274-1284.

[0036] Rice virus transmission and detection methods refer to Zhang, C., Shi, C., Chen, D., and Wu, J. (2018). Rice Ragged Stunt Virus Propagation and Infection on Rice Plants. Bio-protocol 8, e3060.

[0037] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0038] Example 1. Detection of Osa-miR1850 (referred to as miR1850)

[0039] The wild-type rice Zhonghua 11 (ZH11) that was not infected with RRSV after feeding by brown planthoppers was used as a mock control, and the ZH11 infected with RRSV was used as an experimental group. Their above-ground parts were sampled, and total RNA was extracted and sent to the company for high-throughput sequencing of sRNA to screen microRNAs that respond to viral infection. Among them, miR1850 was induced by RRSV, and the accumulation amount increased significantly. The mature sequence of this miRNA is sequence 1 (SEQ ID NO.1). At the same time, using the extracted total RNA as a template, in the reverse transcription system of a conventional reverse transcription kit, the specific reverse transcription primer miR1850-RT (SEQ ID No.2) of miR1850 was added, and cDNA was obtained by the stem-loop reverse transcription method; the cDNA was diluted 5 times as a template for fluorescent quantitative PCR and qRT-PCR detection was performed. Among them, miR1850 was detected using fluorescent quantitative primers miR1850-qF (SEQ ID No.3) and miR1850-qR (SEQ ID No.4), and the U6 gene amplified by U6-qF (SEQ ID No.5) and U6-qR (SEQ ID No.6) was used as an internal reference to obtain the relative accumulation of miR1850. The specific sequence information is as follows:

[0040] miR1850 (SEQ ID NO.1): UGGAAAGUUGGGAGAUUGGGG

[0041] miR1850-RT(SEQ ID No.2):GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCCCAA

[0042] miR1850-qF (SEQ ID No.3): CGCGTGGAAAGTTGGGAGA

[0043] miR1850-qR(SEQ ID No.4):AGTGCAGGGTCCGAGGTATT

[0044] U6-qF (SEQ ID NO.5): CGATAAAATTGGAACGATACAGA

[0045] U6-qR(SEQ ID NO.6):ATTTGGACCATTTCTCGATTTGT

[0046] qRT-PCR results Figure 1 As shown, it was shown that RRSV infection induced the accumulation of miR1850.

[0047] Example 2: Cloning of miR1850 precursor sequence

[0048] Primer design

[0049] The keyword Osa-miR1850 was searched on the miRBase (https: / / www.mirbase.org / ) website, and the accession number MI0008227 was obtained, and its precursor sequence Pre-miR1850 (SEQ ID NO.7) was obtained. The precursor sequence size is 133 nucleotides. The base U in the precursor sequence of Pre-miR1850 was replaced with base T, and compared with the BLAST module on the NCBI (https: / / www.ncbi.nlm.nih.gov / ) website using this as a template. It was found that Pre-miR1850 was located on the negative strand at 26275207-26275339 of chromosome 5 of the Nipponbare rice genome. In this interval, 200 bp were extended upstream and downstream respectively to obtain the nucleic acid sequence LPre-miR1850 (SEQ ID NO.8) in the range of Chr5:26275007-26275546. This was used as a template to design the cloning primers OX1850-F (SEQ ID NO.9) and OX1850-R (SEQ ID NO.10) of Pre-miR1850 using Primer Premier 5.0, which were used to amplify the nucleic acid sequence extending 191 bp upstream and 200 bp downstream of Pre-miR1850. The lowercase letters in the amplification primers represent the restriction enzyme sites of XbaⅠ and PstⅠ, respectively. The specific sequence information is as follows:

[0050] Pre-miR1850 (SEQ ID NO.7): AUGUGAUGGAGAUGCGAUGGAAAGU UGGGAGAUUGGGGGAAGUUGUGUGUGAACUAAACGUGGAUUGGGGCCCUGUUUAGUUCACAUCAAUCUUCCUCCAAAUUCCCAACUUUUCAUCACAUCACAAUCACAU

[0051] LPre-miR1850 (SEQ ID NO.8): GGCCTTTACGCACCCATCTCAAAAAC GGTTACTAAAGATTTATTTATTTTGCCATATTTGATATAATTTATGTTCTCTGATTTTGTCTATCTTAACAGCCCGTCTTTCTATTTGTGTTAAACTTGAGCGTGAACTGATCTTGCTGTAGTGCTGCATCTGTGGATACAACAACCTACCATGAACCTACCATGATGTGATGGAGATGCGATGGAAAGTTGGGAGATTGGGGGAAGTTGTGTGTGAACTAAACGTGGATTGGGGCCCTGTTTAGTTCACATCAATCTTCCTCCAAATTCCCAACTTTTCATCACATCACAATCACATAAACTCTAATTTTTTTTCAAACTACCAACTGTCAAACTTTTTCTCAATTTCAGGATCTAAATGCAGACTGGATTGTGGATTGAAAATTGCGGCTGAAGAACGTGAACATTGAATGCAGACTGCTACATTCGCACTGTTTTGTATCAGTCCGTTAATTCTACAATATTTAGCTGTTTAGTAATTAAACAATGGTCCTGTCA

[0052] OX1850-F (SEQ ID NO.9): AAtctagaGGCCTTTACGCACCCATCT

[0053] OX1850-R (SEQ ID NO.10): GGctgcagTGACAGGACCATTGTTTAATTA CTA

[0054] Example 3. Construction of the vector for overexpressing miR1850

[0055] 1. Using the Nipponbare rice genome as a template, using the amplification primers OX1850-F (SEQ ID NO.9) and OX1850-R (SEQ ID NO.10) in Example 2, and using a high-fidelity DNA polymerase, a PCR reaction was performed to amplify the extended fragment LPre-miR1850 containing the Pre-miR1850 sequence, which was used to construct a vector for overexpressing miR1850. The amplified fragment was recovered by gel excision and used for subsequent experiments.

[0056] 2. The pCAMBIA2300-ACTIN1 vector and the extended DNA recovery fragment containing Pre-miR1850 obtained in step 1 were double-digested with restriction endonucleases XbaⅠ and PstⅠ, and the large vector fragment and PCR product digestion fragment were fully incubated in a 37°C incubator for 3 hours. The concentration of the recovered nucleic acid was determined using a Nanodrop micro-spectrophotometer. The digested linear vector and PCR digestion product were placed in a reaction solution containing T4 ligase, incubated at 16°C for 8 hours, transformed into Escherichia coli DH5α by heat shock, and coated on an LA plate containing kanamycin (50 mg / L). After the monoclonal colony grew, a colony PCR experiment was performed to screen the positive monoclonal clone containing pCAMBIA2300-ACTIN1-LPre-miR1850, shake the bacteria, extract the plasmid, and send it for sequencing.

[0057] 3. Analyze the sequencing data obtained in step 2, and select the pCAMBIA2300-ACTIN1-LPre-miR1850 binary expression vector in which a DNA molecule identical to that shown in LPre-miR1850 is inserted between the restriction sites of XbaⅠ and PstⅠ, while keeping the other sequences of pCAMBIA2300-ACTIN1 unchanged, as the plasmid for subsequent genetic transformation.

[0058] Example 4 Construction of vector for silencing miR1850 function

[0059] 1. Primer Design

[0060] The RNA sequence of sequence 1 (SEQ ID NO.1) was used according to the reverse complementary rule to obtain a DNA sequence (SEQ ID NO.11) that simulates miR1850, and cta (SEQ ID NO.12) was added between the 11th and 12th nucleotides in the reverse complementary sequence, and added to both ends of the 48nt backbone sequence to obtain a sequence of SEQ ID NO.13. This sequence was used as a template to design primers to obtain amplification primers of MIM1850-F (SEQ ID NO.14) and MIM1850-R (SEQ ID NO.15); wherein the 48nt backbone sequence is represented by italic lowercase letters in SEQID NO.13; in the amplification primers of MIM1850-F (SEQ ID NO.14) and MIM1850-R (SEQ ID NO.15), italic lowercase letters represent the restriction endonuclease cutting sites of XbaI and PstI, respectively, and the underlined sequences represent protective bases. The intermediate overlapping primers were designed based on the SEQ ID NO.13 sequence template: Overlap-F (SEQ ID NO.16) and Overlap-R (SEQ ID NO.17), and then the full-length sequence shown in SEQ ID NO.13 was obtained by fusion PCR reaction. The specific sequence information is as follows:

[0061] SEQ ID NO.11: GGGGTTAGAGGGTTGAAAGGT

[0062] SEQ ID NO.12:CCCCAATCTCCctaCAACTTTCCA

[0063] SEQ ID NO.13: CCCCAATCTCCctaCAACTTTCCAgttgttgttgttatggtctaattta aatatggtctaaagaagaagaatCCCCAATCTCCctaCAACTTTCCA

[0064] MIM1850-F (SEQ ID NO. 14): GC tctagaCCCCAATCTCCctaCAACTTTCCAGTTGTTGTTGTTATG

[0065] MIM1850-R (SEQ ID NO.15): AA ctgcagTGGAAAGTTGtagGGAGATTGGGGATTCTTCTTCTTTAG

[0066] Overlap-F (SEQ ID NO. 16): GTCTAATTTAAATATGGTCTAAAGAAGAAG AAT

[0067] Overlap-R (SEQ ID NO. 17): ACCATATTTAAATTAGACCATAACAACAAC AAC

[0068] SEQ ID NO.18: GC tctagaCCCCAATCTCCctaCAACTTTCCAgttgttgttgttatg gtctaatttaaatatggtctaaagaagaagaatCCCCAATCTCCctaCAACTTTCCActgcag TT

[0069] 2. Add primers MIM1850-F (SEQ ID NO.14), MIM1850-R (SEQ ID NO.15), overlap-F (SEQ ID NO.16) and overlap-R (SEQ ID NO.17) to the PCR reaction tube, and perform fusion PCR reaction under the action of high-fidelity DNA polymerase; recover the target fragment (SEQ ID NO.18) with a length of 112bp, and determine its nucleic acid concentration. Take 1μg of the recovered fragment (SEQ ID NO.18) and add 10U of restriction endonucleases XbaⅠ and PstⅠ in sequence, incubate in a 37℃ incubator for 3 hours to complete double enzyme digestion; recover the nucleic acid fragment after digestion by ethanol precipitation. Mix the double enzyme digested vector in Example 3 and the DNA fragment recovered by digestion in this step at a mass ratio of 1:3, add T4 ligase, and incubate at 16℃ for 8 hours. Then, the ligation product was transformed into E. coli DH5α by heat shock, incubated inverted in a 37°C incubator overnight, and single clones were picked for colony PCR to screen positive single clones containing pCAMBIA2300-ACTIN1-MIM1850, shaken, and the plasmid was extracted and sent for sequencing. In SEQ ID NO.18, italic lowercase letters represent the backbone sequence, lowercase letters represent the restriction endonuclease cleavage site, and the underlined sequence represents the protection base.

[0070] 3. Sequencing results showed that the recombinant binary expression vector pCAMBIA2300-ACTIN1-MIM1850 had a DNA molecule as shown in the sequence (SEQ ID NO.13) inserted between the restriction sites of XbaⅠ and PstⅠ, and kept the other sequences of the pCAMBIA2300-ACTIN1 vector unchanged. This plasmid was selected as the vector for subsequent genetic transformation.

[0071] Example 5 Construction of mir1850 vector for editing MIR1850 using CRISPR / Cas9

[0072] Using the DNA sequence of Pre-miR1850 as a template, the online tool (http: / / skl.scau.edu.cn / ) was used to screen the editing targets recognized by CRISPR / Cas9, and two editing targets T1 (SEQ ID NO.19) and T2 (SEQ ID NO.20) for the miR1850 precursor were selected. Two pairs of primers were designed according to the expression cassettes driven by the U3 and U6a promoters, namely U3T1F (SEQ ID NO.21), U3T1R (SEQ ID NO.22), U6aT2F (SEQ ID NO.23), and U6aT2R (SEQ ID NO.24). Referring to the instructions, the target sites T1 and T2 were connected to the gRNA expression cassettes driven by the U3 and U6a promoters, respectively, by cutting and connecting. Then, the two expression cassettes were sequentially connected to the pYLCRISPR / Cas9-MH (B) vector, and PCR amplification was performed using universal primers SP-ML (SEQ ID NO.25) and SP-R (SEQ ID NO.26). The obtained PCR products were sequenced conventionally, and the results were analyzed to confirm that the linked sequence was consistent with the target sequence, and to ensure that other sequences of the vector had not changed. The obtained plasmid can be used as a vector for subsequent genetic transformation. Among them, the lowercase letters in U3T1F (SEQ ID NO.21), U3T1R (SEQ ID NO.22), U6aT2F (SEQ ID NO.23), and U6aT2R (SEQ ID NO.24) represent the linker sequence, and the specific sequence information is as follows:

[0073] T1 (SEQ ID NO.19): TGGAAAGTTGGGAGATTGG

[0074] T2 (SEQ ID NO.20): TGTGAACTAAACGTGGATT

[0075] U3T1F(SEQ ID NO.21):ggcaTGGAAAGTTGGGAGATTGG

[0076] U3T1R (SEQ ID NO.22): aaacCCAATCTCCCAACTTTCCA

[0077] U6aT2F (SEQ ID NO. 23): gccgTGTGAACTAAACGTGGATT

[0078] U6aT2R (SEQ ID NO.24): aaacAATCCACGTTTAGTTCACA

[0079] Example 6 Obtaining and Identifying Transgenic Rice of OX1850, MIM1850, and mir1850

[0080] 1. The positive plasmids obtained in Examples 3, 4, and 5 were sent to a biological company for genetic transformation. The genetic transformation method mediated by Agrobacterium (strain EHA105) was used. The genetic background of the transformed rice was Zhonghua 11 (ZH11). After callus induction, Agrobacterium infection, positive callus screening, differentiation and rooting, more than 20 T0 transgenic strains were finally obtained.

[0081] 2. After culturing T0 transgenic rice in a glass greenhouse for about 2 weeks, the rice genome was extracted using the CTAB method: a rice leaf of about 2 cm in length was placed in a 2 mL centrifuge tube, 500 μL of 1.5 times CTAB extraction solution (1.5% CTAB, 75 mMTris (pH = 8.0), 15 mM EDTA, 6.14% NaCl) was added, and then a 6 mm diameter zirconium oxide bead was added, and the sample was fully broken with a tissue disruptor. The sample was placed in a 65°C water bath for 10 minutes, mixed every 5 minutes, and then 500 μL of chloroform / isoamyl alcohol (24:1) was added. After mixing, the sample was centrifuged at 12000 rpm for 10 minutes at room temperature, and 250 μL of the upper aqueous phase was transferred to a new 1.5 mL centrifuge tube. 500 μL of pre-cooled anhydrous ethanol was added, and after treatment at -20°C for 10 minutes, the sample was centrifuged at 12000 rpm for 10 minutes, and the supernatant was discarded. Next, add 1mL of 75% ethanol for washing, centrifuge at 12000rpm for 5 minutes, discard the supernatant, and dry at room temperature. Finally, add 50μL of sterile deionized water to dissolve the DNA as a template for subsequent PCR experiments. The universal detection primers 2300F (SEQ ID NO.25) and 2300R (SEQ ID NO.26) on the pCAMBIA2300-ACTIN1 vector were used to detect the transgenic rice genomes of OX1850 and MIM1850. The amplified target bands were located between 1-2kb and 0.5-0.75kb molecular markers after electrophoresis; for transgenic rice of mir1850, primers OX1850-F (SEQ ID NO.9) and OX1850-R (SEQ ID NO.10) were used for amplification and conventional sequencing to analyze whether mir1850 had mutated. The specific sequence information is as follows:

[0082] 2300F(SEQ ID NO.25):TCAGCATTGTTCATCGGTAG

[0083] 2300R(SEQ ID NO.26):TAGCATTCGCCATTCAGG

[0084] 3. According to the positive strains identified in step 2, the total RNA of rice was extracted using the Trizol method. Put about 3 cm of young rice leaves into a 2 mL centrifuge tube, add zirconium oxide beads, grind them thoroughly in liquid nitrogen, add 1 mL (AG RNAexPro Reagent, Accurate Biotechnology) and mix them thoroughly. Then add 200 μL of chloroform, shake vigorously for 15 seconds, let stand at room temperature for 5 minutes, and then centrifuge at 12000 rpm at 4 ° C for 15 minutes. The mixture is divided into three layers. Take about 500 μL of supernatant and transfer it to a new 1.5 mL centrifuge tube, add 500 μL of isopropanol, mix thoroughly, and centrifuge at 12000 rpm at 4 ° C for 10 minutes to precipitate RNA. Discard the supernatant, add 1 mL of 75% ethanol solution, invert and wash the precipitate, centrifuge at 7500g at 4 ° C for 5 minutes, and discard the supernatant. After drying at room temperature for 10 minutes, 50 μL of RNase-free deionized water was added to dissolve the RNA, and the RNA concentration was determined using a Nanodrop microspectrophotometer as a template for subsequent reverse transcription experiments. Referring to the reverse transcription operation method in Example 1, the RNA was reverse transcribed to synthesize cDNA, and the accumulation of mature miR1850 was detected by fluorescent quantitative PCR. The OX1850 strains with increased miR1850 accumulation, as well as the MIM1850 and mir1850 strains with reduced miR1850 accumulation were screened out, self-pollinated, and T1 generation rice seeds were harvested from individual plants. After continued germination, the seeds were transplanted and the accumulation of miR1850 in the T1 generation was identified by fluorescent quantitative PCR (results in Figure 2 The expected plants were selected to harvest T2 rice seeds for subsequent rice virus resistance evaluation experiments.

[0085] Example 7 Analysis of virus resistance of miR1850 transgenic rice

[0086] 1. Select 40 plump seeds of Zhonghua 11 (WT), OX1850, MIM1850 and mir1850 homozygous lines, soak them in tap water, and soak them overnight at 30°C. Then keep them moist and continue to germinate for 48 hours. After the rice turns white, transfer them to the greenhouse for cultivation. The culture conditions are 12 hours of light at 28°C and 12 hours of darkness at 25°C. After about 2 weeks, the rice enters the three-leaf stage and is used for subsequent virus transmission experiments.

[0087] 2. Use the group inoculation method to transmit the virus to rice. Use brown planthoppers carrying RRSV to transmit the virus. After about 3 days of feeding, separate the brown planthoppers and rice. The rice continues to be cultured in the greenhouse for about 3 weeks, and obvious typical symptoms of the disease gradually appear. By the fourth week, select the aboveground tissues of no less than 6 independent plants, extract RNA and protein, and relatively quantitatively detect the accumulation of viruses in rice. The remaining rice continues to be cultured to the booting stage. During this period, the symptoms of rice disease are observed, the symptoms of disease of miR1850 transgenic rice and wild-type rice are compared, and photos are taken and recorded. The results are shown in Figure 3 shown.

[0088] 3. After reverse transcription of the extracted RNA, qRT-PCR was performed using a CFX96 fluorescent quantitative PCR instrument (Bio-Rad) to determine the Ct values ​​of the RRSV coat protein gene and the internal reference ACTIN gene in the sample. The specific operating parameters were: 50°C for 2 minutes, 98°C for 10 seconds, 60°C for 10 seconds, 68°C for 30 seconds, and 40 cycles; then the melting curve program was run with the parameters of 95°C for 15 seconds, 60°C for 1 minute, and 99°C for 15 seconds. The experimental results used the ACTIN gene as the internal reference and used 2^ -△△Ct The relative expression of RRSV coat protein gene was calculated by the algorithm (see Figure 4 The detection primers for RRSV coat protein gene are RRSV-CP-F (SEQ ID NO.27) and RRSV-CP-R (SEQ ID NO.28); the detection primers for ACTIN are ACTIN-F (SEQ ID NO.29) and ACTIN-R (SEQ ID NO.30).

[0089] The specific sequence information is as follows:

[0090] RRSV-CP-F(SEQ ID NO.27):GAGCAAACTTGAGGCGTA

[0091] RRSV-CP-R(SEQ ID NO.28):AAGCTACCGTGTAGGTGGCG

[0092] ACTIN-F(SEQ ID NO.29):GAGATCACTGCCTTGGCTCC

[0093] ACTIN-R(SEQ ID NO.30):CGATAACAGCTCCTCTTGGC

[0094] 4. Use Western blot technology to detect the accumulation of viral capsid protein. Grind the rice tissue thoroughly in liquid nitrogen, take about 0.1g of sample powder and add 100μL protein extract (0.25M Tris-HCl (pH=6.8), 8% β-mercaptoethanol, 20% glycerol, 8% SDS), boil for 10 minutes, centrifuge at 12000rpm for 10 minutes, and take the supernatant for SDS-PAGE electrophoresis. After the electrophoresis, the protein was transferred to the PVDF membrane using a semi-dry transfer method. After the membrane was blocked with 5% skimmed milk powder, it was incubated with the primary antibody of RRSV CP protein or the primary antibody of ACTIN at room temperature for 2 hours, washed three times, incubated with HRP-labeled secondary antibody at room temperature for 1 hour, and finally developed in a chemiluminescence instrument. The abundance of RRSV CP protein in ZH11 and the abundance of RRSV CP protein in miR1850 transgenic rice were compared at basically the same ACTIN abundance. The results are shown in Figure 5 .

[0095] In this study, the accumulation of miR1850 was compared in rice that was not infected with RRSV (as the control group) and rice that was infected with RRSV (as the experimental group) after being fed by the virus vector brown planthopper. The results of real-time fluorescence quantitative polymerase chain reaction showed that RRSV significantly induced the accumulation of miR1850, suggesting that miR1850 may regulate rice resistance to the virus.

[0096] In order to further confirm the function of miR1850 in the interaction between rice and RRSV, this program constructed transgenic rice mutants with enhanced (OX1850), weakened (MIM1850) and missing (mir1850) functions of MIR1850, obtained homozygous mutants by self-pollination, and inoculated with RRSV by group inoculation method. By observing the disease symptoms of the test rice and detecting the amount of virus accumulation and other indicators, it was shown that the rice materials with weakened miR1850 function had enhanced resistance to RRSV.

[0097] In summary, it can be concluded that RRSV infection induces the accumulation of miR1850, and silencing miR1850 significantly improves rice resistance to RRSV. This protocol reveals the function of miR1850 in the interaction between rice and viruses. This discovery provides a new target for breeding antiviral rice. By screening low-abundance miR1850, the screening range of candidate antiviral targets is narrowed, and the screening process based on the synergistic antiviral effect of miR1850 and its target genes is accelerated, providing a basis for breeding multi-gene antiviral breeding.

[0098] The above descriptions are only some embodiments of the present invention, and are not intended to limit the protection scope of the present invention. Any equivalent device or equivalent process transformation made using the contents of the present invention specification and drawings, or directly or indirectly applied in other related technical fields, are also included in the patent protection scope of the present invention.

Claims

1. A miRNA, set as miR1850, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.

1.

2. A miRNA precursor, set as Pre-miR1850, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.

7.

3. Application of regulating the expression or accumulation of miRNA and / or miRNA precursor in enhancing resistance of rice to sawtooth leaf dwarf virus, characterized in that: The nucleotide sequence of the miRNA is shown in SEQ ID NO.1; the nucleotide sequence of the miRNA precursor is shown in SEQ ID NO.

7.

4. Application of miRNA or miRNA precursor biomaterials in enhancing resistance of rice to sawtooth leaf dwarf virus, characterized in that: The nucleotide sequence of the miRNA is shown in SEQ ID NO.1; the nucleotide sequence of the miRNA precursor is shown in SEQ ID NO.

7.

5. The use according to claim 4, characterized in that The biological material is any one of the following A1) to A12): A1) a nucleic acid molecule encoding the miRNA according to claim 1 or the miRNA precursor according to claim 2; A2) an expression cassette containing the nucleic acid molecule described in A1); A3) a recombinant vector containing the nucleic acid molecule described in A1); A4) a recombinant vector containing the expression cassette described in A2); A5) a recombinant microorganism containing the nucleic acid molecule described in A1); A6) a recombinant microorganism containing the expression cassette described in A2); A7) a recombinant microorganism containing the recombinant vector described in A3); A8) a recombinant microorganism containing the recombinant vector described in A4); A9) a transgenic plant cell line containing the nucleic acid molecule described in A1); A10) a transgenic plant cell line containing the expression cassette described in A2); A11) a transgenic plant cell line containing the recombinant vector described in A3); A12) A transgenic plant cell line containing the recombinant vector described in A4).

Images