Application of Pyrus bretschneideri E3 ubiquitin ligase PbXBAT31 in negative regulation of plant cold resistance and method thereof
Patent Information
- Application Number
- CN202411879400.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-19
- Publication Date
- 2026-06-23
- Estimated Expiration
- 2044-12-19
Smart Images

Figure CN119685351B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to the application and method of Pyrus pyrifolia E3 ubiquitin ligase PbXBAT31 in the negative regulation of cold resistance in plants. Background Technology
[0002] Low-temperature stress is a significant environmental factor affecting plant growth and development. Based on temperature, low-temperature stress can be categorized into chilling injury (0–15 °C) and freezing injury (<0 °C) (Ding et al., 2019). Chilling injury reduces the fluidity of plant cell membranes, disrupts protein stability, impairs enzyme function, and alters gene expression and protein synthesis (Shi et al., 2018). Freezing injury leads to the formation of ice crystals in the extracellular matrix, causing irreversible damage such as cell dehydration and membrane disruption (Dowgert et al., 1984; Pearce et al., 2001). Both forms of stress not only reduce plant yield and quality but also limit plant growth and distribution in different geographical regions (Ding and Yang, 2022). However, most temperate plants possess a certain degree of low-temperature adaptation, known as low-temperature resilience, exhibiting stronger frost resistance after experiencing non-freezing temperatures. Numerous physiological and molecular changes occur during cold adaptation. These include transcriptional, translational, and metabolic changes that can increase or decrease the levels of specific proteins, metabolites, and plant hormones (Uemura et al., 1995; Thomashow et al., 1999).
[0003] Regulating the levels of key proteins that play a vital role in plant growth and development is essential for maintaining homeostasis and protein turnover (Gagne et al., 2002; Wang et al., 2014; Kumar et al., 2019). Protein hydrolysis, or protein degradation, is one of the important post-translational regulatory mechanisms in response to intracellular signals and the environment (Gagne et al., 2002; Shu and Yang, 2017). Eukaryotes frequently utilize the ubiquitin-proteasome system to regulate protein load by irreversibly degrading proteins (Gagne et al., 2002; Lechner et al., 2006; Brenner et al., 2017; Yumimoto et al., 2020). It is estimated that over 80% of cellular proteins are degraded via the ubiquitin-proteasome system (UPS) (Wang et al., 2014). Ubiquitin ligases play an important role in regulating protein abundance, ensuring that stress responses are initiated only when needed, maintained at an appropriate intensity, and rapidly eliminated when no longer needed.
[0004] Most RING zinc finger proteins possess E3 ubiquitin ligase activity (Joazeiro and Weissman, 2000). Compared to other eukaryotes, plant genomes contain more RING protein-coding genes; for example, Arabidopsis thaliana, rice, and poplar contain 469, 378, and 399 RING-type E3-coding genes, respectively, while humans and Saccharomyces cerevisiae contain only 300 and 47, respectively (Stone et al., 2005; Li et al., 2008; Du et al., 2009). RING zinc finger proteins possess characteristic RING zinc finger domains. They bind to specific gene sequences, interact with a variety of proteins, participate in signal transduction and gene expression, and mediate growth, development, and environmental adaptation (An et al., 2017c; Sun et al., 2019; Han et al., 2020b). RING zinc finger proteins regulate photomorphogenesis, floral organ size, rosette leaf shape, root development, flowering time, fruit development, and symbiotic nodules (Han et al., 2022). Furthermore, RING zinc finger proteins play a crucial role in abiotic stress tolerance (Lu et al., 2017), particularly under drought, temperature, salt, and ROS stress (Kim et al., 2019).
[0005] In plants, RING zinc finger proteins respond to various abiotic stresses through different pathways, such as stress-responsive gene expression, the ABA pathway, ubiquitination, ROS, and Ca2+ signaling. In ABA signal transduction, several RING-type E3 ligases (such as SDIR1, AtAIRP1, RHA2a, and RHA2b) have been found to be positive regulators. Plants lacking these genes are insensitive to ABA, while transgenic plants overexpressing them exhibit high ABA sensitivity and improve drought tolerance by enhancing ABA-induced stomatal closure (Zhang et al., 2007; Bu et al., 2009; Ryu et al., 2010; Li et al., 2011). For example, SDIR1, as a membrane-bound protein, is upregulated under salt and drought stress and functions upstream of ABA-responsive transcription factors (Zhang et al., 2007). AtAIRP expression is induced by ABA, low temperature, salt, and drought stress, and this process is regulated by ABA-activated protein kinases (Ryu et al., 2010; Fujita et al., 2009). RHA2a and RHA2b have redundant and parallel functions with transcription factors such as ABI3 and ABI5 in the ABA response (Bu et al., 2009; Li et al., 2011). RING-type E3 ligases also play an important role in cold signal transduction. ICE1 (CBF expression inducible factor 1) is a MYC-type transcription factor that controls the expression of the cold-response transcription factor CBF3 / DREB1A and regulates the transcription of multiple cold-response genes (Chinnusamy et al., 2003). Low temperature not only increases ICE1 expression but also activates the protein, but the abundance of ICE1 decreases under cold-induced conditions, a process associated with UPS (Dong et al., 2006). Studies have found that the RING-type E3 ligase HOS1 is a key regulator of ICE1 ubiquitination and degradation. Overexpression of HOS1 reduces plant cold tolerance and downregulates the expression of ICE1 target genes (Xiong et al., 2002; Dong et al., 2006). Despite variations in the RING domain of HOS1, it can still catalyze ICE1 ubiquitination. Cold-induced HOS1 translocates from the cytoplasm to the nucleus, promoting ICE1 degradation (Lee et al., 2001; Stone et al., 2005). This mechanism of ICE1 degradation at low temperatures suggests that the expression of cold-responsive genes is a rapid and transient response to cold stress (Chinnusamy et al., 2003).
[0006] Pear is one of my country's three major fruits. As a perennial woody plant, pear is frequently subjected to low-temperature freezing damage, causing significant losses to the pear industry. Therefore, cultivating varieties resistant to low-temperature freezing damage is one of the important goals of plant breeding. However, pears have complex genetic backgrounds, are self-incompatible, and have a long juvenile period, making it difficult to obtain new resistant varieties using traditional hybridization methods. Wild pear (Pyrus pyrifolia), on the other hand, is a widely used rootstock in the pear industry and possesses strong stress resistance, making it an ideal material for discovering cold-resistant genes in woody plants. Currently, research on E3 ubiquitin ligases... PbXBAT31 The specific mechanisms regulating plant responses to low-temperature stress remain unclear. Therefore, using genetic engineering techniques, an E3 ubiquitin ligase was cloned from *Pyrus pyrifolia*. PbXBAT31 Transferring genes into other plants is of great significance for studying their functions and has great application potential. Summary of the Invention
[0007] This invention addresses the technical problem and overcomes the shortcomings of existing technologies by providing the application and method of Pyrus pyrifolia E3 ubiquitin ligase PbXBAT31 in the negative regulation of plant cold resistance. The E3 ubiquitin ligase was isolated and cloned from Pyrus pyrifolia leaves. PbXBAT31 Gene and its application in plant cold resistance. Overexpression of this gene in Arabidopsis and *Ligustrum lucidum* resulted in increased sensitivity to low temperatures.
[0008] The purpose of this invention is to provide an E3 ubiquitin ligase isolated from pear. PbXBAT31 The gene, whose nucleotide sequence is shown in SEQ ID NO.1.
[0009] The further optimized technical solution of this invention is as follows:
[0010] The E3 ubiquitin ligase isolated from *Pyrus pyrifolia* was described above. PbXBAT31 The protein encoded by the gene has the amino acid sequence shown in SEQ ID NO.2.
[0011] This invention also provides an E3 ubiquitin ligase for cloning the above-mentioned E3 ubiquitin ligase isolated from *Pyrus pyrifolia*. PbXBAT31 Primer pairs for the gene cDNA sequence, including a forward primer and a reverse primer, wherein the nucleotide sequence of the forward primer is shown in SEQ ID NO.3 and the nucleotide sequence of the reverse gene is shown in SEQ ID NO.4.
[0012] The E3 ubiquitin ligase isolated from *Pyrus pyrifolia* was described above. PbXBAT31 In the gene amplification method, the E3 ubiquitin ligase PbXBAT31 The cloning conditions for the gene were: 94°C pre-denaturation for 3 minutes; 94°C denaturation for 30 seconds, 58°C annealing for 30 seconds, 72°C extension for 90 seconds, for 35 cycles, followed by 72°C extension for 10 minutes.
[0013] This invention provides an E3 ubiquitin ligase isolated from pear. PbXBAT31 Gene expression patterns in response to low temperature.
[0014] This invention also provides an E3 ubiquitin ligase isolated from pear. PbXBAT31 The application of genes in reducing plant cold resistance.
[0015] In the above applications, build PbXBAT31 Plant overexpression vectors for genes were developed, and Agrobacterium-mediated genetic transformation was used to... PbXBAT31 Gene introduction into plants enables the E3 ubiquitin ligase in pear trees to... PbXBAT31 Overexpression in plants yields transgenic plants with significantly reduced cold resistance.
[0016] In the above applications, the plant is Arabidopsis thaliana seedling, pear callus, or wild pear seedling.
[0017] The present invention PbXBAT31 The gene, an E3 ubiquitin ligase containing a RING domain, was isolated and cloned from *Pyrus pyrifolia* rootstock. An overexpression vector was constructed, and the gene was introduced into *Arabidopsis thaliana* and *Pyrus pyrifolia* callus tissues using Agrobacterium-mediated transformation, achieving stable expression and obtaining overexpression lines. The low-temperature resistance function of these overexpression lines was analyzed. The results showed that under low-temperature stress, the overexpression lines exhibited poorer growth, higher malondialdehyde (MDA) content, and lower antioxidant capacity compared to the wild type. These results indicate that... PbXBAT31 Genes in plants have the function of reducing cold resistance. This study reveals... PbXBAT31 Genes can serve as negative regulatory targets in cold-resistant breeding, providing new theoretical support and genetic resources for improving plant cold resistance. Attached Figure Description
[0018] Figure 1 This is a flowchart illustrating the technical process of the present invention.
[0019] Figure 2 In this invention PbXBAT31 Schematic diagram of low-temperature expression pattern analysis and subcellular localization. In the diagram, A represents... PbXBAT31 Figure 1 shows the results of low-temperature expression pattern analysis. B is a schematic diagram of subcellular localization.
[0020] Figure 3 In this invention PbXBAT31 Positive identification results after gene transformation of Arabidopsis thaliana seedlings. In the figure, A represents... PbXBAT31 Image A shows the DNA identification results of Arabidopsis thaliana, while image B shows the RNA identification results of transgenic Arabidopsis thaliana.
[0021] Figure 4 In this invention PbXBAT31Figure 1 shows the results of cold resistance analysis of Arabidopsis thaliana overexpression. In the figure, A represents overexpression. PbXBAT31 Phenotypic images of Arabidopsis thaliana seedlings after 3 days of low-temperature treatment at 0℃ and 5 days of recovery. B shows the conductivity measurement results after low-temperature treatment; C shows the malondialdehyde (MDA) measurement results after low-temperature treatment; D shows the hydrogen peroxide (H2O2) content measurement results after low-temperature treatment; E shows the resistance to superoxide anion (Anti-O2) after low-temperature treatment. - The results of the activity assay are shown in the figure.
[0022] Figure 5 In this invention PbXBAT31 Image showing the positive identification results of gene-transformed pear callus. In the image, A represents... PbXBAT31 Image showing the results of DNA identification from gene-transformed pear callus; B represents... PbXBAT31 Image showing the results of identifying positive RNA from gene-transformed pear callus.
[0023] Figure 6 For the overexpression in this invention PbXBAT31 Figure 1 shows the results of cold resistance analysis in *Pyrus pyrifolia* callus. In the figure, A represents overexpression after 14 days of low-temperature treatment. PbXBAT31 Phenotypic diagram of callus from pear; B represents overexpression after 14 days of low-temperature treatment. PbXBAT31 Weight of pear callus; C shows the MDA measurement results under normal conditions and after 14 days of low-temperature treatment; D shows the proline measurement results under normal conditions and after 14 days of low-temperature treatment; E shows the H2O2 measurement results under normal conditions and after 14 days of low-temperature treatment; F shows the Anti-O2 measurement results under normal conditions and after 14 days of low-temperature treatment. - Measurement results diagram. Detailed Implementation
[0024] The technical solution of the present invention will be further described in detail below with reference to the embodiments: This embodiment is implemented under the premise of the technical solution of the present invention, and provides detailed implementation methods and specific operation processes, but the protection scope of the present invention is not limited to the following embodiments.
[0025] In this invention, the pCAMBIA1300-35S-EGFP vector was constructed using homologous recombination. First, the pCAMBIA1300 vector was linearized using restriction endonucleases BamHI and SalI. Then, the EGFP gene was amplified by PCR using primers containing BamHI and SalI restriction sites, and the amplified product was obtained. This product was then ligated to the linearized pCAMBIA1300 vector using homologous recombinase. The ligated product was transformed into competent Escherichia coli DH5α, and positive clones were obtained through kanamycin selection. Finally, sequencing analysis verified the positive clones, confirming successful construction and the acquisition of the recombinant vector. Example 1
[0026] like Figure 1 As shown, pear E3 ubiquitin ligase PbXBAT31 The specific process for its application in reducing plant cold resistance is as follows:
[0027] (1) Pear PbXBAT31 Gene cloning and vector construction
[0028] cDNA from pear leaves was used as a template and PCR amplification was performed using Novizan high-fidelity DNA polymerase. The amplification system is shown in Table 1 and the amplification program is shown in Table 2. PbXBAT31 The primers used for full-length amplification were SEQ ID NO.3 and SEQ ID NO.4.
[0029] Table 1 PCR reaction procedure
[0030]
[0031] Table 2 PCR reaction procedure
[0032]
[0033] PCR products were purified and recovered using a gel extraction kit (Vazyme, Nanjing, China). The recovered products were ligated into the linearized pCAMBIA1300-35S:GFP expression vector, which was preserved in the Horticulture and Plant Protection Laboratory of Yangzhou University. To achieve gene-GFP fusion, the stop codon TAG was removed from the 3′ end of the gene. The pCAMBIA1300-35S:GFP vector plasmid was digested with XbaI and BamHI restriction endonucleases, and purified after incubation at 37°C for 4 hours. Subsequently, the digested pCAMBIA1300-35S:GFP vector was ligated into the linearized pCAMBIA1300-35S:GFP expression vector. PbXBAT31 The fragments were ligated using recombinant ligase at 37°C for 30 minutes. The ligation product was then transformed into DH5α competent *E. coli* cells, plated, and cultured for propagation by shaking. Positive clones were then screened and identified. After screening, the positive clones were sent to Sangon Biotech for sequencing, and the sequencing results confirmed the presence of the desired fragments. PbXBAT31 The full-length cDNA sequence of the gene. The double enzyme digestion system of the pCAMBIA1300-35S vector is detailed in Table 3, and the recombination reaction system is detailed in Table 4.
[0034] Table 3 Double enzyme digestion system
[0035]
[0036] Table 4 Reorganization System
[0037]
[0038] For E. coli with correct sequencing results, plasmids were extracted using a plasmid DNA mini-extraction kit (Vazyme, Nanjing, China), and the plasmids were named. PbXBAT31:GFP The constructed sequencing system is correctly... PbXBAT31-GFP The recombinant vector was transformed into Agrobacterium competent strain GV3101 purchased from Weidi Company for later use.
[0039] (2) PbXBAT31 Low-temperature expression pattern analysis
[0040] To verify PbXBAT31 The response of genes to low-temperature stress was analyzed through experiments examining low-temperature expression patterns. Pyrus pyrifolia seedlings grown for 45 days were treated at 4°C, and samples were taken at 0, 3, 6, 9, and 12 hours. RNA was extracted from samples at each time point, and cDNA was generated through reverse transcription. Real-time quantitative PCR was then performed using the forward primer SEQ ID NO. 5 and the reverse primer SEQ ID NO. 6 to detect the cDNA. PbXBAT31 The expression level was determined using SEQ ID NO.7 as the internal reference primer and SEQ ID NO.8 as the reverse primer. The reaction system is shown in Table 5, and the amplification system is shown in Table 6. Results are as follows: Figure 2 As shown in Figure A, with the extension of low-temperature treatment time, PbXBAT31 The gene expression level gradually increased, indicating that the gene is responsive to low temperature stress.
[0041] Table 5 qRT-PCR reaction procedure
[0042]
[0043] Table 6 qRT-PCR reaction system
[0044]
[0045] (3) PbXBAT31 Subcellular localization analysis
[0046] Healthy, mature tobacco leaves aged 4-6 weeks were selected as materials for transient expression. The constructed PbXBAT31-GFP vector was transformed into strain GV3101 using Agrobacterium-mediated transformation. The transformed Agrobacterium was cultured until its OD600 value reached approximately 0.5-0.8, and then the bacterial solution was injected into tobacco leaf cells using the infiltration method. The injected tobacco plants were then placed in the dark for 24 hours to promote the expression of the PbXBAT31-GFP fusion protein in the tobacco leaf cells. Forty-eight hours after transient expression, the GFP signal in the leaf cells was observed using confocal fluorescence microscopy. The specific intracellular location of PbXBAT31 was determined based on the fluorescence localization of GFP. Figure 2 Figure B shows the results of bright-field, mixed-field, fluorescence-field, and DAPI-field analyses of the control GFP gene and the PbXBAT31 gene. The fluorescence of the control GFP gene was distributed in both the cell nucleus and cell membrane, while the fluorescence of the PbXBAT31 gene was only observed in the cell nucleus, indicating that PbXBAT31 is localized in the cell nucleus.
[0047] (4) PbXBAT31 Obtaining overexpression of Arabidopsis thaliana
[0048] Stored at -80°C PbXBAT31 Agrobacterium was inoculated into liquid LB medium containing appropriate antibiotics (kanamycin, rifampin) and cultured with shaking at 28°C for 16-24 hours until the OD600 value of the bacterial solution reached 0.5-1.0. The cultured Agrobacterium was collected and resuspended in liquid MS medium (containing 50 g / L sucrose and 0.02% surfactant Silwet L-77, pH 5.8) to an appropriate concentration (OD600 approximately 0.8-1.0). Healthy Arabidopsis plants that had grown for about 30 days, with pods already formed on the main inflorescence and secondary inflorescences reaching 2-10 cm in length, and with a small number of flowers, were selected. Fully open inflorescences were removed before infection to improve transformation efficiency. The prepared Arabidopsis plants were inverted so that the inflorescences were immersed in the bacterial solution. Vacuum treatment was applied at 0.05 MPa for 5 minutes to allow Agrobacterium to penetrate the inflorescence tissue. After infection, the plants were removed and placed flat in the dark for 24 hours to promote transformation efficiency. After infection, the plants were transferred to normal light conditions and cultured using standard methods, maintaining humidity, until the seeds matured (T0 generation). The harvested T0 generation seeds were surface-sterilized and evenly sown on MS medium containing a selective antibiotic (e.g., 50 mg / L hygromycin). The medium was incubated at 22°C under 16 hours of light, and after about a week, plants with good growth and long root systems were selected. These seedlings were then transplanted into sterilized potting soil and cultured until the T3 generation to confirm the stability of the transgene.
[0049] DNA was extracted from T0 generation Arabidopsis plants, and PCR amplification was performed using specific primers SEQ ID NO.3 (agaacacgggggactctaga ATGGGTCAAGGGTTGAGT) and SEQ ID NO.4 (gcccttgctcaccatggatccAGGTTTGTCAACCCATTC) to confirm the presence of the target gene. Simultaneously, RNA was extracted from the plants and reverse transcribed into cDNA. qRT-PCR was performed using specific primers SEQ ID NO.5 and SEQ ID NO.6 for verification. Internal control primers SEQ ID NO.11 and SEQ ID NO.12 were used to compare the expression levels between transgenic lines and wild-type to identify overexpression lines.
[0050] Positive lines were screened and identified from the transformed Arabidopsis seedlings. The results are as follows: Figure 3 As shown. Five positive strains were successfully screened through DNA-level analysis (see...). Figure 3 (A). qRT-PCR analysis was performed on these five positive lines to assess their gene expression levels. Based on the analysis results, two lines with higher expression levels (#1 and #2) were selected for subsequent cold resistance identification (see A). Figure 3 B).
[0051] (5) PbXBAT31 Identification of cold resistance in Arabidopsis thaliana overexpression
[0052] To verify PbXBAT31 To investigate the effect of cold resistance on Arabidopsis thaliana, Arabidopsis thaliana plants with a growth period of approximately 30 days and uniform condition were selected and subjected to a low-temperature treatment at 0℃ for 3 days. Afterward, they were transferred to a normal environment for cultivation for 5 days. Figure 4 As shown in A, after 3 days of low-temperature treatment at 0°C, WT and PbXBAT31 Leaves of the overexpression lines all exhibited wilting and water-soaked symptoms, with the transgenic plants showing significantly greater damage than the WT lines. After being restored to normal temperature for 5 days, the transgenic plants showed poor survival, while most WT plants recovered to normal growth. Further physiological analysis revealed significantly increased electrical conductivity and MDA content in the transgenic lines compared to WT, reflecting more severe cell membrane damage (see...). Figure 4 (B and C). Furthermore, after low-temperature treatment, the H2O2 content in the transgenic lines was significantly higher, while the level of Anti-O2⁻ was significantly lower (see B and C). Figure 4 (D and E). In summary, PbXBAT31 Overexpression lines showed weaker cold tolerance under low temperature stress, with greater cell membrane damage and weaker antioxidant defense capabilities.
[0053] (6) PbXBAT31 Callus transformation and overexpression of pear callus
[0054] The cryopreserved *Agrobacterium tumefaciens* strain was streaked onto LB agar plates containing 50 mg / L kanamycin and 50 mg / L rifampin and incubated at 28°C for 36–48 hours until colonies formed. Colonies were then scraped and added to liquid MS medium (pH 5.8) until the OD600 value reached 0.8–1.0. 500 μl / L acetylsylgenin was added as a surfactant to facilitate inoculation. Pear and eggplant callus tissue cultured for 15 days was selected, inverted in the prepared *Agrobacterium* culture solution, and agitated evenly at 100 rpm for 15 minutes. After inoculation, the surface liquid of the callus tissue was gently aspirated, and the tissue was spread evenly on co-culture medium. After two days of co-culture in the dark, the callus tissue was transferred to selection medium for further culture. After approximately 30 days, vigorously growing callus pieces were selected and transferred to new selection medium for continued culture.
[0055] DNA was extracted from callus tissue of PbXBAT31 transgenic pear using a DNA extraction kit, following the kit instructions. Positive identification was performed by PCR amplification using the designed gene upstream primer and vector downstream primers SEQ ID NO. 9 and SEQ ID NO. 10. The reaction system and conditions are detailed in Tables 1 and 2. Samples amplifying the expected band were considered positive transgenic lines. qRT-PCR amplification was performed using specific primers (SEQ ID NO. 5 and SEQ ID NO. 6), with SEQ ID NO. 7 and SEQ ID NO. 8 as internal control primers. The reaction conditions and system are detailed in Tables 3 and 4. The difference in expression levels between the transgenic lines and wild-type was detected by quantitative real-time PCR to determine whether the lines were overexpressing transgenic lines.
[0056] Positive lines were screened and identified from the transformed pear callus, and the results were as follows: Figure 5 As shown. Five positive strains were successfully screened through DNA-level analysis (see...). Figure 5 (A). qRT-PCR analysis was performed on these five positive lines to assess their gene expression levels. Based on the analysis results, two lines with higher expression levels (OE1 and OE2) were selected for subsequent cold resistance identification (see A). Figure 5 B).
[0057] (7) PbXBAT31 Identification of cold resistance of overexpressed pear callus
[0058] To verify PbXBAT31 To investigate the function of pears, cold resistance tests were conducted on pear callus tissue that had grown for 15 days, was tender, and in uniform condition. For example... Figure 6As shown in Figure A, there was no significant difference in growth status between WT and overexpressing callus (PbXBAT31-OE) before low-temperature treatment. However, after 14 days of treatment under low-temperature stress, the PbXBAT31-OE line exhibited a yellowish-brown morphological variation and a lower growth weight than WT, with the OE2 line showing a more pronounced difference (see Figure A). Figure 6 (A and B). Further physiological analysis showed that after low-temperature treatment, the MDA content of the PbXBAT31-OE strain was significantly higher than that of the WT strain (see A and B). Figure 6 (C), while the proline content of the overexpression lines was significantly reduced (see C). Figure 6 (D). Furthermore, increased H2O2 accumulation and significantly weakened Anti-O2⁻ activity were observed in the PbXBAT31-OE strain (see D). Figure 6 The values of E and F indicate that its ability to scavenge ROS is significantly reduced. These results suggest that... PbXBAT31 Overexpression of [a specific ingredient] significantly reduced the cold resistance of transgenic pear callus tissue under low-temperature stress. This reduced cold resistance may be related to increased membrane lipid peroxidation damage and weakened antioxidant defense system, which further led to a significant decrease in the survival ability of callus tissue under low-temperature conditions.
[0059] In summary, this invention provides a low-temperature response gene isolated and cloned from *Pyrus pyrifolia*, and the application of this gene in reducing plant cold resistance, through the construction of... PbXBAT31 An overexpression vector was developed and, using Agrobacterium-mediated transformation, the gene was introduced into Arabidopsis thaliana and pear callus tissues, resulting in overexpression lines. Cold resistance tests showed that the cloned gene... PbXBAT31 Genes have the ability to significantly negatively regulate plant cold resistance.
[0060] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any transformations or substitutions that can be conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.
Claims
1. E3 ubiquitin ligase isolated from pear PbXBAT31 The application of genes in reducing plant cold resistance is characterized by, The PbXBAT31 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the plant is Arabidopsis thaliana seedling, pear callus, or wild pear seedling.
2. The application according to claim 1, characterized in that, Build PbXBAT31 Plant overexpression vectors for genes were developed, and Agrobacterium-mediated genetic transformation was used to... PbXBAT31 Gene introduction into plants enables the E3 ubiquitin ligase in pear trees to... PbXBAT31 Overexpression in plants yields transgenic plants that exhibit sensitivity to low temperatures.