A genome scarless editing method of b. brevis based on reverse screening marker pheS* and application

By using the pheS* gene as a reverse selection marker in Bacillus simulans, combined with overlap extension PCR and homologous recombination technology, the scarless editing plasmid pBE194-LDPR was constructed, solving the problem of incomplete genome editing and achieving efficient and safe scarless genome editing.

CN119685367BActive Publication Date: 2025-12-26HUNAN INST OF MICROBIOLOGY
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202411953336.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-27
Publication Date
2025-12-26
Estimated Expiration
2044-12-27

AI Technical Summary

Technical Problem

Existing technologies have limitations in genome editing in Bacillus simulans, leaving lox72 sequence remnants that affect the identification of specific sites for subsequent editing. Furthermore, they are inefficient and cannot meet the needs of multiple rounds of editing.

Method used

Using the pheS* gene as a reverse selection marker, combined with overlap extension PCR and homologous recombination technology, a traceless editing plasmid pBE194-LDPR was constructed. The target gene region was completely deleted through resistance selection and reverse selection, eliminating plasmid sequence residues.

Benefits of technology

It enables complete and traceless editing of short Bacillus genomes, shortens the reverse screening time, improves editing efficiency, avoids cytotoxicity, and facilitates continuous genome editing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119685367B_ABST
    Figure CN119685367B_ABST
Patent Text Reader

Abstract

This invention discloses Bacillus shortbread based on pheS * A method and application of genome editing without scarring, using genes as reverse selection markers. The purpose of this invention is to use Br. brevis X23 as a model strain and utilize site-directed mutagenesis of pheS... * This invention discloses a genome editing method established using genes as reverse selection markers and its applications. It provides a powerful and convenient genetic manipulation tool for subsequent basic and applied research in this strain, promoting the development of metabolic engineering, combinatorial biosynthesis, and synthetic biology.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to a genome scarless editing method of soil biocontrol bacteria Brevibacillus brevis based on pheS * gene. BACKGROUND

[0002] Brevibacillus spp. is one of the most widely distributed gram-positive bacteria, which can survive in various environmental habitats, has high growth efficiency, is easy to transform by electroporation, has available shuttle vectors, has extremely low extracellular protease activity, and has constitutive expression of heterologous proteins, so that some strains of the genus become excellent model strains and are expected to be developed into a kind of excellent chassis cell.

[0003] Brevibacillus brevis is the producing strain of non-ribosomal peptide antibiotic edeines, which has strong biological control effect on solanaceous economic crops (such as pepper, tobacco, etc.), and has been effectively verified in pot experiments and field experiments.

[0004] The main active substance edeines produced by Brevibacillus brevis has good inhibitory effect on gram-positive bacteria (such as Bacillus subtilis), gram-negative bacteria (such as Escherichia coli, Acinetobacter baumannii), fungi (such as Fusarium), mycoplasma and tumor cells, but its wide application is limited due to certain animal cell toxicity.

[0005] The team of the applicant has established a gene "scarless" editing technology based on the combination of Red / ET recombination and site-specific recombination Cre-loxP system in Brevibacillus brevis X23 strain in the previous work, but it is time-consuming and inefficient, and the biggest problem is that the technology is not truly scarless: after recombination at the two specific sites of lox71 and lox66, although the resistance gene between the two sites is eliminated, a "scar" - a new lox72 sequence remains, which generally does not participate in Cre-loxP mediated recombination, but will bring great interference to the specific site recognition of the next round of editing. Therefore, this technical solution is not suitable for the demand of multiple rounds of genome editing. SUMMARY

[0006] To solve the defects existing in the prior art, the application provides a genome scarless editing method of Brevibacillus brevis based on reverse screening marker pheS * .

[0007] The application provides the following technical solutions.

[0008] The application provides a soil biocontrol bacterium Brevibacillus brevis based on a pheS * A genome scarless editing method based on a pheS

[0009] S1, a pheS 43 gene carrying a mutation site and a forward screening marker gene are constructed by using overlap extension PCR technology. * The pheS * gene carrying a mutation site and the forward screening marker gene are respectively introduced with a ribosome binding site SD sequence between each other to become a PA gene expression cassette as a core element. The pheS * gene carrying a mutation site refers to encoding a protein with A309G relative to a PheS protein in a Br.brevis X23 strain.

[0010] S2, a target DNA fragment containing a PA gene expression cassette and a related homologous arm of a gene to be deleted, referred to as an LDPR fragment, is constructed by using overlap extension PCR technology, and the assembly sequence is in turn: an LF01 fragment of a 600-2000bp region on the left side of the gene to be deleted, a DR01 fragment of a 500-1200bp region downstream of the gene to be deleted as a forward repeat sequence, a PA expression cassette fragment, and an RF01 fragment of a 600-1000bp region between the gene to be deleted and the right side of the LF01 fragment.

[0011] S3, a scarless editing plasmid pBE194-LDPR of the gene to be deleted is fused by using a homologous recombination technology, and the backbone fragment of the Br.brevis-E.coli shuttle vector pBE194 is recovered from the shuttle vector pBE194 by using BamHI / SpeI double enzyme digestion or EcoRV / SmaI double enzyme digestion, and the length of the vector backbone fragment is 4.8kb.

[0012] S4, the editing plasmid pBE194-LDPR is electroporated into Brevibacillus brevis, and a transition strain integrated into the target region on the chromosome is obtained through resistance screening, and then a target strain in which the target gene region on the chromosome is deleted and the plasmid sequence is eliminated is obtained by using a reagent p-Cl-Phe reverse screening, so that the target strain realizes the true and complete scarless editing on the X23 genome.

[0013] Specifically, the forward screening marker gene is an apramycin resistance gene.

[0014] In the specific embodiment, the strain is Brevibacillus brevis X23 strain.

[0015] Preferably, the step S1 specifically comprises: constructing the pheS* Gene fusion in P 43 Strong promoter, pheS * Gene, and fusion of forward screening marker gene, in P 43 Strong promoter and pheS * Gene, and pheS * Gene and forward screening marker gene, respectively, an SD sequence as a ribosome binding site is inserted between them, thereby constructing a PA gene expression cassette.

[0016] Specifically, the step S2 specifically comprises: taking the 600-2000bp region left of the gene to be deleted as the LF fragment, taking the 500-1200bp region downstream of the gene to be deleted as the DR fragment of the forward repeat sequence, taking the PA gene expression cassette as the PA fragment, and taking the 600-1000bp region between the LF fragment and the gene to be deleted as the RF fragment, and the fusion order of the above four fragments is LF-DR-PA-RF, referred to as the LDPR fragment.

[0017] In the specific embodiment, the step S3 specifically comprises: recovering the 4.8kb DNA fragment as the vector skeleton after double digestion of the shuttle plasmid pBE194 with BamHI / SpeI or double digestion with EcoRV / SmaI, and fusing it with the LDPR fragment obtained in the previous step to construct the scarless editing plasmid pBE194-LDPR of the gene to be deleted.

[0018] Preferably, in the step S4, when the reagent p-Cl-Phe is used for reverse screening, the concentration of the reagent p-Cl-Phe is determined as follows: first, the concentration of the B. brevis bacterial solution is determined and diluted with LB culture solution to OD 600 = 1.0, then diluted by 10 times to 10 -4 , take the diluent and spread it on LB solid medium containing different concentrations of reagent p-Cl-Phe in the range of 0.5-5mM, place it in a 30-37℃ incubator for 16-24h after uniform spreading, and observe the growth state and number of X23 colonies to determine the appropriate concentration of p-Cl-Phe for screening.

[0019] In the specific embodiment, the resistance screening step in the step S4 specifically comprises: the editing plasmid pBE194-LDPR is electroporated into B. brevis, and LB resistance plates containing an appropriate concentration of Apr are used for screening, 30-37 DEG C incubator is incubated for 16-24h, the transformants are picked to LB culture solution containing an appropriate concentration of Apr, and 30-37 DEG C constant temperature incubator is cultured for 12-20h, then liquid bacterial PCR verification is carried out, a few correct transformant liquids are randomly selected, which are transition strains integrated into the target region of the chromosome, and a small volume is transferred to fresh LB culture solution without resistance, 30-37 DEG C incubator is incubated for 12-20h, and then the LB solid medium containing an appropriate p-Cl-Phe concentration is inoculated with a loop and incubated in a 30-37 DEG C incubator for 16-24h, a few single bacteria are randomly picked to the LB culture solution without resistance and cultured in a 30-37 DEG C constant temperature incubator for 12-20h, then liquid bacterial PCR verification is carried out, the liquid is optionally sequenced, and the results are correct, which are the final strains in which the target gene region on the chromosome is deleted and the plasmid sequence is eliminated.

[0020] The application provides application of the scarless editing method in gene editing of B. brevis.

[0021] Specifically, the target gene of the gene editing is any non-essential gene region on the chromosome of B. brevis, and the gene editing is gene deletion, insertion or site-directed mutation.

[0022] The application takes the soil biocontrol bacterium B. brevis X23 strain as a model material, and develops a set of pheS * The application of the reverse screening method to the elimination of the sequence of the gene editing vector realizes true and thorough scarless genome editing, and improves the efficiency of the existing genetic operation tool. The technical method has the following beneficial characteristics: a) without modification of the genome, the reverse screening time is shortened, and the reverse screening efficiency is improved; b) without cell toxicity, the target strain is not damaged; c) when reverse screening, not only the target editing gene fragment is deleted, but also the vector itself sequence is eliminated, without any residue, facilitating continuous and unlimited times of genome editing. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 The amino acid sequence alignment chart of different bacterial PheS proteins in the application.

[0024] Figure 2 The construction schematic diagram of the core element PA gene expression cassette in the application.

[0025] Figure 3 The electrophoresis gel map of each DNA fragment of the core element PA gene expression cassette constructed in the application.

[0026] Figure 4 The schematic diagram of construction and screening method of traceless editing plasmid pBE194-LDPR in the application.

[0027] Figure 5 The electrophoresis gel map of each DNA fragment and plasmid restriction enzyme identification of traceless editing plasmid pBE194-LDPR01 constructed in the application.

[0028] Figure 6 The test results of Brevibacillus brevis X23 strain on the tolerance of reverse screening reagent p-chlorophenylalanine (p-Cl-Phe) in the application.

[0029] Figure 7 The electrophoresis gel map of PCR identification of transition strain X23::pBE194-LDPR01 and final traceless editing strain X23Δtyc in the application.

[0030] Figure 8 The sequencing map of PCR identification product of traceless editing strain X23Δtyc in the application. DETAILED DESCRIPTION

[0031] The preferred embodiments of the present application are described below in conjunction with the accompanying drawings, and it should be understood that the preferred embodiments described herein are only used to illustrate and understand the present application, and are not used to limit the present application. The endpoints and any values disclosed in the present application are not limited to the exact range or value, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoint values of each range, the endpoint values of each range and individual point values, and the individual point values can be combined with each other to obtain one or more new numerical ranges, which should be regarded as specifically disclosed in the present application.

[0032] 1. Determination of pheS gene pseudo-mutant site of Brevibacillus brevis X23 strain.

[0033] a) Search and download amino acid sequences of PheS proteins from different bacteria including PheS proteins from Bacillus amyloliquefaciens (GenBank Accession No. WP_003152530.1), Escherichia coli (GenBank Accession No. NP_416229.1), Serratia plymuthica (GenBank Accession No. WP_004943598.1), Yersinia rochesterensis (GenBank Accession No. WP_004393358.1), Thermus thermophilus (GenBank Accession No. WP_011229046.1), Streptomyces griseus (GenBank Accession No. WP_012381604.1) and Brevibacillus brevis (GenBank Accession No. ATF12231.1) from NCBI database.

[0034] b) Align the downloaded PheS protein amino acid sequences from different bacteria using bioinformatics tools such as MEGA and ESPript, and analyze the conserved domains of PheS to determine the mutation site: A309G (alignment analysis chart is shown in FIG. 2). Figure 1 )。

[0035] 2. Core element P43-pheS * Construction of the aac(3)IV (PA) gene expression cassette (schematic diagram is shown in FIG. 3). Figure 2 )。

[0036] a) Amplify the P 43 promoter portion by PCR technology, and introduce the first ribosome binding site SD sequence through the P 43 promoter downstream primer.

[0037] PCR amplification of the P 43 promoter portion used primer sequences:

[0038] P 43 -F: gatcctgataggtggtatgtt (SEQ ID No: 1);

[0039] P 43 -R: TTCTTGCAACCGAGTTTGCACTCTAGATCTcctccttgtgtacattcctctcttacct (SEQ ID No: 2).

[0040] Plasmid pBE194-P 43 (Qingshu Liu, Liang Zhang, Yunsheng Wang, Cuiyang Zhang, Tianbo Liu, Caichen Duan, Xiaoying Bian, Zhaohui Guo, Qingshan Long, Ying Tang, Jie Du, Aiyu Liu, Liangying Dai, Dingjun Li*, Wu Chen*. Enhancement of edeine production in Brevibacillus brevis X23 via in situ promoter engineering [J]. Microbial Biotechnology, 202) as template, P 43 -F / P 43 -R is primer, the amplified length of P 43 promoter (the electrophoresis gel map is shown in Figure 3 ), the reaction condition is: 95℃ pre-denaturation 5min; 95℃ denaturation 20s, 55℃ annealing 20s, 72℃ extension 20s, 35 cycles; 72℃ extension 10min.

[0041] b) using overlap extension PCR technology to amplify pheS * gene carrying mutation site, and introducing first SD sequence through pheS * upstream primer, introducing mutation site through two intermediate primers, and introducing second SD sequence through pheS * downstream primer.

[0042] The primer sequences used in overlap extension PCR amplification of pheS * gene are as follows:

[0043] pheS * -F: aggtaagagaggaatgtacacaaggaggAGATCTAGAGTGCAAACTCGGTTGCAAGAA (SEQ ID No: 3);

[0044] pheSm-R: GTTCTACACCCATACCGAA GCC AAAGCCGCTGACTTCCTCA (SEQ ID No: 4);

[0045] pheSm-F: TGAGGAAGTCAGCGGCTTT GGCTTCGGTATGGGTGTAGAAC (SEQ ID No: 5);

[0046] pheS * -R: atcaattttattaaagttcatACTAGTACTcctccttCTAACCTCGATTGAATTGACG (SEQ ID No: 6).

[0047] Firstly, X23 genomic DNA was used as template, and pheS * -F / pheSm-R, pheSm-F / pheS * -R as primers to amplify two short fragments with length of 0.95 kb and 0.13 kb carrying mutation sites, which were recovered by gel recovery kit and used as template for overlap extension PCR, and then pheS * -F / pheS * -R as primers to amplify pheS * gene with length of 1.04 kb (electrophoresis gel map see Figure 3 ), and the reaction conditions were as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 20 s, 55℃ annealing for 20 s, 72℃ extension for 1 min or 20 s, 35 cycles; 72℃ extension for 10 min.

[0048] c) Using PCR technology to amplify apramycin resistance gene aac(3) IV, and introducing a second SD sequence through upstream primer of aac(3) IV gene.

[0049] The primer sequences used for PCR amplification of aac(3) IV gene were as follows:

[0050] aac(3) IV-F: CGTCAATTCAATCGAGGTTAGaaggaggAGTACTAGTatgcaatacgaatggcgaaaa (SEQ ID No: 7);

[0051] aac(3) IV-R: tcagccaatcgactggcgagc (SEQ ID No: 8).

[0052] Using plasmid pBE194-P 43 (collected by Hunan Microorganism Research Institute) as template, and aac(3) IV-F / aac(3) IV-R as primers to amplify aac(3) IV gene with length of 0.81 kb (electrophoresis gel map see Figure 3 ), and the reaction conditions were as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 20 s, 55℃ annealing for 20 s, 72℃ extension for 1 min, 35 cycles; 72℃ extension for 10 min.

[0053] d) The three DNA fragments above are fused to construct the core element P43-pheS by overlap extension PCR technology * -aac(3)IV(PA) gene expression cassette.

[0054] The three DNA fragments above are fused to construct the core element P43-pheS by overlap extension PCR technology 43 Promoter, pheS * Gene and aac(3)IV gene) as templates, P 43 -F / aac(3)IV-R as upstream and downstream primers, and a PA gene expression cassette with a length of 2.15 kb is amplified (see electrophoresis gel map in Figure 3 ), and the reaction conditions are as follows: pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 20 s, annealing at 60℃ for 20 s, extension at 72℃ for 2 min, 35 cycles; and extension at 72℃ for 10 min.

[0055] 3. Construction of target fragment LF-DR-PA-RF (LDPR): The positions and assembly sequence of the four DNA fragments LF, DR, PA and RF are shown in Figure 4 The target fragment constructed in the present application is named LDPR01, taking the deletion of the genes tycA-C, which are non-ribosomal peptide synthase (NRPSs) encoding genes in a tyrocidine biosynthesis gene cluster with a length of about 34 kb on the X23 genome as an example.

[0056] a) The LF01 fragment of the 600-2000 bp region (Left flanking) left to the gene to be deleted is amplified by PCR technology, and a homologous arm required for recombination with the pBE194 vector skeleton is introduced through an upstream primer.

[0057] Primer sequence used for PCR amplification of LF01:

[0058] LF01-F: ggcacacgaaaaacaagttaagggatgcagtttatgcatcccttaacatcggattggatggcttatgg (SEQ ID No: 9);

[0059] LF01-R: aatcatcacaaagccgcgaccgtgtcccctccgataattggc (SEQ ID No: 10).

[0060] The X23 genomic DNA is used as a template, and LF01-F / LF01-R is used as primers, and a LF01 fragment with a length of 0.94 kb is amplified (see electrophoresis gel map in Figure 5 A), and the reaction conditions are as follows: pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 20 s, annealing at 58℃ for 20 s, extension at 72℃ for 1 min, 35 cycles; and extension at 72℃ for 10 min.

[0061] b) Using PCR technology to amplify the region of 500-1200bp downstream of the gene to be deleted as a DR01 fragment of direct repeat.

[0062] Primer sequences used for PCR amplification of DR01:

[0063] DR01-F: gccaattatcggaggggacacggtcgcggctttgtgatgatt (SEQ ID No: 11);

[0064] DR01-R: aacataccacctatcaggatccaacagtccaagagctcccac (SEQ ID No: 12).

[0065] Using X23 genomic DNA as the template and DR01-F / DR01-R as the primers, a DR01 fragment of 0.61 kb in length was amplified (the electrophoresis gel map is shown in Figure 5 the middle A), and the reaction conditions were as follows: 95°C pre-denaturation for 5 min; 95°C denaturation for 20 s, 58°C annealing for 20 s, 72°C extension for 30 s, 35 cycles; 72°C extension for 10 min.

[0066] c) Using PCR technology to amplify a PA gene expression cassette PA01 fragment carrying homologous arms at both ends.

[0067] Primer sequences used for PCR amplification of PA01:

[0068] PA01-F: gtgggagctcttggactgttggatcctgataggtggtatgtt (SEQ ID No: 13);

[0069] PA01-R: attggtatgatttcccaacattcagccaatcgactggcgagc (SEQ ID No: 14).

[0070] Using the PA gene expression cassette constructed in the aforementioned step 2 as the template and PA01-F / PA01-R as the primers, a PA01 fragment of 2.19 kb in length was amplified (the electrophoresis gel map is shown in Figure 5 the middle A), and the reaction conditions were as follows: 95°C pre-denaturation for 5 min; 95°C denaturation for 20 s, 58°C annealing for 20 s, 72°C extension for 2 min, 35 cycles; 72°C extension for 10 min.

[0071] d) Amplifying the RF01 fragment of 600-1000 bp region (Right flanking) adjacent to the right side of the LF01 fragment and between the gene to be deleted by PCR technique, and introducing the homologous arm required for recombination with the pBE194 vector backbone by a downstream primer.

[0072] The primer sequence used for PCR amplification of RF01 is as follows:

[0073] RF01-F: gctcgccagtcgattggctgaatgttgggaaatcataccaat (SEQ ID No: 15);

[0074] RF01-R: TGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGCTG gctgaacctgccgtaatcatg (SEQ ID No: 16).

[0075] The RF01 fragment of 0.96 kb in length was amplified with X23 genomic DNA as the template and RF01-F / RF01-R as the primers (the electrophoresis gel map is shown in Figure 5 A), and the reaction conditions were as follows: pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 20 s, annealing at 58 °C for 20 s, extension at 72 °C for 1 min, 35 cycles; extension at 72 °C for 10 min.

[0076] e) Constructing LF01-DR01-PA01-RF01 (LDPR01) by sequentially fusing the above four DNA fragments using overlap extension PCR technique.

[0077] The LDPR01 fragment of 4.57 kb in length was amplified with the above four DNA fragments (LF01, DR01, PA01 and RF01) recovered from the gel as the template and LF01-F / RF01-R as the primers (the electrophoresis gel map is shown in Figure 5 B), and the reaction conditions were as follows: pre-denaturation at 95 °C for 5 min; denaturation at 95 °C for 20 s, annealing at 58 °C for 20 s, extension at 72 °C for 4 min 30 s, 35 cycles; extension at 72 °C for 10 min.

[0078] 4. Construction of scarless editing plasmid pBE194-LDPR01 (the schematic diagram is shown in Figure 4 ).

[0079] a) Linearizing Br. brevis-E. coli shuttle vector pBE194 backbone: linearizing the plasmid pBE194-P 43(pBR322-ErmB-ori194-Apra, abbreviated as pBE194, Microbial Biotechnology, 2022, 15(2), 577-589)) or by double enzyme digestion of plasmid pBE194-P 43 The 4.8 kb fragment was recovered, which was the pBE194 vector skeleton (see electrophoresis gel Figure 5 B).

[0080] b) Recombinant ligation of target fragment LDPR01 and pBE194 vector skeleton: LDPR01 and pBE194 were mixed at a molar ratio of 1:1-10:1, and then appropriate T4 DNA polymerase and corresponding buffer were added. The above components were gently mixed and then ligated in vitro. The reaction conditions were as follows: 30°C for 20 min, 75°C for 20 min, and 50°C for 30 min.

[0081] c) Desalting treatment of the ligation product: cellulose microporous filter membrane was placed in a sterile culture dish containing sterile water, and the ligation product was gently transferred to the membrane. After 15-30 min of room temperature standing, it was suctioned into a new EP tube.

[0082] d) Electrotransformation of the desalted ligation product into E. coli GBDir: the above desalted ligation product was electrotransformed into E. coli GBDir, and apramycin (Apr) with a concentration of 10-30 μg / mL was used for resistance screening. After plasmid extraction from the transformants, BamHI / SpeI double enzyme digestion was used for identification. The enzyme digestion identification gel map is shown in Figure 5 B, and the correct plasmid was named pBE194-LDPR01.

[0083] 5. Br. brevis X23 strain tolerance test to the counter-screening agent p-chlorophenylalanine (p-Cl-Phe) (results shown in Figure 6 ).

[0084] a) Activated Br. brevis X23 strain single colonies were picked and inoculated into LB culture solution and incubated at 30-37°C constant temperature shaker for 12-16 h. The bacterial solution concentration was first determined, and then the LB culture solution was diluted to OD 600 = 1.0, and then diluted by 10 times to 10 -4 .

[0085] b) Take 100 μL of the above diluted bacteria solution and spread it on LB solid medium containing different concentrations (0.5-5 mM) of counter-screening agent p-Cl-Phe. After uniform spreading, place the medium in a 30-37°C incubator for 16-24 h. Observe the growth state and number of X23 colonies and determine the appropriate concentration range of p-Cl-Phe for screening, which is between 1-2.5 mM.

[0086] 6. The scarless editing strain X23Δtyc is obtained by screening.

[0087] a) Electroporate the editing plasmid pBE194-LDPR01 into the X23 strain and screen using LB resistance plates containing 10-30 μg / mL Apr. Incubate in a 30-37°C incubator for 16-24 h. Pick the transformants and culture them in LB medium containing 10-30 μg / mL Apr at 30-37°C for 12-20 h. Then perform bacterial liquid PCR verification using primers designed on both sides of the aac(3) IV gene. The correct verification result indicates that the target strain X23::pBE194-LDPR01 has been integrated into the chromosome.

[0088] The primers used for PCR verification of whether the plasmid pBE194-LDPR01 has been transferred into the X23 strain are the same as those used for amplifying the aac(3) IV gene: aac(3) IV-F / aac(3) IV-R.

[0089] Using the transformant liquid obtained after Apr resistance screening as the template and aac(3) IV-F / aac(3) IV-R as the primers, a 0.81 kb aac(3) IV gene fragment is amplified (see electrophoresis gel in Figure 7 The reaction conditions are as follows: 95°C pre-denaturation for 5 min; 95°C denaturation for 20 s, 58°C annealing for 20 s, 72°C extension for 1 min, 35 cycles; and 72°C extension for 10 min.

[0090] Colony PCR verification of 12 randomly picked transformants from the Apr resistance screening plate showed that all 12 were strongly positive, indicating that the editing plasmid pBE194-LDPR01 was successfully electroporated into the X23 strain with a transformation efficiency of 100%.

[0091] b) Randomly pick several from the transitional strain bacterial liquid, and transfer a micro-volume of the bacterial liquid to fresh LB culture solution without antibiotics, incubate in a 30-37°C incubator for 12-20 hours, then gently dip a loop in the overnight bacterial liquid, streak on LB solid culture medium containing appropriate p-Cl-Phe, incubate in a 30-37°C incubator for 16-24 hours, randomly pick several single bacterial colonies to LB culture solution without antibiotics, incubate in a 30-37°C constant-temperature shaker for 12-20 hours, then perform bacterial liquid PCR verification, and send the bacterial liquid to a professional company for sequencing, the sequencing primers are designed on both sides of the region outside the target gene to be deleted, and the final strain X23Δtyc is obtained after the PCR verification and sequencing results are correct, and the plasmid sequence is eliminated.

[0092] The primers used for PCR verification of whether the vector sequence is eliminated are the same as those used for amplifying the aac(3) IV gene: aac(3) IV-F / aac(3) IV-R.

[0093] The transformant bacterial liquid obtained after p-Cl-Phe reverse screening is used as a template, and aac(3) IV-F / aac(3) IV-R is used as primers to amplify a 0.81 kb aac(3) IV gene fragment (see electrophoresis gel map in Figure 7 The reaction conditions are as follows: 95°C pre-denaturation for 5 min; 95°C denaturation for 20 s, 58°C annealing for 20 s, 72°C extension for 1 min, 35 cycles; and 72°C extension for 10 min.

[0094] Colony PCR verification results of 12 transformants randomly picked from the p-Cl-Phe reverse screening plate show that the aac(3) IV gene of 11 transformants has been eliminated, and the reverse screening efficiency is 91.67%.

[0095] Two of the 11 positive transformants obtained above are randomly picked and sent to Beijing Qianke Biological Company: their genomic DNA is first extracted, then PCR verification is performed to determine whether the target is deleted, and the deleted gene interval is sequenced, and the results are correct. Finally, the scarless editing strain X23Δtyc is obtained.

[0096] The primers used for PCR verification of whether the target gene is deleted and sequencing of the deleted gene interval are as follows:

[0097] Ve01-F: gtgtgcaggccagcacattag (SEQ ID No: 17); Ve01-R: cgagatcgccggaatgatatt (SEQ ID No: 18).

[0098] The genomic DNA of the transformed cell extracted by Beijing Qianke Biological Company was used as a template, and Ve01-F / Ve01-R was used as a primer to amplify a 0.56 kb length of the deleted gene interval fragment (see the electrophoresis gel map Figure 7 The reaction conditions were as follows: 95 °C pre-denaturation for 5 min; 95 °C denaturation for 20 s, 58 °C annealing for 20 s, 72 °C extension for 30 s, 35 cycles; and 72 °C extension for 10 min.

[0099] The sequencing result map (containing the sequence) of the amplified PCR product of the deleted gene interval is shown in detail in Figure 8 For the operation of multiple rounds of genome editing, the final traceless edited strain obtained by using the screening method has no residual one base, which is convenient, efficient and safe.

Claims

1. A soil-borne biocontrol bacterium Brevibacillus brevis based on genome scarless editing method with pheS * gene as a counter- selection marker, characterized in that, The method comprises the following steps: S1 constructs P 43 promoter, pheS * gene carrying mutation site and forward screening marker gene, and the PA gene expression cassette with ribosome binding site SD sequence as the core element between the P43 promoter, pheS * gene carrying mutation site and forward screening marker gene; the pheS * gene refers to the protein encoding A309G relative to the PheS protein in Br. brevis X23 strain; S2, using overlap extension PCR technology to construct a target DNA fragment containing a PA gene expression cassette and a homologous arm related to the gene to be deleted, referred to as an LDPR fragment, and the assembly sequence is as follows: an LF01 fragment of a 600-2000 bp region on the left side of the gene to be deleted, a DR01 fragment of a 500-1200 bp region downstream of the gene to be deleted as a forward repeat sequence, a PA expression cassette fragment, and an RF01 fragment of a 600-1000 bp region between the gene to be deleted and the right side of the LF01 fragment; S3, using homologous recombination technology to fuse the LDPR fragment and a backbone fragment of a Br. brevis-E. coli shuttle vector pBE194 to obtain a scarless editing plasmid pBE194-LDPR of the gene to be deleted; wherein the backbone fragment of the Br. brevis-E. coli shuttle vector pBE194 is a 4.8 kb vector backbone fragment recovered by double digestion of the shuttle vector pBE194 with BamHI / SpeI or EcoRV / SmaI; S4, electrically transforming the editing plasmid pBE194-LDPR into B. brevis, and first obtaining a transition strain integrated into a target region on a chromosome through resistance screening, and then obtaining a target strain in which the target gene region on the chromosome is deleted and the plasmid sequence is eliminated through reverse screening with a reagent p-Cl-Phe, thereby realizing a truly complete scarless editing on the X23 genome.

2. The scarless editing method of claim 1, wherein, The forward screening marker gene is an apramycin resistance gene.

3. The scarless editing method of claim 1, wherein, The strain is B. brevis X23 strain.

4. The scarless editing method of claim 1, wherein, The step S1 specifically comprises: fusing pheS * gene after a strong promoter, and fusing a positive screening marker gene after pheS 43 gene, to construct a PA gene expression cassette. * gene after a strong promoter, and fusing a positive screening marker gene after pheS 43 gene, to construct a PA gene expression cassette. * gene after a strong promoter, and fusing a positive screening marker gene after pheS * gene, to construct a PA gene expression cassette.

5. The scarless editing method of claim 1, wherein, The step S2 specifically comprises: taking a 600-2000 bp region on the left side of the gene to be deleted as an LF fragment, taking a 500-1200 bp region downstream of the gene to be deleted as a DR fragment as a forward repeat sequence, taking a PA gene expression cassette as a PA fragment, and taking a 600-1000 bp region between the LF fragment and the gene to be deleted on the right side as an RF fragment, and the fusion sequence of the above four fragments is LF-DR-PA-RF, referred to as an LDPR fragment.

6. The scarless editing method of claim 1, wherein, The step S3 specifically comprises: recovering a 4.8 kb DNA fragment as a vector backbone after double digestion of the shuttle plasmid pBE194 with BamHI / SpeI or EcoRV / SmaI, and fusing the LDPR fragment obtained in the previous step to construct a scarless editing plasmid pBE194-LDPR of the gene to be deleted.

7. The scarless editing method of claim 1, wherein, The concentration of the reagent p-Cl-Phe is determined as follows: first, the concentration of the B. brevis bacterial solution is determined and diluted to OD 600 =1.0 with LB culture solution, then diluted by 10 times in ratio to 10 -4 , and the diluted solution is coated on LB solid medium containing different concentrations of the reagent p-Cl-Phe in the range of 0.5-5 mM, and then placed in an incubator at 30-37°C for 16-24 h. The growth state and number of X23 colonies are observed to determine the appropriate concentration of p-Cl-Phe for screening.

8. The scarless editing method of claim 1, wherein, The resistance screening step in step S4 specifically includes: electrically transforming the editing plasmid pBE194-LDPR into B. brevis, screening with LB resistance plates containing appropriate concentration of Apr, incubating in a 30-37°C incubator for 16-24h, picking the transformants into LB culture solution containing appropriate concentration of Apr and incubating in a 30-37°C constant temperature shaker for 12-20h, then performing bacterial liquid PCR verification, randomly selecting several correct transformant liquids, which are transitional strains integrated into the target region on the chromosome, and aspirating a small volume from the transitional strains into fresh LB culture solution without resistance, incubating in a 30-37°C incubator for 12-20h, then using a loop to streak inoculate on LB solid medium containing appropriate p-Cl-Phe concentration, incubating in a 30-37°C incubator for 16-24h, randomly picking several single bacteria to LB culture solution without resistance and incubating in a 30-37°C constant temperature shaker for 12-20h, then performing bacterial liquid PCR verification, optionally sequencing the bacterial liquid, and the final strain in which the target gene region on the chromosome is deleted and the plasmid sequence is eliminated is correct.

9. Application of the scarless editing method according to any one of claims 1 to 8 in gene editing of B. brevis.

10. The application according to claim 9, wherein the target gene for gene editing is any non-essential gene region on the chromosome of B. brevis, and the gene editing is gene deletion, insertion or site-directed mutation.

Citation Information

Patent Citations

  • Manufacturing method of flash memory device

    CN1505134A

  • Brevibacillus brevis gene recombinant strain and preparation method and application thereof

    CN111139207A

  • Reverse selection marker of streptococcus suis, streptococcus suis containing reverse selection marker and application of streptococcus suis

    CN115161333A