Freeze-dried PCR (Polymerase Chain Reaction) reagent for dengue virus typing detection and preparation method of freeze-dried PCR reagent

Abstract

The invention relates to the technical field of biological detection, and discloses a freeze-dried PCR reagent for dengue virus typing detection and a preparation method thereof.The freeze-dried PCR reagent comprises reaction freeze-dried powder, an internal standard, a positive control and a negative control, the reaction freeze-dried powder comprises an optimized buffer system, Taq DNA polymerase and reverse transcriptase, and the internal standard is a positive standard. A section of artificially synthesized pseudovirus is used as an internal standard in a PCR amplification system, the pseudovirus and a sample are added into an extraction reagent together to participate in extraction and monitor nucleic acid extraction and PCR amplification processes, false negative caused by PCR interfering substances possibly existing in the sample is prevented, mutant reverse transcriptase is adopted, the enzyme has high enzyme activity at 50-60 DEG C, and the detection sensitivity is high. Reverse transcription can be completed within an extremely short time, meanwhile, mutant antibody modified Taq DNA polymerase can quickly release enzyme activity at 95 DEG C, and by adding a short amplicon, the detection time can be greatly shortened, and detection can be completed within about 30 min.

Description

Technical Field

[0001] The invention relates to the technical field of biological detection, in particular to a freeze-dried PCR reagent for dengue virus typing detection and a preparation method thereof. Background Art

[0002] Dengue virus belongs to the genus Flavivirus of the family Flaviviridae. Its RNA is about 11kb long and can be divided into four serotypes according to different antigenicity: DEN-1, DEN-2, DEN-3 and DEN-4. All four serotypes of dengue virus can cause a wide range of clinical diseases, from common dengue fever to fatal dengue shock syndrome. At present, it is believed that some serotypes of dengue virus are more virulent than other types, more likely to infect cells and cause more serious diseases. Clinical epidemiological observations have also found that DEN-2 and DEN-3 are more likely to cause severe diseases than DEN-1 and DEN-4. In addition, the type-specific antibodies produced by the first infection not only have no cross-immune protection against other types of dengue virus, but may even enhance viral infection during secondary infection with heterotypic viruses, leading to more severe dengue hemorrhagic fever (DHF) and dengue shock syndrome (DSS). Large-scale dengue virus outbreaks have occurred many times in various countries around the world; according to relevant statistics in 2023 alone, Bangladesh has accumulated more than 300,000 cases of dengue fever; Vietnam has confirmed nearly 150,000 cases; China has nearly 20,000 cases. There is still no vaccine that is completely effective in preventing dengue fever infection, and the disease is characterized by rapid transmission and easy epidemic. Once it occurs, it will seriously threaten people's health and social stability. Therefore, it is of great significance to implement rapid detection of dengue virus typing in the early stage of the disease for early warning and judgment of severe cases, improve the level of clinical treatment, and reduce the mortality rate of severe dengue fever.

[0003] At present, the traditional detection of dengue virus infection is mainly based on serology and culture methods. This method has low sensitivity and long immune cross-reaction cycle, and is not suitable for large-scale clinical application. The multiplex fluorescence RT-PCR method uses the conservative sequences of dengue virus of different serotypes as the detection target, and conducts in vitro qualitative detection of dengue virus nucleic acid from human samples. It can accurately, sensitively and quickly identify dengue virus serotypes. This method is simple to operate and only requires further experiments to obtain results. It is simple, fast and accurate. It can detect patients in the window period or with low viral load and detect infected people early. It is relatively suitable for large-scale promotion and application in clinical practice, and is of great significance for auxiliary diagnosis and large-scale population screening.

[0004] There is currently a multiplex fluorescent RT-PCR method for dengue virus typing detection. For example, Chinese patent application CN104630388 discloses a dengue virus rapid typing and identification detection kit, CN105441588 discloses a dengue fever type I, II, III, IV RT-PCR one-step MIX detection kit and a detection method thereof, and CN113430304 discloses multiplex real-time fluorescent quantitative PCR primers, probes, kits and methods for using the kits for dengue virus typing detection. All of them use multiplex fluorescent RT-PCR for dengue virus typing detection, but all of them have no internal standard, cannot monitor the entire process of nucleic acid extraction and amplification, and are difficult to distinguish between false positive and false negative results; and the above methods have a long detection time, which is not conducive to quickly obtaining test results and delays diagnosis and treatment time. In addition, although the patent application CN113430304 uses DENV-Type amplification reaction solution (lyophilized powder), it still needs to be reconstituted and then packaged for use, which is cumbersome; and most methods use liquid reagents, which contain temperature-sensitive Taq enzymes, primers, probes and other components, and need to be transported and stored at low temperatures to avoid changes in their properties and failure. The configuration is cumbersome during use, and the cost of product storage and transportation is high. For this reason, we propose a lyophilized PCR reagent for dengue virus typing detection and a preparation method thereof. Summary of the invention

[0005] The purpose of the present invention is to provide a freeze-dried PCR reagent for dengue virus typing detection and a preparation method thereof, which solves the problems raised in the above-mentioned background technology.

[0006] To achieve the above object, the present invention provides the following technical solution: a freeze-dried PCR reagent for dengue virus typing detection, comprising a reaction freeze-dried powder, an internal standard, a positive control and a negative control, wherein the reaction freeze-dried powder comprises an optimized buffer system, Taq DNA polymerase, a reverse transcriptase, a dNTP Mix, a freeze-dried protective agent and specific primers and probes;

[0007] The specific primers include a universal oligonucleotide upstream primer for specific amplification of dengue virus, a universal oligonucleotide downstream primer, an oligonucleotide upstream primer for specific amplification of an internal standard, and an oligonucleotide downstream primer;

[0008] The probes include dengue virus type I detection oligonucleotide fluorescent probe, dengue virus type II detection oligonucleotide fluorescent probe, dengue virus type III detection oligonucleotide fluorescent probe, dengue virus type IV detection oligonucleotide fluorescent probe and internal standard detection oligonucleotide fluorescent probe;

[0009] The serial number of the universal oligonucleotide upstream primer is SEQ ID NO: 1, the serial numbers of the universal oligonucleotide downstream primer are SEQ ID NO: 2 and SEQ ID NO: 3, the serial number of the oligonucleotide upstream primer for specific amplification of the internal standard is SEQ ID NO: 8, and the serial number of the oligonucleotide downstream primer for specific amplification of the internal standard is SEQ ID NO: 9;

[0010] The serial number of the dengue virus type I detection oligonucleotide fluorescent probe is SEQ ID NO: 4, the serial number of the dengue virus type II detection oligonucleotide fluorescent probe is SEQ ID NO: 5, the serial number of the dengue virus type III detection oligonucleotide fluorescent probe is SEQ ID NO: 6, the serial number of the dengue virus type IV detection oligonucleotide fluorescent probe is SEQ ID NO: 7, and the serial number of the internal standard detection oligonucleotide fluorescent probe is SEQ ID NO: 10.

[0011] Preferably, the two ends of the oligonucleotide fluorescent probe are respectively labeled with a fluorescent group and a quenching group, the fluorescent group is a fluorescent group with luminescent properties selected from FAM, VIC, TET, CY3, CY5, and ROX, and the quenching group is a chemical group with fluorescence quenching function selected from BHQ1, BHQ2, BHQ3, TAMRA, and MGB, and each tube of the reaction lyophilized powder comprises: 0.1 μM to 1 μM oligonucleotide upstream primer, 0.1 μM to 1 μM oligonucleotide downstream primer, 0.1 μM to 1 μM oligonucleotide fluorescent probe, 0.1 to 1 unit Taq DNA polymerase, 0.1 to 1 unit reverse transcriptase, a freeze-dried protective agent with a m / v of 1% to 10%, 0.1 to 1 mM dNTP Mix, and an optimized 1 to 10× buffer system.

[0012] Preferably, the Taq DNA polymerase is a mutant Taq DNA polymerase, and the reverse transcriptase is a mutant reverse transcriptase.

[0013] Preferably, the lyoprotectant is a mixture of one or more of pullulan, glycine, HPMC-E5, trehalose, PEG-20000, β-cyclodextrin, sucrose, maltodextrin, gelatin, CMC-Na (50-200cps), PVP-10000, etc., the lyoprotectant is 1% to 10% trehalose, 1% to 10% β-cyclodextrin, 1% to 10% maltodextrin, 1% to 10% sucrose, and the lyoprotectant is 3% trehalose, 3% β-cyclodextrin, 3% maltodextrin, and 3% sucrose.

[0014] Preferably, the reaction lyophilized powder is prepared by the following process:

[0015] The components were mixed evenly according to the proportion to prepare a reaction lyophilized powder mixture with a volume of 25 μL;

[0016] Prepare the required volume of mixed solution 25 μL×N according to the needs, mix evenly and dispense into 8 strips of PCR tubes, and put them into the freeze dryer without covering to prepare the reaction freeze-dried powder;

[0017] After lyophilization, cover the PCR tube cap and seal it in an aluminum foil bag (with desiccant inside) by vacuum pumping to obtain the reaction lyophilized powder.

[0018] Preferably, the internal standard is a synthetic pseudovirus, and the specific sequence is SEQ ID NO: 11.

[0019] Preferably, the main components and concentrations of the positive control are as follows:

[0020] Pseudovirus containing dengue virus serotype 1 gene-specific fragment, 10 5 copies / mL;

[0021] Pseudovirus containing dengue virus serotype II gene-specific fragment, 10 5 copies / mL;

[0022] Pseudovirus containing dengue virus serotype III gene-specific fragment, 10 5 copies / mL;

[0023] Pseudovirus containing dengue virus serotype IV gene-specific fragment, 10 5 copies / mL;

[0024] The negative control was RNase-Free Water.

[0025] The method for preparing a freeze-dried PCR reagent for dengue virus typing detection comprises the following steps:

[0026] S1. First, a mutant reverse transcriptase is used. This enzyme has a high enzyme activity at 55°C and can complete reverse transcription in a very short time. At the same time, the mutant antibody-modified Taq DNA polymerase can quickly release enzyme activity at 95°C. Combined with a shorter amplicon, the detection time can be greatly shortened, and the detection can be completed in about 30 minutes.

[0027] S2. Then, oligonucleotide primers and probes, Taq DNA polymerase, reverse transcriptase, dNTP, optimized buffer system, lyophilization protective agent, etc. are made into components that can coexist stably at room temperature, and the detection performance is consistent with that of liquid reagents, and can be transported at room temperature;

[0028] S3. Finally, a synthetic pseudovirus is used as an internal control in the PCR amplification system. It is added to the extraction reagent together with the sample to participate in nucleic acid extraction, monitor the nucleic acid extraction and PCR amplification process, and prevent false negatives caused by PCR interfering substances in the sample.

[0029] The preparation method of the freeze-dried PCR reagent for dengue virus typing detection also includes fluorescence quantitative PCR detection, and the fluorescence quantitative PCR detection includes the following steps:

[0030] Reverse transcription was performed at 55°C for 30 s, pre-denaturation was performed at 95°C for 10 s, pre-amplification was performed for 12 cycles, denaturation was performed at 95°C for 1 s, annealing and extension was performed at 56°C for 3 s, amplification was performed for 30 cycles, denaturation was performed at 95°C for 1 s, annealing and extension were performed at 56°C for 13 s, DEN-1 was detected in the FAM channel, DEN-2 was detected in the TET channel, DEN-3 was detected in the ROX channel, DEN-4 was detected in the CY5 channel, and the internal standard was detected in the CY3 channel.

[0031] The present invention provides a freeze-dried PCR reagent for dengue virus typing detection and a preparation method thereof. The freeze-dried PCR reagent for dengue virus typing detection and a preparation method thereof have the following beneficial effects:

[0032] (1) The present invention uses a synthetic pseudovirus as an internal standard in the PCR amplification system, which is added to the extraction reagent together with the sample to participate in the extraction, monitor the nucleic acid extraction and PCR amplification process, and prevent false negatives caused by PCR interfering substances that may exist in the sample;

[0033] (2) The present invention uses a mutant reverse transcriptase, which has a high enzyme activity at 50°C to 60°C and can complete reverse transcription in a very short time. At the same time, the mutant antibody-modified Taq DNA polymerase can quickly release enzyme activity at 95°C, and with a shorter amplicon, the detection time can be greatly shortened, and the detection can be completed in about 30 minutes.

[0034] (3) The reaction lyophilized powder prepared by the present invention is a component that can stably coexist at room temperature by making oligonucleotide primers and probes, Taq DNA polymerase, reverse transcriptase, dNTP, optimized buffer system, lyophilization protective agent, etc., and the detection performance is consistent with that of liquid reagents, and can be transported and stored at room temperature. The transportation and storage costs of fluorescent PCR reagents are greatly reduced, the shelf life is extended, the use operation steps are reduced, the clinical detection process is simplified, and it is more convenient for practical use and promotion. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is an example diagram of the reaction freeze-dried powder in the present invention;

[0036] Figure 2This is an example diagram comparing the detection performance of the freeze-dried PCR reagent and the liquid PCR reagent in the present invention;

[0037] Figure 3 This is an example diagram of the clinical sample test results in the present invention;

[0038] Figure 4 This is an example diagram of the stability test results of the kit in the present invention. DETAILED DESCRIPTION

[0039] In order to have a clearer understanding of the technical features, purposes and effects of the present invention, specific embodiments of the present invention are now described with reference to the accompanying drawings.

[0040] The primers, probes and pseudoviruses in the examples of the present invention were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The remaining components in the kit were all commercially available products from Jiangsu Kangwei Century Biotechnology Co., Ltd. and may also be replaced by other similar commercially available products.

[0041] Example 1

[0042] Design of primers and probes for target and internal standard

[0043] The gene sequences of each serotype of dengue virus were searched on NCBI (National Center of Biotechnology Information). According to the primer and probe design principles, specific primer and probe sequences were designed. The sequences are shown in the table below.

[0044] name Serial number Sequence 5′-3′ 5′ fluorescent group 3′ fluorescent group <![CDATA[ DNE-F ]]> SEQ ID NO: 1 AATATGCTGAAACGCGAGAGA / / DNE-R1 SEQ ID NO: 2 TCCKTTTGAGAATCTCTTCRCCA / / DNE-R2 SEQ ID NO: 3 TCCAAGTGAGAATCTCTTTGTCA / / DNE-P1 SEQ ID NO: 4 AACCGCGTGTCAACTGTTTCACAGT FAM BHQ1 DNE-P2 SEQ ID NO: 5 AACCGCGTGTCGACTGTGCAACAGC TET BHQ1 DNE-P3 SEQ ID NO: 6 AACCGTGTGTCAACTGGATCACAGT ROX BHQ2 DNE-P4 SEQ ID NO: 7 AACCGCGTATCAACCCCTCAAGGGT CY5 BHQ3

[0045] The present invention uses a synthetic pseudovirus as an internal control sequence, which has no homology with the target and the host. The specific sequence is shown in SEQ ID NO: 11. The primers and probes for internal standard detection are shown in the table below.

[0046] name Serial number Sequence 5′-3′ 5′ fluorescent group 3′ fluorescent group <![CDATA[ IC-F ]]> SEQ ID NO: 8 GTTGGGTCACACCAGATTTTG / / <![CDATA[ IC-R ]]> SEQ ID NO: 9 GCTCCTTGCAAGAACACTTCA / / <![CDATA[ IC-P ]]> SEQ ID N3:10 CTCTATGCAGCATTTGATCCACTTGCA CY3 BHQ2

[0047] Internal control sequence SEQ ID NO: 11:

[0048] TCTCACCCCCAGTAACTAGTCACAGACAACAGAAAAGTCTATATCGAGCATACCAGAAACTTTATGCTTCAATGCATGTAAAAGGATTGGGACCCCACAAGACTCAATATAGAAGAGATGAAAACTACACTCTTCTATGTTGGGTCACACCAGATTTTGAACTCTATGCAGCATTT GATCCACTTGCAGACAAGGCGATGGCGATAAAGATATGCAATCAGGTGTGCCAAAGGGTAAAAGATGTGGAGAATGAAGTGTTCTTGCAAGGAGCTAGTCCTTTCTCTTGGTGATAATATTTTACTATTCACTCTTTAATATATATGTATTTTTTTTTAATCTTTCTACTGGTTTGA

[0049] The above primers, probes, and pseudoviruses were synthesized by Sangon Biotech (Shanghai) Co., Ltd. After the sequence was synthesized, it was quality checked and quantified, and then diluted to the required concentration as needed.

[0050] Example 2

[0051] Preparation of freeze-dried PCR reagents and kits for dengue virus typing detection

[0052] (1) Reaction freeze-dried powder

[0053] Prepare freeze-dried protective agent mother solution (30%): 30% (m / v) (trehalose + β-cyclodextrin + maltodextrin + sucrose). Wherein, m / v refers to mass concentration, which means the mass per unit volume, and the unit is "kg / L" or "kg / m3".

[0054] The reaction lyophilized powder was prepared as follows:

[0055] Components <![CDATA[Dosage for one person ( μL )]]> Final concentration DEN-F (100 μM) 0.125 0.5μM DEN-R1 (100 μM) 0.125 0.5μM DEN-R2 (100 μM) 0.125 0.5μM DEN-P1 (100 μM) 0.05 0.2μM DEN-P2 (100 μM) 0.05 0.2μM DEN-P3 (100 μM) 0.05 0.2μM DEN-P4 (100 μM) 0.05 0.2μM <![CDATA[ IC-F (100μM)]]> 0.125 0.5μM <![CDATA[ IC-R (100μM)]]> 0.125 0.5μM <![CDATA[ IC-P (100μM)]]> 0.05 0.2μM Lyophilized Protectant Stock Solution (30%) 2.5 3％ <![CDATA[ Taq DNA polymerase (5 units)]]> 3 0.6 units Reverse transcriptase (200 units) 0.05 0.4 units <![CDATA[ dNTP (10mM)]]> 1.5 0.6mM Optimized 5× buffer system 5 1× <![CDATA[ RNase-Free Water]]> 12.075 / Total 25 /

[0056] After mixing the above components evenly, a reaction freeze-dried powder mixture with a volume of 25 μL is prepared. The required volume of the mixture (25 μL×N) is prepared according to the needs, mixed evenly and dispensed into 8 strips of PCR tubes, and placed in a freeze dryer without covering to prepare the reaction freeze-dried powder, according to the following procedures: 0℃, 30min; -45℃, 4h; -40℃, 14bar, 3h; -20℃, 14bar, 3h; 0℃, 14bar, 2h; 10℃, 14bar, 3h; 30℃, 14bar, 4h. After the freeze-drying is completed, the PCR tube cap is covered and vacuum-sealed with an aluminum foil bag (with a desiccant inside) to obtain the reaction freeze-dried powder.

[0057] (2) Internal standard: a synthetic pseudovirus, Tris buffer, EDTA, Triton X-100, gelatin, pseudovirus concentration of 10 6 copies / mL, and the sequence is shown in SEQ ID NO: 11.

[0058] (3) Positive control: pseudovirus containing dengue virus type I serotype gene-specific fragment, pseudovirus containing dengue virus type II serotype gene-specific fragment, pseudovirus containing dengue virus type III serotype gene-specific fragment, pseudovirus containing dengue virus type IV serotype gene-specific fragment, Tris buffer, EDTA, Triton X-100, gelatin, pseudovirus concentration of 10 5 copies / mL.

[0059] (4) Negative control: RNase-Free Water.

[0060] The components of the kit (48 servings / box) are as follows:

[0061]

[0062] Example 3

[0063] Testing process of freeze-dried PCR reagents for dengue virus typing detection

[0064] 1) Sample type: serum, plasma samples

[0065] 2) Sample processing: Take 200 μL of the sample to be tested, the positive control and the negative control, and add 5 μL of internal standard to each processed sample (Note: no internal standard is added to the negative control). It is recommended to use the free RNA (serum plasma urine) extraction reagent (Cat. No.: CW2281S) produced by Jiangsu Kangwei Century Biotechnology Co., Ltd. and perform nucleic acid extraction according to its instructions.

[0066] 3) Sample addition: ① Preparation of reaction solution: Calculate the required number of reactions according to the number of samples to be tested. If the number of samples is n, the total number of reactions N = n + 2. Take N tubes of reaction lyophilized powder, centrifuge for 30 seconds to ensure that the reaction lyophilized powder is at the bottom of the tube, and set aside.

[0067] ② Sample addition: Gently open the cap of the eight-tube containing the lyophilized powder, transfer 25 μL of the extracted sample, positive control and negative control nucleic acid into the eight-tube, and close the cap tightly.

[0068] ③ Vortex for 30 seconds until completely dissolved and the solution is clear with no white lyophilized residue remaining, remove bubbles and centrifuge for 30 seconds for later use.

[0069] 4) PCR amplification: The present invention uses Applied Biosystems QuantStudio TM 5 Real-time fluorescence quantitative PCR detection, in Fast mode, reverse transcription at 55°C for 30 s, pre-denaturation at 95°C for 10 s, pre-amplification for 12 cycles (95°C denaturation for 1 s, 56°C annealing and extension for 3 s), amplification for 30 cycles (95°C denaturation for 1 s, 56°C annealing and extension and fluorescence collection for 13 s), DEN-1 was detected in the FAM channel, DEN-2 in the TET channel, DEN-3 in the ROX channel, DEN-4 in the CY5 channel, and the internal standard in the CY3 channel.

[0070] 5) Result analysis:

[0071] ①Quality control standards:

[0072] Positive control: The fluorescence signals of FAM, TET, ROX, CY5, and CY3 channels all increased significantly, showing a typical S-shaped curve, and the corresponding Ct value was ≤23;

[0073] Negative control: There is no obvious increase in the fluorescence signal of each channel, and there is no obvious S-shaped curve;

[0074] The above requirements must be met simultaneously in the same experiment, otherwise the experiment will be invalid and must be retested.

[0075] ②Result determination

[0076]

[0077] Note 1: For a positive target test, the internal standard test result may be positive, or the internal standard result may be negative due to high concentration target amplification.

[0078] Example 4

[0079] Comparison of performance between freeze-dried PCR reagents and liquid PCR reagents

[0080] The freeze-dried PCR reagent used in this example is the freeze-dried PCR reagent for dengue virus typing detection prepared in Example 2, and the control reagent is a liquid PCR reagent (consistent with the freeze-dried PCR reagent formula).

[0081] Freeze-dried PCR amplification system: reaction freeze-dried powder + 10μL test sample + 15μL ddH2O

[0082] Liquid PCR amplification system: Prepare the liquid PCR amplification system according to the table below, vortex to mix, and dispense 15 μL / well.

[0083] Components <![CDATA[Dosage for one person ( μL )]]> Final concentration DEN-F (100 μM) 0.125 0.5μM DEN-R1 (100 μM) 0.125 0.5μM DEN-R2 (100 μM) 0.125 0.5μM DEN-P1 (100 μM) 0.05 0.2μM DEN-P2 (100 μM) 0.05 0.2μM DEN-P3 (100 μM) 0.05 0.2μM DEN-P4 (100 μM) 0.05 0.2μM <![CDATA[ IC-F (100μM)]]> 0.125 0.5μM <![CDATA[ IC-R (100μM)]]> 0.125 0.5μM <![CDATA[ IC-P (100μM)]]> 0.05 0.2μM Lyophilized Protectant Stock Solution (30%) 2.5 3％ <![CDATA[ Taq DNA polymerase (5 units)]]> 3 0.6 units Reverse transcriptase (200 units) 0.05 0.4 units <![CDATA[ dNTP (10mM)]]> 1.5 0.6mM Optimized 5× buffer system 5 1× <![CDATA[ RNase-Free Water]]> 2.075 / Total 15 /

[0084] The templates were the positive control and negative control prepared in Example 2 and normal human plasma samples.

[0085] The detection method is the same as in Example 3. The positive control and negative control meet the quality control standards, and this detection is valid.

[0086] Reaction freeze-dried powder Figure 1 As shown, the test results are Figure 2 As shown: the prepared freeze-dried PCR reagent for dengue virus typing detection has basically the same detection performance as the liquid PCR reagent (consistent with the freeze-dried PCR reagent formula).

[0087] Example 5

[0088] Application of freeze-dried PCR reagents for dengue virus typing detection in clinical samples

[0089] The reagent used was the freeze-dried PCR reagent for dengue virus typing detection prepared in Example 2, and the samples to be tested were 10 samples clinically diagnosed as dengue virus positive and 5 samples negative in the hospital.

[0090] The detection method is the same as in Example 3. The positive control and negative control meet the quality control standards. The detection is effective. The detection results are shown in the following table: 3 samples are positive for dengue virus type I nucleic acid ( Figure 3 Example); 3 samples were positive for dengue virus type II nucleic acid ( Figure 3 Example); 2 samples were positive for dengue virus type III nucleic acid ( Figure 3 Example); 2 samples were positive for dengue virus type IV nucleic acid ( Figure 3 Example); 5 samples were negative for dengue virus nucleic acid ( Figure 3 Example); consistent with the hospital's diagnosis.

[0091]

[0092] Note: Unde Indicates Undetermined.

[0093] Example 6

[0094] Detection limit test of freeze-dried PCR reagents for dengue virus typing detection

[0095] The templates were dengue virus serotype I / II / III / IV cultures of 6 different concentrations, and 25 μL RNase-Free Water was used as a no-template control (NTC). All templates were replicated in 20 wells, and the detection method was the same as in Example 3.

[0096] The results are shown in the following table: The types of dengue virus samples were consistent with the test results, and there was no non-specific amplification and cross-detection. This shows that the probe has good specificity and there is no interference between the detection of samples of different types. The detection system has a high detection sensitivity for samples of different serotypes. The detection sensitivity of this kit for types I and III is 3TCID 50 / reaction, the detection sensitivity for type II and type IV is 1TCID 50 / reaction.

[0097] Dengue virus detection limit test results

[0098]

[0099] Example 7

[0100] Stability testing of freeze-dried PCR reagents for dengue virus typing detection

[0101] The kit used in this example is the freeze-dried PCR reagent for dengue virus nucleic acid detection prepared in Example 2. The kit was stored at room temperature for 10 months and compared with the newly prepared freeze-dried PCR reagent (preparation method is the same as in Example 2). The samples to be tested are 1 positive sample of dengue virus type I serotype, 1 positive sample of type II serotype, 1 positive sample of type III serotype, 1 positive sample of type IV serotype and 1 negative sample clinically diagnosed in the hospital, and the detection method is the same as in Example 3.

[0102] Test results such as Figure 4 As shown: the amplification performance of the freeze-dried PCR reagent stored at room temperature for 10 months is consistent with the amplification performance of the newly prepared freeze-dried PCR reagent in the control group. Therefore, the freeze-dried PCR reagent and kit for respiratory virus nucleic acid detection prepared in Example 2 can be stored at room temperature for 10 months.

[0103] The above description is only an illustrative specific implementation mode of the present invention and is not intended to limit the scope of the present invention. Any equivalent changes and modifications made by any technician in the field without departing from the concept and principle of the present invention should fall within the scope of protection of the present invention. It should also be noted that the various components of the present invention are not limited to the above-mentioned overall application. The various technical features described in the specification of the present invention can be selected one by one or multiple ones can be selected and used in combination according to actual needs. Therefore, the present invention should naturally cover other combinations and specific applications related to the invention point of this case.

Claims

1. A freeze-dried PCR reagent for dengue virus typing detection, comprising a reaction freeze-dried powder, an internal standard, a positive control and a negative control, characterized in that: The reaction lyophilized powder includes an optimized buffer system, Taq DNA polymerase, reverse transcriptase, dNTPMix, a lyophilization protectant, and specific primers and probes; The specific primers include a universal oligonucleotide upstream primer for specific amplification of dengue virus, a universal oligonucleotide downstream primer, an oligonucleotide upstream primer for specific amplification of an internal standard, and an oligonucleotide downstream primer; The probes include dengue virus type I detection oligonucleotide fluorescent probe, dengue virus type II detection oligonucleotide fluorescent probe, dengue virus type III detection oligonucleotide fluorescent probe, dengue virus type IV detection oligonucleotide fluorescent probe and internal standard detection oligonucleotide fluorescent probe; The serial number of the universal oligonucleotide upstream primer is SEQ ID NO: 1, the serial numbers of the universal oligonucleotide downstream primer are SEQ ID NO: 2 and SEQ ID NO: 3, the serial number of the oligonucleotide upstream primer for specific amplification of the internal standard is SEQ ID NO: 8, and the serial number of the oligonucleotide downstream primer for specific amplification of the internal standard is SEQ ID NO: 9; The serial number of the dengue virus type I detection oligonucleotide fluorescent probe is SEQ ID NO: 4, the serial number of the dengue virus type II detection oligonucleotide fluorescent probe is SEQ ID NO: 5, the serial number of the dengue virus type III detection oligonucleotide fluorescent probe is SEQ ID NO: 6, the serial number of the dengue virus type IV detection oligonucleotide fluorescent probe is SEQ ID NO: 7, and the serial number of the internal standard detection oligonucleotide fluorescent probe is SEQ ID NO:

10.

2. The freeze-dried PCR reagent for dengue virus typing detection according to claim 1, characterized in that: The two ends of the oligonucleotide fluorescent probe are respectively labeled with a fluorescent group and a quenching group, the fluorescent group is a fluorescent group with luminescence characteristics selected from FAM, VIC, TET, CY3, CY5, and ROX, and the quenching group is a chemical group with fluorescence quenching function selected from BHQ1, BHQ2, BHQ3, TAMRA, and MGB, and each tube of the reaction lyophilized powder comprises: 0.1 μM to 1 μM oligonucleotide upstream primer, 0.1 μM to 1 μM oligonucleotide downstream primer, 0.1 μM to 1 μM oligonucleotide fluorescent probe, 0.1 to 1 unit TaqDNA polymerase, 0.1 to 1 unit reverse transcriptase, a freeze-dried protective agent with a m / v of 1% to 10%, 0.1 to 1 mM dNTP Mix, and an optimized 1 to 10× buffer system.

3. The freeze-dried PCR reagent for dengue virus typing detection according to claim 1, characterized in that: The TaqDNA polymerase is a mutant TaqDNA polymerase, and the reverse transcriptase is a mutant reverse transcriptase.

4. The freeze-dried PCR reagent for dengue virus typing detection according to claim 1, characterized in that: The lyophilization protective agent is a mixture of one or more of pullulan, glycine, HPMC-E5, trehalose, PEG-20000, β-cyclodextrin, sucrose, maltodextrin, gelatin, CMC-Na, and PVP-1000, and the lyophilization protective agent is 1% to 10% trehalose, 1% to 10% β-cyclodextrin, 1% to 10% maltodextrin, and 1% to 10% sucrose.

5. The freeze-dried PCR reagent for dengue virus typing detection according to claim 1, characterized in that: The reaction lyophilized powder is prepared by the following process: The components were mixed evenly according to the proportion to prepare a reaction lyophilized powder mixture with a volume of 25 μL; Prepare the required volume of mixed solution 25 μL×N according to the needs, mix evenly and dispense into 8 strips of PCR tubes, and put them into the freeze dryer without covering to prepare the reaction freeze-dried powder; After lyophilization, cover the PCR tube cap and seal it in an aluminum foil bag (with desiccant inside) by vacuum pumping to obtain the reaction lyophilized powder.

6. The freeze-dried PCR reagent for dengue virus typing detection according to claim 1, characterized in that: The internal standard is a synthetic pseudovirus, and the specific sequence is SEQ ID NO:

11.

7. The freeze-dried PCR reagent for dengue virus typing detection according to claim 1, characterized in that: The main components and concentrations of the positive control are as follows: Pseudovirus containing dengue virus serotype 1 gene-specific fragment, 10 5 copies / mL; Pseudovirus containing dengue virus serotype II gene-specific fragment, 10 5 copies / mL; Pseudovirus containing dengue virus serotype III gene-specific fragment, 10 5 copies / mL; Pseudovirus containing dengue virus serotype IV gene-specific fragment, 10 5 copies / mL; The negative control was RNase-Free Water.

8. A method for preparing a freeze-dried PCR reagent for dengue virus typing detection, applicable to the freeze-dried PCR reagent for dengue virus typing detection according to any one of claims 1 to 9, characterized in that: The following steps are involved: S1. First, a mutant reverse transcriptase is used. This enzyme has a high enzyme activity at 55°C and can complete reverse transcription in a very short time. At the same time, the mutant antibody-modified Taq DNA polymerase can quickly release enzyme activity at 95°C. Combined with a shorter amplicon, the detection time can be greatly shortened, and the detection can be completed in about 30 minutes. S2. Then, oligonucleotide primers and probes, Taq DNA polymerase, reverse transcriptase, dNTP, optimized buffer system, lyophilization protective agent, etc. are made into components that can coexist stably at room temperature, and the detection performance is consistent with that of liquid reagents, and can be transported at room temperature; S3. Finally, a synthetic pseudovirus is used as an internal control in the PCR amplification system. It is added to the extraction reagent together with the sample to participate in nucleic acid extraction, monitor the nucleic acid extraction and PCR amplification process, and prevent false negatives caused by PCR interfering substances in the sample.

9. The method for preparing a freeze-dried PCR reagent for dengue virus typing detection according to claim 8, characterized in that: It also includes fluorescent quantitative PCR detection, which includes the following steps: Reverse transcription was performed at 55°C for 30 s, pre-denaturation was performed at 95°C for 10 s, pre-amplification was performed for 12 cycles, denaturation was performed at 95°C for 1 s, annealing and extension was performed at 56°C for 3 s, amplification was performed for 30 cycles, denaturation was performed at 95°C for 1 s, annealing and extension were performed at 56°C for 13 s, DEN-1 was detected in the FAM channel, DEN-2 was detected in the TET channel, DEN-3 was detected in the ROX channel, DEN-4 was detected in the CY5 channel, and the internal standard was detected in the CY3 channel.

Images