Vigna sphaeroides root system SLAH1 gene and application thereof

Abstract

According to the invention, the cowpea root SLAH1 gene is cloned from the cowpea root for the first time, and research shows that the gene can significantly improve the endurance capacity of plants under stress such as high salinity, promote plant growth, increase the length of the plant root, increase the plant biomass, increase the photosynthetic rate and the relative content of chlorophyll, and reduce the electrolyte exosmosis rate and the dead leaf rate. The salt tolerance of the transgenic SLAH1 soybean is remarkably improved, and the transgenic SLAH1 soybean is expected to be cultivated into a salt-tolerant transgenic soybean variety and planted in saline-alkali soil. The invention provides a new candidate gene for research in the aspects of improving the stress resistance of plants, promoting the growth of the plants, changing the phenotypes of the plants and the like.

Description

Technical Field

[0001] The invention belongs to the biological field, and particularly relates to a Vigna serrata root system SLAH1 gene and an application thereof. Background Art

[0002] Saline-alkali land is widely distributed around the world and is known as the "ringworm of the earth". Under the severe situation of global climate change and uneven distribution of water resources, the saline-alkali land problem has become a major challenge facing the sustainable development of global agriculture. Salt-tolerant legumes, with their unique salt tolerance, strong soil improvement ability and multi-purpose characteristics, have become the key to solving the problem of coastal saline-alkali land.

[0003] Vigna marina (Burm.) Merr. is a perennial creeping or climbing herbaceous plant of the Leguminosae family and the Vigna genus. Vigna marina is widely distributed in tropical coastal sands and is a typical coastal halophyte. It can be used as an excellent germplasm for building coastal green spaces and windbreaks, and can also be used as food, forage, and green manure for humans. Due to its unique biological characteristics, it can better adapt to high-salt, sandy, drought, and barren growth environments. Therefore, in-depth research on Vigna marina stress-resistant regulatory genes can not only reveal the regulatory role of Vigna marina biological characteristics at the gene level, but also explore genes with excellent regulatory effects, providing candidate genes for crop variety improvement and genetic engineering breeding of the same genus or species. Summary of the invention

[0004] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a Vigna serrata root system SLAH1 gene and application thereof.

[0005] The first aspect of the present invention is to provide a Vigna serrata root system SLAH1 gene, the coding region sequence of which is shown as SEQ ID NO:1.

[0006] The second aspect of the present invention is to provide a protein encoded by the SLAH1 gene of the Vigna serrata root system according to the first aspect of the present invention.

[0007] The third aspect of the present invention is to provide a recombinant vector containing the coding region of the Vigna serrata root SLAH1 gene described in the first aspect of the present invention.

[0008] The original vector of the recombinant vector can be a vector commonly used in the field of gene recombination, such as a virus, a plasmid, etc. The present invention is not limited to this. In a specific embodiment of the present invention, the original vector is PHB and WMV069, but it should be understood that the present invention can also use other plasmids, or viruses, etc.

[0009] Preferably, the original vector of the recombinant vector is a PHB expression vector, and the coding region of the Vigna japonica root SLAH1 gene is located between the two restriction endonuclease sites of BamHI and PstI of the PHB expression vector.

[0010] Preferably, the original vector of the recombinant vector is the WMV069 expression vector, and the coding region of the Vigna japonica root SLAH1 gene is located between the BamHI and SpeI restriction endonuclease sites of the WMV069 expression vector.

[0011] The fourth aspect of the present invention is to provide a host bacteria containing the SLAH1 gene coding region of the cowpea root system described in the first aspect.

[0012] The fifth aspect of the present invention is to provide an expression cassette containing the coding region of the Vigna serrata root SLAH1 gene described in the first aspect of the present invention.

[0013] The sixth aspect of the present invention is to provide the use of the SLAH1 gene of the cowpea root system as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacteria as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in improving plant salt tolerance.

[0014] The seventh aspect of the present invention is to provide the use of the SLAH1 gene of the cowpea root system as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacteria as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in promoting plant growth.

[0015] The eighth aspect of the present invention is to provide the use of the SLAH1 gene of the cowpea root system as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacteria as described in the fourth aspect of the present invention, or the expression box as described in the fifth aspect of the present invention in increasing the length of plant roots, and / or increasing the relative content of chlorophyll, and / or reducing the electrolyte exudation rate.

[0016] In a specific embodiment of the present invention, the plant is Arabidopsis thaliana.

[0017] The ninth aspect of the present invention is to provide the SLAH1 gene of the cowpea root system as described in the first aspect of the present invention, or the protein as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacteria as described in the fourth aspect of the present invention, or the expression cassette as described in the fifth aspect of the present invention in improving plant growth potential, and / or increasing plant height, and / or increasing plant biomass, and / or increasing photosynthetic rate, and / or increasing chlorophyll relative content, and / or reducing electrolyte exudation rate, and / or reducing leaf dead rate, and / or reducing Na in plant stems and leaves. + and Cl - content, and / or increase Ca in plant leaves 2+ Application in content.

[0018] In a specific embodiment of the present invention, the plant is soybean.

[0019] The tenth aspect of the present invention is to provide a primer pair, wherein the primer pair is F':TTATCAGAGATTAGCAGGGA and R':ACAAGAAAAGGAAGAAGGAG; or the primer pair is F':TATCAGAGATTGGCAGGGAACA and R':ACCAGGGACATGAAAAGGAAG.

[0020] The present invention cloned the SLAH1 gene of the root system of Vigna fasciata for the first time from the root system of Vigna fasciata. Studies have shown that the gene can significantly improve the survival ability of plants under stress such as high salt, promote plant growth, increase plant root length, increase plant biomass, increase photosynthetic rate and relative chlorophyll content, reduce electrolyte exudation rate and reduce leaf dead rate, etc. The salt tolerance of soybeans with SLAH1 gene is significantly improved, and it is expected to be cultivated into salt-tolerant transgenic soybean varieties and planted in saline-alkali land. The present invention provides new candidate genes for research on improving plant stress resistance, promoting plant growth, changing plant phenotypes, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The phenotype, root length, relative chlorophyll content and electrolyte exudation rate of SLAH1 transgenic Arabidopsis after 6 days of 200mM NaCl treatment were measured. WT is wild-type Arabidopsis, and line1-3 are three types of SLAH1 transgenic Arabidopsis. The control is normal cultivation conditions.

[0022] Figure 2 This is the map of the WMV069 empty vector.

[0023] Figure 3 The phenotype, photosynthetic rate, relative chlorophyll content and electrolyte exudation rate of SLAH1 transgenic soybeans after 12 days of 200 mM NaCl treatment were measured. JACK is an empty vector-transformed soybean variety. The control is normal cultivation conditions.

[0024] Figure 4 Na in roots, stems and leaves of SLAH1 transgenic soybean treated with 200 mM NaCl for 12 days + , Cl - , Ca 2+ JACK is the soybean variety transformed with an empty vector. CK is the normal cultivation condition, and T is the 200 mM NaCl treatment.

[0025] Figure 5 The fresh weight and dead leaf rate of SLAH1 soybean were calculated after 12 days of treatment with 200 mM NaCl. JACK is a soybean variety transformed with an empty vector. The control is a normal cultivation condition. DETAILED DESCRIPTION

[0026] The present invention will be further described below with reference to the accompanying drawings in conjunction with specific embodiments to better understand the present invention. Where specific techniques or conditions are not indicated in the embodiments, the techniques or conditions described in the literature in this area or the product specifications are used. Where the manufacturer of the reagents or instruments used is not indicated, they are all conventional products that can be obtained commercially.

[0027] Example 1: Cloning of SLAH1 gene

[0028] Vigna serrata germplasm was collected from the seaside of Gancheng Town, Dongfang City, Hainan Province, at longitude 108.634, latitude 18.867, and altitude -9.35 meters. Total RNA was extracted from the root system of Vigna serrata, and the first strand of cDNA was obtained by reverse transcription. PCR amplification reaction was performed using the first strand of cDNA as a template and F':TTATCAGAGATTAGCAGGGA and R':ACAAGAAAAGGAAGAAGGAG as primers.

[0029] (1) PCR amplification reaction system:

[0030]

[0031] (2) PCR amplification reaction conditions:

[0032]

[0033] Melting curve:

[0034]

[0035] The amplified product was recovered to obtain the SLAH1 gene of the Vigna fasciata root system, and sequenced. The coding region sequence of the SLAH1 gene of the Vigna fasciata root system is shown in SEQ ID NO:1.

[0036] Example 2: Transgenic Arabidopsis thaliana with SLAH1 gene

[0037] 1. Planting of Arabidopsis

[0038] 1) Preparation of culture medium: MS was selected as the culture medium for Arabidopsis thaliana and was prepared in advance (pH = 5.8).

[0039] 2) Seed disinfection: Add 1 ml of 5% sodium hypochlorite solution (containing 1 drop of Tween) to a 1.5 ml centrifuge tube, mix by inversion for 8 minutes, and rinse with sterile water 5 times;

[0040] 3) After the sterilized seeds are divided into packages, they are mixed with a 40-50°C culture medium, poured into a plate, and evenly spread in one layer (a small culture dish requires about 4-5 ml of culture medium);

[0041] 4) Seal the plate, put it in a 4℃ refrigerator for 2-3 days, and place it in an artificial climate chamber to start germination and growth. The plant growth environment is 60% relative humidity; constant temperature 21-23℃; photoperiod is 16h light, 8h dark; light intensity is 80-200μmol / M 2 / S;

[0042] 5) Preparation of planting soil: Mix peat soil and vermiculite in a ratio of 2:1 and set aside for later use;

[0043] 6) Soaking the soil: put the soil into the planting pot to about 1cm from the pot mouth, and use Huawuque compound fertilizer (N, P, K = 20%, 20%, 20%) to completely soak it;

[0044] 7) Transplantation: 7 to 12 days after germination, select the healthy and uniformly growing seedlings and transplant them into the culture soil that has been soaked in Huawuque beforehand. Cover with plastic wrap and remove it after the seedlings are alive.

[0045] 8) Cultivate until it sprouts and flowers.

[0046] 2. SLAH1 gene positive Agrobacterium

[0047] (1) Construction of recombinant vector

[0048] Total RNA was extracted from the root system of Vigna serrata and reverse transcribed to obtain the first strand of cDNA. The first strand of cDNA was used as a template and F':TTATCAGAGATTAGCAGGGA and R':ACAAGAAAAGGAAGAAGGAG as primers to perform PCR amplification. The reaction system and reaction procedure were as follows:

[0049] PCR system:

[0050]

[0051] Reaction conditions:

[0052]

[0053] The amplified product was recovered to obtain the full-length sequence of SLAH1 with BamHI and PstI restriction sites. The PHB empty vector and the full-length sequence of SLAH1 with added restriction sites were double-digested with BamHI and PstI, and then the two fragments were connected and transformed into competent E. coli, and spread on LB solid culture medium. After a single colony was grown, a positive PCR test was performed to obtain the PHB expression vector.

[0054] (2) Cultivation of Agrobacterium

[0055] The Agrobacterium culture medium used was LB medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, pH 7.0 (Note: 15 g agar was added per liter when preparing the solid culture medium.

[0056] Take the competent Agrobacterium stored at -80℃ and place it at room temperature or in the palm of your hand for a while until it partially melts. When it is in an ice-water mixing state, insert it into ice. Add 0.1μg (volume not more than 10μl) plasmid DNA for every 100μl competent state, stir the bottom of the tube by hand to mix, and let it stand on ice for 5min, liquid nitrogen for 5min, 37℃ water bath for 5min, and ice bath for 5min. Add 700μl LB liquid culture medium without antibiotics and culture at 28℃ and 200rpm for 2-3h. Centrifuge at 6000rpm for one minute to collect the bacteria, keep about 100μl of supernatant, gently blow and resuspend the bacteria block, apply it on the LB plate containing 50μg / ml kanamycin, and invert it in a 28℃ incubator for 2-3d. Randomly select a single colony, do colony PCR, identify the correct Agrobacterium monoclone and mark it for use.

[0057] Use a sterile pipette to pick up the marked Agrobacterium monoclone and inoculate it into 1.5ml LB liquid medium containing the corresponding antibiotics (use a 50ml blue-capped centrifuge tube) and shake culture at 30℃, 200rpm for 24h. Inoculate the Agrobacterium culture with a small shake at a ratio of 1% into 100ml LB liquid medium containing antibiotics and shake culture at 30℃ until OD600 = 1.0. Centrifuge at 20℃, 4,000rpm for 15min to collect the bacteria. Use the transformation buffer to evenly blow the bacteria and resuspend them to about OD600 = 1.0 for use.

[0058]

[0059] 3. Transformation of Arabidopsis

[0060] Water the plants that are about to sprout and bloom one day in advance. Invert the small pot and place all the inflorescences in the bacterial solution suspended in the transformation buffer for about 30 seconds. Repeat the transformation once after 7 days. After 2-3 weeks, try to use less nutrient solution to accelerate aging. Collect the mature seeds in a paper bag and put them in a desiccator for 7 days.

[0061] 4. Screening of transgenic Arabidopsis

[0062] 1) Preparation of culture medium: The culture medium for Arabidopsis thaliana is 1 / 2MS (0.8% agar powder, without sucrose, pH 5.8).

[0063] 1 / 2MS (1L) preparation method:

[0064] MS Basal Salt Mixture (Phyto Technology Laboratories#M524): 2.17g

[0065] Murashige and SkoogVitaminpowder(Sigma#M3900): 0.5ml

[0066] Inositol 50mg

[0067] Add water to 1L and adjust the pH to 5.8

[0068] Add 8 g of fat powder and sterilize at 121°C for 20 min.

[0069] 2) Seed disinfection: 70% ethanol for 1 min, add 1 ml of 7% sodium hypochlorite solution (containing 1 drop of Tween) for disinfection for 10 min, invert and mix for 5 min, and rinse with sterile water 5 times.

[0070] 3) Resuspend the sterilized seeds with 100 μl sterile water, pipette with a 1 ml pipette tip, and spot on a 1 / 2 MS medium (selective antibiotics are added to the medium: 50 μg / ml KAN or 30 μg / ml HYG or 50 μM Glufosinate-ammonium) plate.

[0071] 4) Seal the plate, place in a 4℃ refrigerator for 48 hours, and place in an artificial climate chamber to start germination and growth. The plant growth environment is 60% relative humidity; constant temperature 20-22℃; photoperiod is 16h light, 8h dark; light intensity is 80-200μmol / M 2 / S.

[0072] 5) Observe after 8-15 days, identify the positive ones through positive PCR detection and transplant them into planting soil.

[0073] Preparation of planting soil: Mix peat soil and vermiculite in a ratio of 2:1 and set aside.

[0074] 6) Soaking the soil: Fill the soil into the planting pot to about 1 cm from the pot mouth, and use Huawuque compound fertilizer (N, P, K = 20%, 20%, 20%) to completely soak it.

[0075] 7) Transplantation: 20 days after germination, select the healthy and uniformly growing seedlings and transplant them into the culture soil that has been soaked with Huawuque fertilizer in advance. Cover it with plastic wrap and remove it after the seedlings are alive.

[0076] 8) Continue to culture according to the culture method of non-transgenic normal Arabidopsis to obtain transgenic Arabidopsis seeds.

[0077] 5. Salt tolerance test

[0078] Transgenic Arabidopsis seeds were germinated on a medium containing hygromycin and 200 mM NaCl, and wild-type Arabidopsis was used as a control (WT). The results were observed after 6 days. Figure 1 As shown in the figure, under 200mM NaCl treatment, the root length, chlorophyll relative content and photosynthetic rate of transgenic Arabidopsis were significantly higher than those of the control, and the electrolyte exudation rate was significantly lower than that of the control, indicating that the salt tolerance of transgenic Arabidopsis was significantly better than that of the control. Under normal cultivation conditions, the root length of transgenic Arabidopsis and the control group increased significantly, and there was no significant difference in photosynthetic rate and electrolyte exudation rate.

[0079] Method for determining the relative content of chlorophyll: Use a TYS-B chlorophyll meter (Zhejiang Top Company) to measure the SPAD value of chlorophyll content, and randomly select healthy and mature leaves on the upper part of the plant for determination.

[0080] Electrolyte extravasation rate determination method: refer to Zou Qi's method (2004), adopt the conductivity method and improve it. Add 20ml of deionized water to a 50ml centrifuge tube and measure the initial conductivity E0 (S0<0.4); randomly cut healthy and mature leaves from the upper part of the plant, wash with distilled water, dry the water on the leaves with absorbent paper, then accurately weigh 0.5g, cut into 1cm small sections, put in a test tube with the initial conductivity value measured, shake for 24h, and then use a DDS-320 digital conductivity meter (produced by Shanghai Dapu Instrument Co., Ltd.) to measure its conductivity value E1. Then seal the test tube and place it in a boiling water bath for 30min to kill the plant tissue. After taking out the test tube, cool it to room temperature with tap water, shake it well and use a conductivity meter to measure its conductivity value E2. Calculate the relative conductivity according to the formula EL (%) = (E1-E0 / E2-E0) × 100%.

[0081] Example 3: Transgenic soybeans with SLAH1 gene

[0082] 1. SLAH1 gene positive Agrobacterium

[0083] (1) Construction of recombinant vector

[0084] Total RNA was extracted from the root system of Vigna serrata and reverse transcribed to obtain the first strand of cDNA. PCR amplification was performed using the first strand of cDNA as a template and primers F':TATCAGAGATTGGCAGGGAACA and R':ACCAGGGACATGAAAAGGAAG.

[0085] PCR reaction 50μm system:

[0086]

[0087] The reaction procedure is as follows:

[0088] The PCR machine runs the following series of reactions

[0089]

[0090] The amplified product was recovered to obtain the full-length sequence of SLAH1 with BamHI and SpeI restriction sites. The WMV069 empty vector and the full-length sequence of SLAH1 with added restriction sites were double-digested with BamHI and SpeI, and then the two fragments were connected, transformed into competent E. coli, and spread on LB solid culture medium. After a single colony was grown, a positive PCR test was performed to obtain the WMV069 expression vector.

[0091] WMV069 empty vector was commissioned by Weimi Biotechnology Co., Ltd. to be transformed from PCAMBIA3300 vector. The map of WMV069 empty vector is as follows Figure 2 shown.

[0092] (2) Cultivation of Agrobacterium

[0093] 1) 20μl Agrobacterium (EHA105-WM) + 1μl recombinant plasmid, ice bath for 5min, quick freeze in liquid nitrogen for 5min, 37℃ water bath for 5min, ice bath for 5min. Add 100μl antibiotic-free LB, shake at 28℃ 200rpm for 2h, directly apply on the plate with corresponding bacterial antibiotics + rifampicin, and culture at 28℃ for 2d.

[0094] 2) Picking single clone bacteria:

[0095] Two days later, pick a single clone and put it into a 5 ml sterile EP tube, add 2 ml of the corresponding bacterial antibiotic + rifampicin in advance, and shake the bacteria overnight.

[0096] 3) Preservation of glycerol bacteria: 400μl bacterial solution + 100μl 75% sterile glycerol, mark well, and store in a -70℃ refrigerator. Use the remaining bacterial solution to extract the plasmid and transform E. coli (1μl plasmid + 20μl competent E. coli, stand on ice for 30min, heat shock at 42℃ for 35s, stand on ice for 2min, add 100μl LB without antibiotics, shake at 37℃, 200rpm, for 1h, plate, LB + corresponding bacterial antibiotics, and culture at 37℃ for 1d).

[0097] 4) Pick a single clone and shake the bacteria in the morning, send the bacterial solution directly for sequencing in the evening, and select part of it for sequencing.

[0098] 5) The sequencing feedback is correct, verifying that there is no problem with the Agrobacterium, and the prepared Agrobacterium can be used for the subsequent transformation experiment.

[0099] 2. Genetic transformation

[0100] The soybean variety JACK, which has germinated for 1 day, was used as the material and placed in a culture dish containing 50 ml of Agrobacterium suspension. About 150 explants were treated within 2 hours and placed at room temperature for 30 minutes for infection. After the infection, the Agrobacterium liquid was discarded, and the explants were placed in a co-culture medium and co-cultured in the dark at 23°C for 3 days. After co-culture, the embryos were transferred to a resting culture medium, cultured in light at 25°C for 7 days, and then placed on a screening culture medium with corresponding resistance, cultured for three weeks, and induced resistant buds. Then they were transferred to an elongation culture medium with corresponding resistance and cultured in light for 6-9 weeks. The regenerated elongated seedlings were cultured for rooting.

[0101] After transplanting the plug tray, the T0 plants were tested for genes and positive plants were obtained. The growth potential and biomass of positive plants were significantly higher than those of the control. Primers: Bar-F1: CCATCGTCAACCACTACATCGAGACA and Bar-R1: CTTCAGCAGGTGGGTGTAGAGCGT, amplification size 269bp. The reaction system (20μl) is: 10μl 2*PCR buffer, 7μl H2O, 1μl upstream primer (10μM) 1μl downstream primer (10μM) 1μl DNA. The reaction procedure is as follows:

[0102]

[0103]

[0104] 3. Salt tolerance test

[0105] After the transgenic soybean seedlings were cultured to the T2 generation, the transgenic soybean seedlings of one month old in the sand culture were taken and irrigated with Hongland nutrient solution (control) and Hongland nutrient solution containing 200mM NaCl, respectively, once a day. The soybean seedlings transformed with an empty vector were used as blank control (JACK) and observed after 12 days. Figure 3 and Figure 4 , Figure 5 As shown ( Figure 3 All the potted plants in the above picture were irrigated with Hongland nutrient solution containing 200mM NaCl. The first pot on the left is the control (empty vector-transformed soybean), and the second to fourth pots on the left are SALH1-transformed soybeans). Under salt treatment, the growth potential, plant height, and biomass of transgenic soybean seedlings were significantly higher than those of empty vector-transformed soybeans, the dead leaf rate was significantly lower than the control, the photosynthetic rate and relative chlorophyll content were significantly higher than the control, and the electrolyte exudation rate was significantly lower than that of empty vector-transformed soybeans. Na in stems and leaves + , Cl - The contents of leaf Ca 2+ The content was significantly higher than that of soybean transformed with empty vector ( Figure 4 The results show that the salt tolerance of soybeans transformed with SLAH1 gene is significantly improved, and it is expected to be cultivated into salt-tolerant transgenic soybean varieties. Under normal cultivation conditions (control), soybeans transformed with empty vector and soybeans transformed with CML37 showed no dead leaves, that is, the dead leaf rate was 0; the relative content of chlorophyll, relative water content and dead leaf rate were not significantly different. Under normal cultivation conditions, the Na in soybean roots, stems and leaves was + , Cl - There was no significant difference in content ( Figure 4 Under normal cultivation conditions, the fresh weight of SLAH1 transgenic soybeans was significantly higher than that of empty transgenic soybeans.

[0106] Photosynthetic rate determination method: The net photosynthetic rate of leaves (Pn, μmol·CO2 m -2 s -1 ). The parameters for photosynthesis determination were set as follows: CO2 concentration 400 μmol·mol -1 , flow rate 400 μmol·s -1 , the light intensity was 1000 μmol·m -2 s -1 The leaves measured were randomly selected from the upper part of the plant, which were healthy and mature.

[0107] The formula for calculating the leaf withering rate is: the percentage of leaves with withering symptoms in 50% of the area to the total number of leaves (Feng, 2018).

[0108] Method for determining the relative content of chlorophyll: Use a TYS-B chlorophyll meter (Zhejiang Top Company) to measure the SPAD value of chlorophyll content, and randomly select healthy and mature leaves on the upper part of the plant for determination.

[0109] Electrolyte extravasation rate determination method: refer to Zou Qi's method (2004), adopt the conductivity method and improve it. Add 20ml of deionized water to a 50ml centrifuge tube and measure the initial conductivity E0 (S0<0.4); randomly cut healthy and mature leaves from the upper part of the plant, wash with distilled water, dry the water on the leaves with absorbent paper, then accurately weigh 0.5g, cut into 1cm small sections, put in a test tube with the initial conductivity value measured, shake for 24h, and then use a DDS-320 digital conductivity meter (produced by Shanghai Dapu Instrument Co., Ltd.) to measure its conductivity value E1. Then seal the test tube and place it in a boiling water bath for 30min to kill the plant tissue. After taking out the test tube, cool it to room temperature with tap water, shake it well and use a conductivity meter to measure its conductivity value E2. Calculate the relative conductivity according to the formula EL (%) = (E1-E0 / E2-E0) × 100%.

[0110] Na + , Ca 2+ Content determination method: microwave digestion-ICP OES method; Cl - Content determination method: Argentometric method (direct titration method).

[0111] The specific embodiments of the present invention are described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modification and substitution of the practical is also within the scope of the present invention. Therefore, the equalization transformation and modification made without departing from the spirit and scope of the present invention should be included in the scope of the present invention.

Claims

1. A Vigna oleracea root SLAH1 gene, characterized in that: The coding region sequence is shown in SEQ ID NO:

1.

2. The protein encoded by the SLAH1 gene of the Vigna foetida root system according to claim 1.

3. A recombinant vector or host bacteria or expression cassette containing the coding region of the Vigna foetida root SLAH1 gene according to claim 1.

4. The recombinant vector according to claim 3, characterized in that The original vector of the recombinant vector is the PHB expression vector, and the coding region of the SLAH1 gene of the cowpea root system is located between the two restriction endonuclease sites of BamHI and PstI of the PHB expression vector; or, the original vector of the recombinant vector is the WMV069 expression vector, and the coding region of the SLAH1 gene of the cowpea root system is located between the two restriction endonuclease sites of BamHI and SpeI of the WMV069 expression vector.

5. Use of the Vigna serrata root SLAH1 gene as claimed in claim 1, or the protein as claimed in claim 2, or the recombinant vector or host bacteria or expression cassette as claimed in any one of claims 3 to 5 in improving plant salt tolerance and / or promoting plant growth.

6. Use of the Vigna serrata root SLAH1 gene as described in claim 1, or the protein as described in claim 2, or the recombinant vector or host bacteria or expression cassette as described in any one of claims 3 to 5 in increasing plant root length, and / or increasing the relative content of chlorophyll, and / or reducing electrolyte exudation rate.

7. The use according to claim 7, characterized in that The plant is Arabidopsis thaliana.

8. The SLAH1 gene of the cowpea root system according to claim 1, or the protein according to claim 2, or the recombinant vector or host bacteria or expression cassette according to any one of claims 3 to 5 is effective in improving plant growth potential, and / or increasing plant height, and / or increasing plant biomass, and / or increasing photosynthetic rate, and / or increasing chlorophyll relative content, and / or reducing electrolyte exudation rate, and / or reducing leaf dead rate, and / or reducing Na in plant stems and leaves. + and Cl - content, and / or increase Ca in plant leaves 2+ Application in content.

9. The use according to claim 7, characterized in that The plant is soybean.

10. A primer pair, characterized in that: The primer pair is F':TTATCAGAGATTAGCAGGGA and R':ACAAGAAAAGGAAGAAGGAG; or F':TATCAGAGATTGGCAGGGAACA and R':ACCAGGGACATGAAAAGGAAG.

Images