Small-fragment RNA (Ribonucleic Acid) derived from circular RNA and application of small-fragment RNA in treatment of vascular diseases of diabetes mellitus

Abstract

The invention belongs to the technical field of nucleic acid drugs, and particularly relates to a small-fragment RNA (Ribonucleic Acid) derived from circular RNA and application of the small-fragment RNA in treatment of vascular diseases of diabetes mellitus. The nucleotide sequence of the small-fragment RNA is CUAGCCGAAUGUUAAAAAAU, and the nucleotide sequence of the small-fragment RNA is The small-fragment RNA provided by the invention has good effects of protecting and maintaining biological functions of vascular endothelial cells, has the advantages of good structural stability, long in-vivo half-life period, low onset concentration, high biological safety and the like, has good application potential in the field of clinical nucleic acid drug development, and has wide application prospects. A new thought is provided for treating chronic progressive vasculopathy caused by diabetes mellitus.

Description

Technical Field

[0001] The present invention relates to the technical field of nucleic acid drugs, and in particular to a small RNA fragment derived from circular RNA and application thereof in the treatment of diabetic vascular diseases. Background Art

[0002] Diabetes is a metabolic syndrome characterized by hyperglycemia caused by multiple causes. Its chronic complications involve large and small blood vessels throughout the body, affecting the functions of multiple organs such as the heart, kidneys, and eyes. Diabetic vascular disease is a common complication and the main cause of death in diabetic patients. It includes two types of progressive vascular lesions, both of which can occur simultaneously or alone. Diabetic macroangiopathy is characterized by atherosclerotic lesions in the coronary and peripheral arterial circulation, such as coronary artery disease (CAD), cerebrovascular disease (cerebralvascular disease), and peripheral arterial disease (PAD). Reducing cardiovascular events is an important goal in preventing and treating complications in diabetic patients. However, the current treatment options for diabetic vascular complications are not entirely effective. It is an urgent clinical need to explore the molecular regulatory mechanisms of diabetic vascular complications and develop new diagnostic and therapeutic targets and therapeutic drugs.

[0003] The vascular endothelium is a continuous lining in the vascular system that is responsible for maintaining vascular tone, angiogenesis, and hemostasis, and provides an antioxidant, anti-inflammatory, and anti-thrombotic surface. Studies have shown that in diabetes, high glucose and inflammatory responses stimulate endothelial cells to release a series of growth factors and cytokines. Under the stimulation of these cytokines and metabolic factors, vascular endothelial cells have the characteristics of transforming into mesenchymal cells, that is, endothelial to mesenchymal transition (EndoMT). This transformation causes significant changes in endothelial cells in terms of polarity, morphology, and function, and ultimately leads to endothelial dysfunction, which is involved in the occurrence and development of diabetic vascular disease. EndoMT may be an early event in diabetic vascular disease and plays a key role in the occurrence and development of diabetic vascular diseases, suggesting that EndoMT is expected to become an effective target for the prevention and treatment of diabetic macrovascular complications.

[0004] Small RNA is a type of endogenous noncoding RNA (ncRNA), which exists widely and in large quantities in organisms in various types. Small RNA drugs have inherent advantages in the treatment of chronic diseases: 1) Small RNA drugs directly regulate upstream gene expression and are relatively less likely to develop drug resistance; 2) The efficacy of small RNA drugs is relatively long-lasting, which can greatly reduce the frequency of administration, which has great clinical value for the treatment of many chronic diseases. A study explored the relationship between drug compliance and cardiovascular disease by analyzing the database of a large health insurance company. The results showed that the incidence of all-cause death, myocardial infarction, stroke or coronary artery revascularization surgery was closely related to drug compliance. Therefore, the advantages of small RNA drugs such as long-term effectiveness and difficulty in developing drug resistance have gradually made the industry realize that nucleic acid drugs such as small RNA are new research and development directions for the treatment of cardiovascular diseases in the future.

[0005] In the previous study of this topic, it was confirmed that a circular RNA derived from the Ube3a gene has an inhibitory effect on EndoMT and is an excellent candidate drug for the treatment of diabetic vascular complications. However, the bottleneck of the application of this circRNA nucleic acid drug is mainly due to the high threshold of its artificial transcription synthesis and amplification technology, and the dilemma that long fragments are easily degraded. Therefore, optimizing the sequence to make it more effective in protecting blood vessels and having higher stability is expected to open up new ideas for the treatment of diabetic vascular diseases and bring more effective treatment options to patients, which is of great significance to reducing the prevalence of diabetic vascular diseases, significantly improving the quality of life of patients, and prolonging their lifespan. Summary of the invention

[0006] In view of the above problems in the prior art, the present invention provides a small RNA fragment derived from circular RNA, which has a good effect of protecting and maintaining the biological functions of vascular endothelial cells, has good structural stability, a long half-life in the body, and has the advantages of low effective concentration and high biosafety. It has good application potential in the field of clinical nucleic acid drug development and provides a new idea for the treatment of chronic progressive vascular diseases caused by diabetes.

[0007] To achieve the above object, the present invention is specifically implemented through the following technical solutions:

[0008] The present invention provides a small RNA fragment derived from a circular RNA, the nucleotide sequence of which is CUAGCCGAAUGUUAAAAAAU.

[0009] The second aspect of the present invention provides a DNA molecule encoding a small RNA fragment derived from the circular RNA as described above.

[0010] The third aspect of the present invention provides a recombinant expression vector, which contains the DNA molecule described above.

[0011] A fourth aspect of the present invention provides a host cell, wherein the host cell contains the small RNA fragment derived from the circular RNA as described above, the DNA molecule as described above, or the recombinant expression vector as described above.

[0012] The host cell may be an endothelial cell, specifically a human umbilical vein endothelial cell.

[0013] The fifth aspect of the present invention provides the use of the small RNA fragments described above in the preparation of drugs for preventing and / or treating diabetic vascular diseases.

[0014] A sixth aspect of the present invention provides a drug for preventing and / or treating diabetic vascular diseases, wherein the active ingredient of the drug is a small RNA fragment derived from the circular RNA as described above.

[0015] Furthermore, the drug also includes a delivery vector, which is used to deliver the small RNA fragment into cells or organisms, including a viral vector or a nanoliposome.

[0016] Furthermore, the diabetic vascular diseases include but are not limited to: 1) diabetic microangiopathy, such as diabetic nephropathy and diabetic cardiac microangiopathy; 2) diabetic macroangiopathy, such as diabetic coronary artery disease, diabetic cerebrovascular disease and diabetic peripheral arterial disease.

[0017] Furthermore, the concentration of the small RNA fragment in the drug is 1-50 nM.

[0018] The advantages and positive effects of the present invention are:

[0019] 1. The novel small RNA fragments derived from circular RNA provided by the present invention are easy to synthesize and have enhanced pharmacodynamic activity, can significantly reduce the damage of AGEs to endothelial cells, enhance cell viability, and can significantly inhibit the transformation of endothelial cells to mesenchymal cells, which is beneficial to protect and maintain the biological functions of vascular endothelial cells, thereby exerting a cardiovascular protective effect and playing a role in preventing and / or treating diabetic vascular diseases.

[0020] 2. The novel small RNA fragments derived from circular RNA provided by the present invention have obvious efficacy within 24 hours and can last for at least 48 hours. They have a long half-life in the body and have the advantages of low effective concentration and high biosafety. They have good application potential in the field of clinical nucleic acid drug development and provide new ideas for the treatment of chronic progressive vascular diseases caused by diabetes. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments.

[0022] Figure 1 A schematic diagram of the secondary structure of a functional small RNA fragment according to an embodiment of the present invention;

[0023] Figure 2 The relative survival rate of endothelial cells treated with AGEs 24h / 48h after transfection with hsa_circ_0103211-JP (1-5) in the present invention;

[0024] Figure 3 The effect of hsa_circ_0103211-JP (1-5) transfection for 24 hours followed by AGEs treatment for 24 hours on the expression level of related marker proteins in the process of endothelial-mesenchymal transition in the present invention, wherein Figure A is an electrophoresis gel diagram of the expression of related markers, and Figure B is a bar graph of the relative levels of the expression of related markers;

[0025] Figure 4 The figure shows the effect of hsa_circ_0103211-JP(1-5) transfection for 24 hours followed by AGEs treatment for 48 hours on the expression level of related marker proteins in the process of endothelial-mesenchymal transition in the embodiment of the present invention, wherein Figure A is an electrophoresis gel diagram of the expression of related markers, and Figure B is a bar graph of the relative levels of the expression of related markers. Implementation

[0027] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments. The embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0028] Based on the information contained in the present invention, it is easy for those skilled in the art to make various changes to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the defined processes, properties or components, because these embodiments and other descriptions are only for the purpose of illustrating specific aspects of the present invention. In fact, various changes that a person skilled in the art or related fields can obviously make to the embodiments of the present invention are covered within the scope of the appended claims.

[0029] In order to better understand the present invention but not to limit the scope of the present invention, all the numbers and other numerical values ​​used in the present invention to express the amount, percentage, etc. should be understood as modified by the word "approximately" in all cases. The term "approximately" has its usual meaning, which is used to indicate that a value includes the inherent variation of the error of the device or method used to determine the value, or contains a value close to the value, such as within 10% of the value (or range of values). Therefore, unless otherwise specified, the numerical parameters listed in the specification and the attached claims are approximate values, which may be changed according to the different ideal properties attempted to be obtained.

[0030] The meaning of the terms "include", "comprising", "containing", "having" and the like is non-restrictive, i.e., other steps and other ingredients that do not affect the result may be added. The term "and / or" should be regarded as a specific disclosure of each of the two specified features or components with or without the other. For example, "A and / or B" will be regarded as including the following situations: (i) A, (ii) B, and (iii) A and B.

[0031] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and understandable, the present invention is described in detail below with reference to the accompanying drawings.

[0032] Under high sugar and inflammatory conditions, diabetic patients usually accumulate higher levels of advanced glycation end products (AGEs). The effects of AGEs on vascular health are mainly manifested in the following aspects: (1) AGEs can bind to their receptors (such as RAGE) and activate oxidative stress and inflammatory responses. This can lead to endothelial cell damage and dysfunction, promoting the occurrence and development of atherosclerosis; (2) The accumulation of AGEs can lead to cross-linking and stiffening of vascular wall proteins, increase vascular hardness, and reduce vascular elasticity. This is an important reason why diabetic patients are prone to atherosclerosis and hypertension; (3) AGEs can directly damage vascular endothelial cells, reduce their ability to resist coagulation and regulate vascular tension, which increases the risk of thrombosis and leads to cardiovascular events such as myocardial infarction and stroke; (4) AGEs can change the structure of the extracellular matrix, promote smooth muscle cell proliferation and migration, and lead to vascular remodeling. This vascular remodeling is an important factor leading to peripheral arterial disease in diabetic patients; (5) The accumulation of AGEs in microvessels can lead to microvascular lesions such as diabetic retinopathy and diabetic nephropathy. These microvascular lesions are the main cause of serious complications of diabetes; (6) AGEs can activate monocytes and macrophages and increase the production of inflammatory factors. This persistent inflammatory state will further damage blood vessels and increase the risk of atherosclerosis and thrombosis. Therefore, AGEs play a vital role in diabetic vascular diseases, damaging vascular health through multiple mechanisms and increasing the risk of cardiovascular events and microvascular lesions.

[0033] The interaction between AGEs and their receptor RAGE induces the production of EndoMT, which is an important factor leading to the above risks. Endothelial-to-mesenchymal transition (EndoMT) refers to the process in which endothelial cells lose their original characteristics and transform into mesenchymal cells under the action of various stimuli. In order to obtain a mesenchymal phenotype, endothelial cells inhibit the expression of endothelial-specific markers, such as vascular endothelial cadherin (E-Cadherin), platelet-endothelial cell adhesion molecule (Pecam-1 / CD31) and vascular endothelial growth factor (VEGFR), and activate the expression of mesenchymal markers, such as α-smooth muscle actin (α-SMA), type I and type III collagen, and fibroblast-specific protein 1 (FSP1). This transformation can cause significant changes in endothelial cells in terms of polarity, morphology, and function. When endothelial cells undergo EndoMT, these cells that have transformed into mesenchyme gain stronger migration and proliferation capabilities. They can migrate to the subendothelial membrane and secrete extracellular matrix components (ECM). The fibrous basement membrane formed will thicken and harden the vascular wall, narrow the lumen, reduce vascular elasticity, and weaken the diastolic function, thereby causing vascular sclerosis and exacerbating hemodynamic changes; in addition, the tight junctions and adhesion junctions of endothelial cells are destroyed, making the connections between endothelial cells loose, increasing vascular permeability, impairing barrier function, and making it easier for plasma components and inflammatory cells to leak out of the blood vessels, which will trigger an inflammatory response and aggravate the lesions. At the same time, EndoMT will change the anticoagulant and fibrinolytic properties of endothelial cells, enhance platelet adhesion, and increase the possibility of thrombosis. The EndoMT process will also trigger vascular inflammatory reactions. The transformed cells can secrete a variety of inflammatory factors, such as IL-1β and TNF-α. The inflammatory activation of endothelial cells will aggravate the aforementioned process, forming a vicious cycle.

[0034] A large number of studies have confirmed that EndoMT is a key initiating factor in the development of various cardiovascular diseases (CVDs) and an early event in diabetic vascular disease, and is closely related to the occurrence and development of diabetes-related cardiovascular diseases. Therefore, inhibiting the process of EndoMT may have potential therapeutic effects in the treatment of diabetic vascular diseases, which is of great significance for the prevention and treatment of diabetic vascular diseases.

[0035] The previous study of our research group (see the literature: Zhou Weiping. Study on the effect of mm9_circ_010056 on diabetes-induced vascular endothelial-mesenchymal transition and its mechanism [D]. Hubei: Wuhan University of Science and Technology, 2019.) also confirmed the occurrence of EndoMT in the aorta of diabetic mice. At the same time, the literature observed that the expression of mm9_circ_010056 was downregulated in the aortic endothelial layer of type 2 diabetes (T2DM) mice of different ages; in addition, exogenous AGEs were given to mouse aortic endothelial cells (MAEC cells) to establish a T2DM cell model. The results showed that AGEs inhibited the expression of mm9_circ_010056 in a concentration-dependent and time-dependent manner; interfering with the level of mm9_circ_010056 can promote the occurrence of EndoMT in cells, and overexpression can inhibit the occurrence of EndoMT induced by AGEs, which is beneficial to inhibit the progression of diabetic vascular diseases. These results suggest that mm9_circ_010056 is involved in regulating the diabetes-induced EndoMT process and is a candidate drug and intervention target for the treatment of diabetic vascular diseases. mm9_circ_010056 is derived from the mouse Ube3a gene, and its genomic location is chr7: 66496336-66502587, with a length of 6252bp. The nucleotide sequence can be found in the circBase database ID: mmu_circ_0001572. In the human body, there is an RNA molecule highly homologous to the above-mentioned mm9_circ_010056 - CircUBE3a (hsa_circ_0103211), which is derived from the same parent gene Ube3a as mm9_circ_010056. Human hsa_circ_0103211 has the same biological and pathological functions as mouse mm9-circ-010056 in the human body. The location of hsa_circ_0103211 in the genome is chr15: 25599499-25657118, with a length of 57620 bp. The nucleotide sequence can be found in the circBase database ID: hsa_circ_0103211.

[0036] Due to the large length of hsa_circ_0103211, the in vivo delivery efficiency is low, and the stability is insufficient, it is difficult to use for treatment in clinical practice. Therefore, the present invention synthesizes multiple small RNA fragments based on the junction part (JP) sequence of hsa_circ_0103211, named: hsa_circ_0103211-JP, and its screening and evaluation methods refer to the document "Yuan, Q., Sun, Y., Yang, F. et al. CircRNA DICAR as a novel endogenous regulator for diabetic cardiomyopathy and diabetic pyroptosis of cardiomyocytes. SigTransduct Target Ther8, 99 (2023). https: / / doi.org / 10.1038 / s41392-022-01306-2". Hsa_circ_0103211-JP has a special stem-loop structure and is the core functional fragment of hsa_circ_0103211.

[0037] In order to verify the biological function of hsa_circ_0103211-JP in inhibiting EndoMT and its therapeutic effect on diabetic vascular diseases, the present invention first used RNAfold, a software tool for predicting RNA secondary structure, to analyze the secondary structure and structural stability of the sequence, eliminated sequences with unreasonable spatial conformations, and screened out 5 new small RNA fragments containing "CUAGCCGAAUGUUAAAAAAU". These 5 sequences were then pharmacodynamically evaluated. Specifically, endothelial cells were treated with advanced glycation end products (AGEs) to simulate the vascular injury process induced by diabetes. Hsa_circ_0103211-JP (1-5) was applied to endothelial cells treated with AGEs, and the activity of endothelial cells was tested by CCK8 experiment. It was found that hsa_circ_0103211-JP (1) can reduce the damage of AGEs to endothelial cells and enhance cell viability, which is beneficial to protect endothelial cells. Moreover, after treatment with hsa_circ_0103211-JP(1), the expression of endothelial markers E-cadherin and CD31 was significantly enhanced, and the expression of mesenchymal cell markers SNAIL and SLUG was inhibited, reflecting a good inhibitory effect on EndoMT.

[0038] The above results show that the novel small RNA fragment hsa_circ_0103211-JP (1) provided after screening and optimizing the junction site sequence of hsa_circ_0103211 has enhanced pharmacodynamic activity, and can protect endothelial cells and inhibit endothelial-mesenchymal transformation to maintain the biological function of vascular endothelial cells, thereby exerting a cardiovascular protective effect and preventing and / or treating diabetic vascular diseases. In addition, the hsa_circ_0103211-JP (1) provided by the present invention has a small molecular weight and can be efficiently transfected into cells through conventional nanoliposomes. Moreover, hsa_circ_0103211-JP (1) has good structural stability, and the drug effect is obvious at 24h and can last for at least 48h, and has a long half-life in vivo. It also has the advantages of low onset concentration and high biosafety, and has good application potential in the field of clinical nucleic acid drug development, and provides a new idea for the treatment of chronic progressive vascular lesions caused by diabetes.

[0039] Based on this, an embodiment of the present invention provides a small RNA fragment, the nucleotide sequence of which is as follows:

[0040] CUAGCCGAAUGUUAAAAAAU (see SEQ ID NO. 1).

[0041] In practical applications, when the small RNA fragment of the present invention or a DNA molecule capable of expressing the small RNA fragment, a recombinant expression vector, etc. is used as an active ingredient in a drug for treating diabetic vascular diseases, when the drug is formulated into a liquid preparation or an intravenous injection formulation, the concentration of the small RNA fragment is 1-50nM, preferably 30-50nM.

[0042] The drug usually also includes a delivery vector, such as a viral vector or a nanoliposome, for delivering the small RNA fragment into a cell or an organism. Of course, the small RNA fragment can also be directly delivered into a cell or an organism by microinjection technology or gene gun targeting technology. The present invention does not make any special restrictions on this.

[0043] The present invention is further described below in conjunction with specific examples. The experimental methods in the following examples where specific conditions are not specified are generally based on the conditions recommended by the manufacturer. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources. Example

[0044] 1. Nucleic acid sequence optimization

[0045] In this example, based on the junction part (JP) sequence in the full-length sequence of hsa_circ_0103211, multiple small RNA fragments with optimized structures, namely hsa_circ_0103211-JP, were synthesized. RNAfold, a software tool for predicting RNA secondary structure, was used to screen the optimized sequences. Sequences with unreasonable spatial conformations were eliminated based on the secondary structure and nucleic acid sequence structural stability. Five candidate sequences, namely hsa_circ_0103211-JP (1), hsa_circ_0103211-JP (2), hsa_circ_0103211-JP (3), hsa_circ_0103211-JP (4) and hsa_circ_0103211-JP (5), were screened out. The specific nucleotide sequences are shown in Table 1. Figure 1 The secondary structure of hsa_circ_0103211-JP (1-5) is shown.

[0046] Table 1 Nucleotide sequences of candidate sequences in this example

[0047]

[0048] 2. Construction of diabetes-induced endothelial cell injury model

[0049] Due to the continuous hyperglycemia in diabetic patients, AGEs accumulate rapidly in the body, and AGEs are also one of the markers for clinical diagnosis of diabetes. AGEs can bind to receptors (RAGE) on the surface of endothelial cells, activate a series of intracellular signaling pathways, lead to inflammatory response and oxidative stress, damage endothelial cells, and cause EndoMT. Therefore, this example uses exogenous administration of AGEs to human umbilical vein endothelial cells to establish a diabetic vascular endothelial injury model to simulate the vascular pathological process induced by diabetes.

[0050] Human umbilical vein endothelial cells (HUVEC) (purchased from Zhejiang Meisen Cell Technology Co., Ltd., from CTCC) were cultured in an ECM endothelial cell-specific culture medium (containing ECGS, FBS and P / S solution, purchased from ScienCell, catalog number ScienCell-1001) at 37°C in an incubator containing 5% CO2.

[0051] The optimal concentration and duration of endothelial cell-mesenchymal cell transformation were determined by adding different concentrations (100 μg / mL, 200 μg / mL and 200 μg / mL) of advanced glycolysis end products (AGEs, purchased from Bioss, catalog number bs-1158P) to the culture medium for culture treatment. The control group was not treated with any treatment. EndoMT is characterized by decreased expression of endothelial markers (such as E-Cadherin and CD31) and increased expression of mesenchymal markers (including SNAIL and SLUG).

[0052] The protein expression activity of related markers was detected based on Western Blot (WB) technology. The WB experimental steps are as follows: rinse the cells twice with PBS, then lyse the cells, centrifuge, and collect the supernatant protein. Separate the proteins by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and transfer the membrane at a constant current of 360mA for 90min after the protein electrophoresis is completed. Take out the membrane and place it in the antibody incubation box, wash it with TBST 3 times, 5min each time, and block it with rapid blocking solution for 90min; then incubate with SLUG primary antibodies against CD31, E-Cadherin, and SNAIL, respectively, overnight at 4℃; wash with TBST for 10min×3 times; then incubate with secondary antibodies at room temperature for 50min; wash with TBST for 10min×4 times. Enhanced chemiluminescence reagent was used for signal detection, and Western blot bands were quantitatively analyzed using Image J software. Among them, mouse anti-CD31 antibody was purchased from Abcam, rabbit anti-E-Cadherin antibody was purchased from CST, catalog number 3195S; catalog number ab9484, rabbit anti-SNAIL antibody was purchased from Abcam, catalog number ab216347; rabbit anti-SLUG antibody was purchased from CST, catalog number 9585T; β-actin was used as the internal reference protein, and its antibody was purchased from Proteintech (catalog number 66009-1-Ig). The secondary antibody was selected according to the species of the primary antibody. When the primary antibody was mouse antibody, the secondary antibody was HRP-conjugate daffinipure goat anti-mouse IgG (H+L) (purchased from Proteintech, catalog number SA 00001-1); when the primary antibody was rabbit antibody, the secondary antibody was HRP-conjugated affinipure goat anti-rabbit IgG (H+L) (Proteintech, catalog number SA00001-2).

[0053] The results showed that after treatment with AGEs (200 μg / mL, 48h), endothelial cells showed obvious EndoMT phenomenon, the expression of endothelial markers E-Cadherin and CD31 was significantly reduced compared with the control group, and the mesenchymal markers SNAIL and SLUG were significantly increased; therefore, in the subsequent examples of the present invention, 200 μg / mL AGEs were used to treat endothelial cells.

[0054] 3. Protective effect of hsa_circ_0103211-JP(1-5) on diabetes-induced endothelial cell damage

[0055] Experimental groups: (1) Control group without any treatment (Control); (2) AGEs treatment group, treated with 200μg / mL AGEs for 24h or 48h; (3) Nucleic acid negative control group (negative control, NC), HUVEC cells were transfected with 20nM nonsense RNA, and then treated with 200μg / mL AGEs for 24h or 48h; (4) Drug treatment group: HUVEC cells were transfected with 20nM hsa_circ_0103211-JP (1-5) respectively, and then the transfected cells were treated with AGEs (200μg / mL, 24h, 48h). The nucleotide sequence of the nonsense RNA of the NC control is: UUGUACUACACAAAAGUACUG.

[0056] Nucleic acid transfection method: Medium (25 μL) diluted 2 μL cationic liposomes ( RNAi MAX) (purchased from Thermo Fisher Scientific, Cat. No. 13778-500) and hsa_circ_0103211-JP (1-5) and NC-RNA, then the two reagents were thoroughly mixed and incubated at room temperature for 5 min. RNAi MAX and hsa_circ_0103211-JP complex was added to HUVEC cell culture medium in a 96-well plate at 25 μL / well and cultured for 24 hours. After that, the complete culture medium was replaced with serum-free ECM culture medium and the cell cycle was synchronized for 2 hours. Then, 200 μg / mL of AGEs was added to treat HUVEC cells for 24 hours and 48 hours, and samples were taken to measure cell activity.

[0057] The protective activity of different sequence treatments on endothelial cells was evaluated by CCK8 experiment. The following steps were included: the cells were washed twice with PBS in the dark, and serum-free ECM medium containing CCK8 (CCK8:ECM=1:9) was added; the well plate was returned to the cell culture incubator and incubated for 1 hour, and the absorbance was measured at 450nm using an enzyme reader. The cell viability (%) was calculated according to the following formula:

[0058] Cell viability = [(A 450nm Experiment-A 450nm blank)] / [(A 450nm Control-A 450nm blank)], where blank refers to serum-free ECM medium.

[0059] Figure 2 The relative survival of endothelial cells in different treatment groups is shown. The results showed that at 24h, the cells transfected with hsa_circ_0103211-JP(1) had less cell viability loss after AGEs treatment, and the relative cell viability was significantly higher than that of other groups, even close to that of the untreated group, and still had a certain protective effect at 48h. The effect of hsa_circ_0103211-JP(1) in resisting endothelial cell damage caused by AGEs was better than that of hsa_circ_0103211-JP(2-5).

[0060] 4. Inhibitory effect of hsa_circ_0103211-JP(1-5) on diabetes-induced endothelial-mesenchymal transition

[0061] The hsa_circ_0103211-JP(1-5) sequence was transfected into the HUVEC cell model for 24h or 48h, and the serum-free medium was replaced for starvation for 2h, and then treated with 200μg / mL AGEs for 48h. After the cell treatment, WB was used to detect the expression of EndoMT-related proteins CD31, E-Cadherin, SNAIL, and SLUG, and the internal reference protein was β-actin. The detection method was the same as above.

[0062] Endothelial cells undergo extensive gene expression reprogramming during the EndoMT process, including downregulation of endothelial markers E-Cadherin and CD31, and upregulation of mesenchymal markers SNAIL and SLUG. Ultimately, endothelial cells acquire the characteristics of mesenchymal cells through EndoMT: in terms of cell morphology, they change from a flat, tightly connected morphology to a fibrous, migratory morphology; in terms of cell function, they change from vascular endothelial barrier function to mesenchymal cells with invasion and migration capabilities, and damage the function of endothelial cells.

[0063] Figure 3-4The effects of hsa_circ_0103211-JP(1-5) transfection for 24h and 24h and 48h after AGEs treatment on the expression levels of CD31, E-Cadherin, SNAIL, and SLUG proteins in the process of endothelial-mesenchymal transition are shown respectively (Figure A is an electrophoresis gel diagram of the expression of relevant markers, "+" in the figure indicates corresponding treatment, "-" indicates no corresponding treatment, and Figure B is a bar graph of the relative level of the expression of relevant markers according to the gray value of the electrophoresis gel diagram in Figure A). The above results show that human endothelial cells HUVEC can significantly inhibit the expression of EndoMT-related proteins SNAIL and SLUG after treatment with has_circ_0103211-JP(1), indicating that hsa_circ_0103211-JP(1) has the ability to protect against vascular damage caused by diabetes by inhibiting EndoMT, and the effect is better than hsa_circ_0103211-JP(2-5).

[0064] The statistical data in the above embodiments of the present invention were processed by Graphpad software and a one-way ANOVA test was used. ++++ p<0.0001, +++ p<0.0005vs.Control; * p<0.05, ** p<0.01, *** p<0.005, **** p<0.0001vs.AGEs+NC.

[0065] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A small RNA fragment derived from circular RNA, characterized in that: The nucleotide sequence of the small RNA fragment is CUAGCCGAAUGUUAAAAAAU.

2. A DNA molecule, characterized in that The DNA molecule encodes the small RNA fragment derived from the circular RNA as claimed in claim 1.

3. A recombinant expression vector, characterized in that: The recombinant expression vector contains the DNA molecule according to claim 2.

4. A host cell, characterized in that The host cell contains the small RNA fragment derived from the circular RNA as claimed in claim 1, the DNA molecule as claimed in claim 2 or the recombinant expression vector as claimed in claim 3.

5. The host cell according to claim 4, characterized in that The host cell is an endothelial cell.

6. Use of the small RNA fragment derived from the circular RNA as claimed in claim 1 in the preparation of a drug for preventing and / or treating diabetic vascular diseases.

7. A drug for preventing and / or treating diabetic vascular diseases, characterized in that: The active ingredient of the drug is the small RNA fragment derived from the circular RNA as claimed in claim 1.

8. The drug for preventing and / or treating diabetic vascular diseases according to claim 7, characterized in that: The medicament also includes a delivery vehicle.

9. The drug for preventing and / or treating diabetic vascular diseases according to claim 7, characterized in that: The concentration of the small RNA fragment in the drug is 1-50 nM.

10. The drug for preventing and / or treating diabetic vascular diseases according to claim 7, characterized in that: The diabetic vascular disease includes diabetic microangiopathy and / or diabetic macroangiopathy; the diabetic microangiopathy includes diabetic nephropathy and / or diabetic cardiomyopathy; the diabetic macroangiopathy includes diabetic coronary artery disease, diabetic cerebrovascular disease and / or diabetic peripheral artery disease.

Images