Linearization method for NGS sequencing, sequencing chip and sequencing method

Abstract

The invention relates to a linearization method for NGS sequencing, a sequencing chip and a sequencing method. The linearization method comprises the following steps: introducing single ribonucleoside into a DNA primer, wherein the 2 '-OH position of the ribonucleoside is modified with a hydroxyl protecting group; during linearization, removing the hydroxyl protecting group by using a cutting reagent, and exposing 2 '-OH of ribonucleoside; a phosphodiester bond at the ribonucleoside position is cut off, so that one chain in the DNA primer is broken; the linear reaction formula is shown in the specification. According to the novel linearization method, one DNA chain can be cut and removed very quickly and efficiently, the single-stranded DNA template suitable for sequencing is obtained, and the novel linearization method has the advantages of low damage to DNA, capability of obviously improving the sequencing quality, good stability and capability of keeping stable sequencing quality in actual PE (Poly Ethylene) sequencing application. # imgabs0 #

Description

Technical Field

[0001] The present invention belongs to the technical field of gene sequencing, and in particular relates to a linearization method, a sequencing chip and a sequencing method for NGS sequencing. Background Art

[0002] Next-generation sequencing (NGS) technology is widely used in high-throughput genome sequencing, in which bridge amplification and linearization are key steps. Bridge amplification generates double-stranded DNA clusters on the chip surface, and the purpose of linearization is to remove one of the DNA strands and retain the other single-stranded DNA as a sequencing template (see Figure 1 ). Especially in paired-end sequencing, the linearization process has a direct impact on the accuracy and efficiency of sequencing.

[0003] Sequencing by Synthesis (SBS) is a widely used method in next-generation sequencing technology. Its principle is based on sequencing by synthesis, that is, by gradually synthesizing complementary DNA chains and detecting the introduction order of nucleotides in real time to perform base sequencing. The specific process is as follows:

[0004] (I) Sample preparation and bridge amplification: First, the DNA sample is randomly broken into shorter fragments and connected to specific primer sequences at the ends. Next, these fragments bind to the primers on the surface of the sequencing chip through primers. During the bridge amplification process, a large number of double-stranded DNA clusters are formed, which constitute the template for sequencing.

[0005] (ii) Linearization: After bridge amplification, the linearization step is used to remove one strand of the double-stranded DNA, leaving only the other single-stranded DNA fixed to the chip surface. At this point, the single-stranded DNA will serve as a sequencing template.

[0006] (III) Primer binding and DNA synthesis: Next, the sequencing primer binds to the single-stranded DNA fixed on the chip surface, and the SBS reaction begins. Fluorescently labeled nucleotides containing reversible terminators are gradually added by DNA polymerase, and only one base is added at a time. Since the terminator limits further chain extension, only one nucleotide can be added at a time.

[0007] (iv) Fluorescence signal detection: Each time a nucleotide is introduced, a fluorescent signal is released. The sequencer captures and records the fluorescent signal emitted by each cluster to determine the type of base added. Then, the terminal terminator is removed by chemical treatment to allow the next nucleotide to be added.

[0008] Repeat steps (iii) and (iv) above until the sequence is complete.

[0009] (V) Data processing and base calling: As the sequencing reaction of each cluster proceeds, the system gradually parses the base sequence in each DNA cluster by analyzing the intensity and color of different fluorescent signals to generate the final DNA sequence data.

[0010] In the above sequencing process, the efficiency of the linearization process directly affects the quality of subsequent sequencing. In the linearization step after bridge amplification, if one DNA chain can be efficiently cut off and the other chain is retained as a sequencing template, the number of available single-stranded DNA templates fixed on the chip surface will be greater. This means that in the Sequencing by Synthesis (SBS) process, there are more DNA molecules in each cluster, and the generated fluorescence signal is also stronger, thereby improving the signal intensity and signal-to-noise ratio (SNR). The signal is clearer and the baseline is more stable, which can significantly improve the accuracy of base calling. On the contrary, if the linearization efficiency is low, the number of single-stranded templates available for sequencing will be reduced, resulting in insufficient fluorescence signals generated by each cluster and a decrease in the signal-to-noise ratio. In this case, it is difficult for the sequencer to accurately distinguish different fluorescence signals, and errors are prone to occur during base calling, which in turn affects the final sequencing quality. Therefore, optimizing the linearization step is crucial to improving sequencing accuracy and reducing error rates.

[0011] There are three commonly used linearization methods:

[0012] USER enzyme excision method: This method introduces U base (uracil) into the primer on the chip surface, and then uses USER enzyme (uracil DNA glycosylase and endonuclease) to excise a DNA chain containing the U base. The USER enzyme method is currently the most efficient linearization method with the least DNA damage, and is therefore widely used in sequencing processes.

[0013] FPG enzyme excision method: This method introduces 8-oxo-G bases into the primers on the chip surface, and uses FPG enzyme (epiglucosylase) to recognize and excise the DNA chain containing this special base. Although FPG enzyme causes less damage to DNA, its efficiency in excising DNA chains on the chip surface is not as high as that of USER enzyme, and its efficiency is unstable, which will affect the uniformity and accuracy of sequencing templates in high-density cluster structures, resulting in unstable sequencing quality.

[0014] Sodium periodate chemical cleavage method: The third method is chemical cleavage, which introduces diol functional groups into oligonucleotide primers and fixes the primers on the chip surface. During linearization, the chip surface is treated with sodium periodate, which can cut diols and thus remove a DNA chain. Although this method has a high cutting efficiency, sodium periodate, as a strong oxidant, can cause significant damage to DNA, affecting the accuracy of sequencing and data quality.

[0015] It can be seen that the above three methods each have their own advantages and disadvantages, and in double-end sequencing, two different linearization methods are often needed to be used at the same time to cut the DNA chains in two directions respectively, which makes the linearization process more complicated and demanding. However, although the most commonly used USER enzyme excision method is highly efficient and has low damage, it cannot solve the needs of double-end sequencing alone; the efficiency of the FPG enzyme excision method is not ideal, and sodium periodate is highly destructive to DNA. Therefore, the existing linearization methods still have obvious limitations in the application of double-end sequencing, and there is an urgent need to develop new, efficient and less damaging linearization methods to improve the overall performance of double-end sequencing. Summary of the invention

[0016] Based on this, the purpose of the present invention is to provide a new, efficient and less damaging DNA linearization method to improve the overall performance of sequencing (especially double-end sequencing).

[0017] The technical solutions for achieving the above-mentioned purpose include the following.

[0018] In a first aspect, the present invention provides a novel linearization method for NGS sequencing, comprising the following steps:

[0019] Introducing a single ribonucleoside into a DNA primer, wherein the 2'-OH position of the ribonucleoside is modified with a hydroxyl protecting group;

[0020] During linearization, the hydroxyl protecting group is removed with a cleavage reagent to expose the 2'-OH of the ribonucleoside;

[0021] Cutting the phosphodiester bond at the ribonucleoside position results in a break in one strand of the DNA primer;

[0022] The linearized reaction is as follows:

[0023]

[0024] Wherein, R is a hydroxyl protecting group; Base is a heterocyclic base; and the cleavage reagent is a chemical reagent capable of removing the R group in the ribonucleoside.

[0025] Wherein, R can be selected from but not limited to the following groups: amino,

[0026]

[0027] Among them, R 1 , R 2 and R 3 are independently selected from: H, C 1 -C 6 Alkyl, C 3 -C 8 Cycloalkyl, phenyl substituted C1 -C 6 Alkyl, halogen substituted C 1 -C 6 alkyl;

[0028] R 4 Selected from: cyanomethyl, azido, nitro, amino, sulfonyl, carboxyl, halogen, C 1 -C 6 Alkoxy, R 6 Substituted or unsubstituted C 6 -C 10 Aryl, R 6 a substituted or unsubstituted 5-10 membered heteroaryl group;

[0029] R 5 Selected from: C 1 -C 6 Alkyl, C 3 -C 8 Cycloalkyl, phenyl substituted C 1 -C 6 Alkyl, halogen substituted C 1 -C 6 Alkyl, C 1 -C 6 Alkoxy, halogen substituted C 1 -C 6 Alkoxy, C 1 -C 6 Alkylthio, C 1 -C 6 Alkylamino, R 6 Substituted or unsubstituted C 6 -C 10 Aryl, R 6 a substituted or unsubstituted 5-10 membered heteroaryl group;

[0030] R 6 Selected from: C 1 -C 6 Alkyl, cyano, azido, nitro, amino, sulfonyl, carboxyl, halogen, C 3 -C 8 Cycloalkyl, phenyl substituted C 1 -C 6 Alkyl, halogen substituted C 1 -C 6 Alkyl, C 1 -C 6 Alkoxy, halogen substituted C 1 -C 6 Alkoxy, C 1 -C 6 Alkylthio, C 1 -C 6 Alkylamino.

[0031] Base can be selected from the group consisting of adenine, guanine, cytosine, uracil, thymine, methyladenine, 1-methylguanine, isoguanine, 7-methylguanine, methylcytosine, isocytosine, pseudouracil, 5-hydroxymethylcytosine, hypoxanthine, R 7 Substituted adenine, R 7 Substituted guanine, R 7 Substituted cytosine, R 7 Substituted uracil, R 7 substituted thymine, etc.; wherein R 7 Selected from: H, benzoyl, benzyloxymethyl.

[0032] In a second aspect, the present invention provides an NGS sequencing chip, wherein at least one DNA primer is connected to the surface of the NGS sequencing chip, wherein a single ribonucleoside is introduced into the at least one DNA primer, and the 2'-OH position of the ribonucleoside is modified with a hydroxyl protecting group;

[0033] A DNA primer incorporating a single ribonucleoside is shown in the following formula (I):

[0034]

[0035] wherein R and Base are as described in any one of claims 1-4.

[0036] Furthermore, two DNA primers are connected to the surface of the NGS sequencing chip, the two DNA primers are P5 primer and P7 primer, a single ribonucleoside is introduced into the P7 primer, and the 2'-OH position of the ribonucleoside is modified with a hydroxyl protecting group; the P5 primer sequence has a dU base modification in the middle;

[0037] The P7 primer incorporating a single ribonucleoside is shown in the following formula (I):

[0038]

[0039] In a third aspect, the present invention provides a method for preparing the NGS sequencing chip of the present invention, comprising the following steps:

[0040] The DNA primers are prepared, and at least one DNA primer is as shown in formula (I);

[0041] The DNA primers are modified onto the surface of the NGS sequencing chip.

[0042] In a fourth aspect, the present invention provides the linearization method described in the present invention, or the application of the NGS sequencing chip described in the present invention in NGS sequencing (especially double-end NGS sequencing).

[0043] In a fifth aspect, the present invention provides an NGS sequencing method, comprising the following steps:

[0044] Sample preparation and amplification: Prepare a sequencing library from a DNA sample to be tested, hybridize the sequencing library with the NGS sequencing chip of the present invention and perform surface amplification to obtain a double-stranded DNA cluster to be tested fixed on the surface of the NGS sequencing chip;

[0045] Linearization: Pass a cutting reagent solution into the NGS sequencing chip and incubate to remove the R group in the DNA primer; then pass an RNase solution or an alkaline reagent and incubate to cut the ribonucleosides to obtain single-stranded DNA fixed on the surface of the NGS sequencing chip;

[0046] The sequencing primer is combined with the single-stranded DNA fixed on the surface of the NGS sequencing chip to perform SBS sequencing.

[0047] In a sixth aspect, the present invention provides a double-end NGS sequencing method, comprising the following steps:

[0048] Sample preparation and amplification: preparing a sequencing library from a DNA sample to be tested, hybridizing the sequencing library with the NGS sequencing chip of claim 13 and performing surface amplification to obtain a double-stranded DNA cluster to be tested fixed on the surface of the NGS sequencing chip;

[0049] First-strand linearization and sequencing: USER enzyme excision method is used to cut the P5 primer in the first strand to obtain single-stranded DNA fixed on the surface of the NGS sequencing chip. The sequencing primer is combined with the single-stranded DNA fixed on the surface of the NGS sequencing chip to perform first-strand SBS sequencing;

[0050] Second-chain linearization and sequencing: Pass a cutting reagent solution into the NGS sequencing chip and incubate to remove the R group in the P7 primer in the second chain; then pass an RNase solution or an alkaline reagent and incubate to cut the ribonucleosides in the P7 primer to obtain single-stranded DNA fixed on the surface of the NGS sequencing chip; combine the sequencing primer with the single-stranded DNA fixed on the surface of the NGS sequencing chip to perform second-chain SBS sequencing.

[0051] The present invention has the following beneficial effects:

[0052] The present invention introduces a 2'-OH modified RNA nucleoside (i.e., ribonucleoside) with a hydroxyl protecting group into a DNA primer sequence, and then uses the DNA primer to modify an NGS sequencing chip, and is used for linearization in NGS sequencing. During linearization, the hydroxyl protecting group is cut with a chemical reagent, and then treated with RNase or an alkaline reagent to obtain a single-stranded DNA template suitable for sequencing, thereby obtaining a novel linearization method. The novel linearization method of the present invention can very quickly and efficiently cut and remove a DNA chain to obtain a single-stranded DNA template suitable for sequencing, and its cutting reaction conditions have the advantage of low damage to DNA, and using it for NGS sequencing can significantly improve the sequencing quality; especially when it is used in conjunction with the existing USER enzyme excision method, the quality of double-end sequencing can be significantly improved, and it has the advantage of good stability, and can maintain stable sequencing quality in actual PE sequencing applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Figure 1 Schematic diagram of the NGS sequencing process and its linearization method.

[0054] Figure 2 The efficiency of DNA cutting by linearization 2 reagent was analyzed by gel electrophoresis. The upper part is the electrophoresis spectrum, and the lower part is the comparison of P7 primer cutting efficiency.

[0055] Figure 3 Comparison of SE100 sequencing signals for two linearization methods for direct cleavage of P7.

[0056] Figure 4 Comparison of SE100 sequencing Q30 for two linearization methods for direct cleavage of P7.

[0057] Figure 5 Schematic diagram of the 2-strand linearization method for cleaving RNA nucleosides.

[0058] Figure 6 Comparison of PE150 sequencing signals of two linearization methods for direct cutting of P7.

[0059] Figure 7 Comparison of PE150 sequencing Q30 for two linearization methods for direct cleavage of P7.

[0060] Figure 8 The control group is 10 sets of parallel PE150 sequencing signals of the linearization reagent 2 of the traditional FPG enzyme.

[0061] Fig. 9 Control group - 10 parallel PE150 sequencing Q30 of linearization reagent 2 of traditional FPG enzyme.

[0062] Fig.10Experimental group - 10 sets of parallel PE150 sequencing signals of the new linearization reagent 2 for cutting RNA nucleosides.

[0063] Fig.11 For the experimental group - 10 parallel sets of PE150 sequencing Q30 using the new linearization reagent 2 that cuts RNA nucleosides.

[0064] Fig.12 Comparison of the second-strand signal maintenance rates of 10 parallel PE150 sequencing runs in the experimental and control groups. DETAILED DESCRIPTION

[0065] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0066] The experimental methods in the following examples without specifying specific conditions are usually carried out according to conventional conditions, such as the fourth edition of Molecular Cloning: A Laboratory Manual edited by Green and Sambrook, published in 2013, or according to the conditions recommended by the manufacturer. The various commonly used chemical reagents used in the examples are all commercially available products.

[0067] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0068] In addition, as used in the present invention, the term "or" is an inclusive "or" symbol and is equivalent to the term "and / or", unless the context clearly dictates otherwise. The term "based on" is not exclusive and allows for being based on other factors not described, unless the context clearly dictates otherwise. In addition, throughout the specification, the meanings of "a", "an", and "the" include plural referents. The meaning of "in..." includes "in..." and "on...".

[0069] There are currently three known methods for NGS sequencing, namely USER enzyme excision, FPG enzyme excision, and sodium periodate chemical cutting. These three methods have their own advantages and disadvantages, and in double-end sequencing, two different linearization methods are often needed to be used simultaneously to cut the DNA chains in two directions respectively, which makes the linearization process more complicated and demanding. However, although the most commonly used USER enzyme excision method is highly efficient and has low damage, it cannot solve the needs of double-end sequencing alone; the efficiency of the FPG enzyme excision method is not ideal, and the cutting efficiency is unstable, sometimes good and sometimes bad, which leads to very unstable sequencing quality; sodium periodate is highly destructive to DNA. Therefore, the existing linearization methods still have obvious limitations in the application of double-end sequencing. Based on this, the purpose of the invention is to develop a new linearization method that can cut efficiently and has little damage to DNA, so as to improve the overall performance of its sequencing in NGS sequencing, especially to improve the overall quality of double-end sequencing.

[0070] In order to achieve the above object, in one embodiment of the present invention, a linearization method for NGS sequencing is provided, comprising the following steps:

[0071] Introducing a single ribonucleoside into a DNA primer, wherein the 2'-OH position of the ribonucleoside is modified with a hydroxyl protecting group;

[0072] During linearization, the hydroxyl protecting group is removed with a cleavage reagent to expose the 2'-OH of the ribonucleoside;

[0073] Cutting the phosphodiester bond at the ribonucleoside position results in a break in one strand of the DNA primer;

[0074] The linearized reaction is as follows:

[0075]

[0076] Wherein, R is a hydroxyl protecting group; Base is a heterocyclic base; and the cleavage reagent is a chemical reagent capable of removing the R group in the ribonucleoside.

[0077] Base can be specifically selected from: adenine, guanine, cytosine, uracil, thymine, methyladenine, 1-methylguanine, isoguanine, 7-methylguanine, methylcytosine, isocytosine, pseudouracil, 5-hydroxymethylcytosine, hypoxanthine, R 7 Substituted adenine, R 7 Substituted guanine, R 7 Substituted cytosine, R 7 Substituted uracil, R 7 Substituted thymine; wherein R 7 It is a protecting group for hydrogen or amino, for example: benzoyl, benzyloxymethyl.

[0078] R is a hydroxyl protecting group known to those skilled in the art, which can be selected from but not limited to the following groups: amino,

[0079]

[0080] Among them, R 1 , R 2 and R 3 are independently selected from: H, C 1 -C 6 Alkyl, C 3 -C 8 Cycloalkyl, phenyl substituted C 1 -C 6 Alkyl, halogen substituted C 1 -C 6 alkyl;

[0081] R 4 Selected from: cyanomethyl, azido, nitro, amino, sulfonyl, carboxyl, halogen, C 1 -C 6 Alkoxy, R 6 Substituted or unsubstituted C 6 -C 10 Aryl, R 6 a substituted or unsubstituted 5-10 membered heteroaryl group;

[0082] R 5 Selected from: C 1 -C 6 Alkyl, C 3 -C 8 Cycloalkyl, phenyl substituted C 1 -C 6 Alkyl, halogen substituted C 1 -C 6 Alkyl, C 1 -C 6 Alkoxy, halogen substituted C 1 -C 6 Alkoxy, C 1 -C 6 Alkylthio, C 1 -C 6 Alkylamino, R 6 Substituted or unsubstituted C 6 -C 10 Aryl, R 6 a substituted or unsubstituted 5-10 membered heteroaryl group;

[0083] R 6 Selected from: C 1 -C 6Alkyl, cyano, azido, nitro, amino, sulfonyl, carboxyl, halogen, C 3 -C 8 Cycloalkyl, phenyl substituted C 1 -C 6 Alkyl, halogen substituted C 1 -C 6 Alkyl, C 1 -C 6 Alkoxy, halogen substituted C 1 -C 6 Alkoxy, C 1 -C 6 Alkylthio, C 1 -C 6 Alkylamino.

[0084] In some preferred embodiments, R is selected from amino or the following groups:

[0085]

[0086] R 1 , R 2 and R 3 Each is independently selected from: H, methyl, ethyl;

[0087] R 4 Selected from: cyanomethyl, azido, nitro, R 6 Substituted or unsubstituted C 6 -C 10 Aryl, R 6 Substituted or unsubstituted 5-6 membered heteroaryl;

[0088] R 6 Selected from: methyl, ethyl, propyl, cyano, azido, nitro, amino, sulfonyl, carboxyl, halogen, C 3 -C 6 Cycloalkyl, methoxy, ethoxy;

[0089] More preferably, R is selected from:

[0090]

[0091] More preferably, R is allyl.

[0092] The hydroxyl protecting group of the present invention is used to protect the 2'-OH of RNA nucleoside, and can be effectively chemically removed during linearization, thereby exposing the 2'-OH for subsequent reactions. The hydroxyl protecting group of the present invention is highly compatible with DNA sequencing and can be efficiently removed by chemical reagents without damaging DNA. For example, when R is an allyl group, it can be rapidly cut by a palladium catalyst; when R is an o-nitrobenzyl group, it can be destroyed by ultraviolet light (3'-O-modified nucleotides as reversible terminators for pyrosequencing. Proc Natl Acad Sci US A. 2007 Oct 16; 104 (42): 16462-7); when R is an azidomethylene group, it can be removed by triphenylphosphine (Four-color DNA sequencing with 3'-O-modified nucleotide reversible terminators and chemically cleavable fluorescent dideoxynucleotides. Proc Natl Acad Sci USA. 2008 Jul 8; 105 (27): 9145-50.); and the like.

[0093] Therefore, the above hydroxyl protecting groups can be modified on the 2'-OH of RNA nucleosides (i.e. ribonucleosides) by chemical reaction, and prepared into corresponding phosphoramidites (the preparation method can be found in J.Org.Chem.2011,76,9,3042-3053; Probing the Influence of Stereoelectronic Effects on the BiophysicalProperties of Oligonucleotides:Comprehensive Analysis ofthe RNA Affinity,Nuclease,Biochemistry 2005,44,9045-9057; etc.), and then solid phase synthesis is used to obtain the DNA sequence containing one RNA nucleoside required by the present invention, which is used to modify the NGS sequencing chip. During linearization, the hydroxyl protecting group is cut with a chemical reagent, and then treated with RNase or alkaline conditions to obtain a single-stranded DNA template suitable for sequencing.

[0094] In some embodiments, the hydroxyl protecting group R is an allyl group, and the cleavage reagent is a palladium catalyst; wherein the palladium catalyst can be generated from sodium tetrachloropalladate and sodium trisulfonate triphenylphosphine, and the ratio of sodium tetrachloropalladate to sodium trisulfonate triphenylphosphine is preferably 1:1-20, more preferably 1:5-15, more preferably 1:6-9, and more preferably 1:7-8.

[0095] In some embodiments, removing the hydroxyl protecting group with a cleavage agent comprises: incubating the DNA primer with a palladium catalyst solution; preferably, the palladium catalyst solution contains Na 2 PdCl 4 and P(PhSO 3 Na) 3 Buffer solution; Further preferably, the Na 2 PdCl 4 The concentration of the palladium catalyst in the solution is 0.5 mM to 3 mM, more preferably 1 mM to 2 mM, and more preferably 1.1 mM to 1.5 mM; more preferably, the P(PhSO 3 Na) 3 The concentration of the palladium catalyst in the solution is 3 mM to 27 mM, more preferably 6 mM to 18 mM, and even more preferably 8 mM to 12 mM.

[0096] The buffer in the palladium catalyst solution may be a buffer such as Thermopol I, Tris, MOPS, HEPES, or TE.

[0097] In some embodiments, the incubation temperature with the palladium catalyst solution is 40°C to 80°C, preferably 50°C to 70°C, and more preferably 55°C to 65°C.

[0098] In some embodiments, the incubation time with the palladium catalyst solution is 0.1 min to 30 min, preferably 0.5 min to 10 min, and more preferably 1 min to 5 min.

[0099] In the linearization method of the present invention, the method of cutting the phosphodiester bond at the ribonucleoside position can be to use RNase to recognize and cut the phosphodiester bond at the ribonucleoside position, or to use an alkaline reagent to cut the phosphodiester bond at the ribonucleoside position.

[0100] The RNase may be RNase HII, RNase HI or RNase HIII, etc.

[0101] In some embodiments, the method of using RNase to recognize and cut the phosphodiester bond at the ribonucleoside position comprises: incubating the DNA primer exposing the 2'-OH of the ribonucleoside with an RNase solution; preferably, the RNase solution is a buffer solution containing RNaseHII.

[0102] In some embodiments, the enzyme activity of the RNase HII in the RNase solution is 0.1U / uL to 5U / uL, preferably 0.3U / uL to 3U / uL, more preferably 0.5U / uL to 1.5U / uL, and more preferably 0.7U / uL to 1.0U / uL.

[0103] In some embodiments, the buffer in the RNase solution is a buffer such as Thermopol I, Tris, MOPS, HEPES, TE, etc.

[0104] In some embodiments, the temperature of incubation with the RNase solution is 35°C to 40°C.

[0105] In some embodiments, the incubation time with the RNase solution is 0.5 min to 30 min, preferably 1 min to 10 min, and more preferably 3 min to 8 min.

[0106] The linearization method of the present invention can very quickly and efficiently cut and remove a DNA chain to obtain a single-stranded DNA template suitable for sequencing, and its cutting reaction conditions have the advantage of low damage to DNA, thereby significantly improving the sequencing quality; especially when it is used in conjunction with the existing USER enzyme excision method, it can significantly improve the quality of double-end sequencing, and has the advantage of good stability, and can maintain stable sequencing quality in actual PE sequencing applications.

[0107] Based on the above new linearization method, the present invention provides an NGS sequencing chip in another embodiment thereof, wherein at least one DNA primer is connected to the surface of the NGS sequencing chip, wherein a single ribonucleoside is introduced into the at least one DNA primer, and the 2'-OH position of the ribonucleoside is modified with a hydroxyl protecting group;

[0108] A DNA primer incorporating a single ribonucleoside is shown in the following formula (I):

[0109]

[0110] Wherein, R is a hydroxyl protecting group; Base is a heterocyclic base.

[0111] Specifically, Base can be selected from: adenine, guanine, cytosine, uracil, thymine, methyladenine, 1-methylguanine, isoguanine, 7-methylguanine, methylcytosine, isocytosine, pseudouracil, 5-hydroxymethylcytosine, hypoxanthine, R 7 Substituted adenine, R 7 Substituted guanine, R 7 Substituted cytosine, R 7 Substituted uracil, R 7 Substituted thymine; wherein R 7 It is a protecting group for hydrogen or amino, for example: benzoyl, benzyloxymethyl.

[0112] R is a hydroxyl protecting group known to those skilled in the art, which can be selected from but not limited to the following groups: amino,

[0113]

[0114] Among them, R 1 , R 2 and R 3 are independently selected from: H, C 1 -C 6 Alkyl, C 3 -C 8 Cycloalkyl, phenyl substituted C 1 -C 6 Alkyl, halogen substituted C 1 -C 6 alkyl;

[0115] R 4 Selected from: cyanomethyl, azido, nitro, amino, sulfonyl, carboxyl, halogen, C 1 -C 6 Alkoxy, R 6 Substituted or unsubstituted C 6 -C 10 Aryl, R 6 a substituted or unsubstituted 5-10 membered heteroaryl group;

[0116] R 5 Selected from: C 1 -C 6 Alkyl, C 3 -C 8 Cycloalkyl, phenyl substituted C 1 -C 6 Alkyl, halogen substituted C 1 -C 6 Alkyl, C 1 -C 6 Alkoxy, halogen substituted C 1 -C 6 Alkoxy, C1 -C 6 Alkylthio, C 1 -C 6 Alkylamino, R 6 Substituted or unsubstituted C 6 -C 10 Aryl, R 6 a substituted or unsubstituted 5-10 membered heteroaryl group;

[0117] R 6 Selected from: C 1 -C 6 Alkyl, cyano, azido, nitro, amino, sulfonyl, carboxyl, halogen, C 3 -C 8 Cycloalkyl, phenyl substituted C 1 -C 6 Alkyl, halogen substituted C 1 -C 6 Alkyl, C 1 -C 6 Alkoxy, halogen substituted C 1 -C 6 Alkoxy, C 1 -C 6 Alkylthio, C 1 -C 6 Alkylamino.

[0118] In some preferred embodiments, R is selected from amino or the following groups:

[0119]

[0120] R 1 , R 2 and R 3 Each is independently selected from: H, methyl, ethyl;

[0121] R 4 Selected from: cyanomethyl, azido, nitro, R 6 Substituted or unsubstituted C 6 -C 10 Aryl, R 6 Substituted or unsubstituted 5-6 membered heteroaryl;

[0122] R 6 Selected from: methyl, ethyl, propyl, cyano, azido, nitro, amino, sulfonyl, carboxyl, halogen, C 3 -C 6 Cycloalkyl, methoxy, ethoxy;

[0123] More preferably, R is selected from:

[0124]

[0125] More preferably, R is allyl.

[0126] The single RNA nucleoside embedded in the DNA sequence can be cut under an alkaline environment or under the action of RNase, and broken into two DNA ends. Therefore, the single RNA nucleoside embedded in the DNA sequence can play the role of a linear cutting site. However, the stability of RNA nucleoside itself is poorer than that of DNA nucleoside, and is not suitable for long-term storage of gene chips. Therefore, the present invention modifies the 2'-OH position of the single RNA nucleoside embedded in the DNA sequence with a hydroxyl protecting group, thereby greatly improving the stability of the RNA nucleoside; and in double-end sequencing, it can smoothly pass the first chain sequencing, and when the second chain is linearized, the hydroxyl protecting group can be effectively removed by the corresponding chemical reagent, so that the 2'-OH of the RNA nucleoside is exposed again, and further can be recognized by RNase or alkaline reagents and cut the phosphodiester bond, resulting in chain breakage.

[0127] In double-end sequencing, two DNA primers are connected to the surface of the NGS sequencing chip, the two DNA primers are P5 primer and P7 primer, a single ribonucleoside is introduced into the P7 primer, and the 2'-OH position of the ribonucleoside is modified with a hydroxyl protecting group; the middle of the P5 primer sequence is modified with a dU base; the P7 primer introduced with a single ribonucleoside is shown in the following formula (I):

[0128]

[0129] The NGS sequencing chip of the present invention can be prepared according to conventional methods in the art, for example, mainly comprising the following steps:

[0130] The DNA primers are prepared, and at least one DNA primer is as shown in formula (I);

[0131] The DNA primers are modified onto the surface of the NGS sequencing chip.

[0132] The DNA primer shown in formula (I), wherein the hydroxyl protecting group can be modified at the 2'-OH of RNA nucleoside (i.e., ribonucleoside) by chemical reaction, and prepared into the corresponding phosphoramidite, i.e., the phosphoramidite of ribonucleoside with hydroxyl protecting group modified at 2'-OH (the preparation method can be referred to J. Org. Chem. 2011, 76, 9, 3042-3053; Probing the Influence of Stereoelectronic Effects on the Biophysical Properties of Oligonucleotides: Comprehensive Analysis of the RNA Affinity, Nuclease, Biochemistry 2005, 44, 9045-9057; etc.), and then the DNA primer is obtained by solid phase synthesis, and then modified onto the NGS sequencing chip by conventional methods in the art.

[0133] Based on the linearization method provided by the present invention, or the application of the NGS sequencing chip in NGS sequencing (especially double-end NGS sequencing), another embodiment of the present invention provides an NGS sequencing method, comprising the following steps:

[0134] Sample preparation and amplification: Prepare a sequencing library from a DNA sample to be tested, hybridize the sequencing library with the NGS sequencing chip of the present invention and perform surface amplification to obtain a double-stranded DNA cluster to be tested fixed on the surface of the NGS sequencing chip;

[0135] Linearization: Pass a cutting reagent solution into the NGS sequencing chip and incubate to remove the R group in the DNA primer; then pass an RNase solution or an alkaline reagent and incubate to cut the ribonucleosides to obtain single-stranded DNA fixed on the surface of the NGS sequencing chip;

[0136] The sequencing primer is combined with the single-stranded DNA fixed on the surface of the NGS sequencing chip to perform SBS sequencing.

[0137] Specifically, during double-end NGS sequencing, two DNA primers are connected to the surface of the NGS sequencing chip, the two DNA primers are P5 primer and P7 primer, a single ribonucleoside is introduced into the P7 primer, and the 2'-OH position of the ribonucleoside is modified with a hydroxyl protecting group; the P5 primer sequence has a dU base modification in the middle; the double-end NGS sequencing method comprises the following steps:

[0138] Sample preparation and amplification: Prepare a sequencing library from a DNA sample to be tested, hybridize the sequencing library with the NGS sequencing chip of the present invention and perform surface amplification to obtain a double-stranded DNA cluster to be tested fixed on the surface of the NGS sequencing chip;

[0139] First-strand linearization and sequencing: USER enzyme excision method is used to cut the P5 primer in the first strand to obtain single-stranded DNA fixed on the surface of the NGS sequencing chip. The sequencing primer is combined with the single-stranded DNA fixed on the surface of the NGS sequencing chip to perform first-strand SBS sequencing;

[0140] Second-chain linearization and sequencing: Pass a cutting reagent solution into the NGS sequencing chip and incubate to remove the R group in the P7 primer in the second chain; then pass an RNase solution or an alkaline reagent and incubate to cut the ribonucleosides in the P7 primer to obtain single-stranded DNA fixed on the surface of the NGS sequencing chip; combine the sequencing primer with the single-stranded DNA fixed on the surface of the NGS sequencing chip to perform second-chain SBS sequencing.

[0141] In some embodiments, the hydroxyl protecting group R is an allyl group, and the cleavage reagent is a palladium catalyst; preferably, the palladium catalyst is generated from sodium tetrachloropalladate and sodium trisulfonate triphenylphosphine, and the ratio of sodium tetrachloropalladate to sodium trisulfonate triphenylphosphine is preferably 1:1-20, more preferably 1:5-15, more preferably 1:6-9, and more preferably 1:7-8.

[0142] In some embodiments, the cutting reagent solution contains Na 2 PdCl 4 and P(PhSO 3 Na) 3 Buffer solution; wherein the Na 2 PdCl 4 The concentration of the cleavage reagent in the solution is preferably 0.5 mM to 3 mM, preferably 1 mM to 2 mM, more preferably 1.1 mM to 1.5 mM; the P(PhSO 3 Na) 3 The concentration of the cleavage reagent in the solution is preferably 3 mM to 27 mM, preferably 6 mM to 18 mM, and more preferably 8 mM to 12 mM; the buffer in the solution is preferably Thermopol I buffer.

[0143] In some embodiments, the incubation temperature after the cutting reagent solution is introduced is 40°C to 80°C, preferably 50°C to 70°C, and more preferably 55°C to 65°C.

[0144] In some embodiments, the incubation time after the cutting reagent solution is introduced is 0.1 min to 30 min, preferably 0.5 min to 10 min, and more preferably 1 min to 5 min.

[0145] In some embodiments, the RNase is RNase HI or RNase HIII.

[0146] In some embodiments, the RNase solution is a buffer solution containing RNase HII; the enzymatic activity of the RNase HII in the RNase solution is preferably 0.1U / uL~5U / uL, more preferably 0.3U / uL~3U / uL, more preferably 0.5U / uL~1.5U / uL, more preferably 0.7U / uL~1.0U / uL; the buffer in the RNase solution is preferably Thermopol I, Tris, MOPS, HEPES, TE and other buffers.

[0147] In some embodiments, the incubation temperature after the RNase solution is introduced is 35° C. to 40° C.

[0148] In some embodiments, the incubation time after the introduction of the RNase solution is 0.5 min to 30 min, preferably 1 min to 10 min, and more preferably 3 min to 8 min.

[0149] The new linearization method or NGS sequencing chip provided by the present invention is used for NGS sequencing, which can very quickly and efficiently cut and remove a DNA chain to obtain a single-stranded DNA template suitable for sequencing, and has the advantage of low damage to DNA, which can significantly improve the sequencing quality, especially the quality of double-end sequencing, and has the advantage of good stability, and can maintain stable sequencing quality in actual PE sequencing applications.

[0150] The present invention is further described in detail below with reference to specific embodiments.

[0151] Example 1 Preparation of microfluidic chip

[0152] This embodiment provides a microfluidic chip for gene sequencing, wherein the surface of the chip is modified with a primer P5, which has a dU base modification in the middle of its sequence and can be broken under the action of USER enzyme, thereby realizing a 1-chain linearization function; meanwhile, the surface of the chip is modified with a primer P7, which has a 2'-O-allyl substituted base modification in the middle of its sequence and can be broken under the action of a palladium catalyst and an RNase II enzyme in sequence, thereby realizing a 2-chain linearization function.

[0153] The method for preparing a microfluidic chip for gene sequencing in this embodiment comprises the following steps:

[0154] 1. Prepare P5 primer (DBCO-P5-dU) and P7 primer containing 2'-O-allyl-T (DBCO-P7-2'-O-allyl-T) by standard solid phase synthesis method, and prepare P7 primer containing 8-oxo-G (DBCO-P7-8-oxo-G) as a control. Among them, DBCO-P5-dU uses DMT-dU phosphoramidite as a raw material to modify the dU base at the specified position of the P5 primer, and its sequence is: TTTTTTTTT / ideoxyU / AGAGCGACTGCACAACTGTAAGGT (SEQ ID NO: 1); DBCO-P7-2'-O-allyl-T uses 2'-O-allyl-T phosphoramidite (phosphoramidite of 2'-O-allyl substituted RNA nucleoside) as a raw material to introduce 2'-O-allyl-T at the specified position of the P7 primer, and its sequence is: TTTTTTTTTTTA[allyl-T]GCGACAGAAACTGTGCAGCTACCTAAT (SEQ ID NO: 2); DBCO-P7-8-oxo-G uses 8-oxo-G phosphoramidite as a raw material to introduce 8-oxo-G at the specified position of the P7 primer, and its sequence is: TTTTTTTTTTAT / i8oxodG / CGACAGAAACTGTGCAGCTACCTAAT (SEQ ID NO:3).

[0155] Wherein, the DMT-dU phosphoramidite and 8-oxo-G phosphoramidite used are commercially available products. The phosphoramidite of 2'-O-allyl substituted RNA nucleoside can be prepared by referring to the method disclosed in the literature (e.g., Probing the Influence of Stereoelectronic Effects on the Biophysical Properties of Oligonucleotides: Comprehensive Analysis of the RNA Affinity, Nuclease, Biochemistry 2005, 44, 9045-9057. etc.). Wherein, the structural formula of the phosphoramidite of 2'-O-allyl-T is as follows:

[0156]

[0157] 2. According to the preparation process of the sequencing microfluidic chip supporting the Salus pro sequencer, modify the primers prepared in step 1 to the surface of the microfluidic chip for use in the NGS sequencing experiment. The specific method is:

[0158] a. Add 3xSSC (buffer, pH 8.0) containing 10uM DBCO-P5-dU (Shanghai Bioengineering) and 10uM DBCO-P7-2'-O-allyl-T (a T base in the P7 sequence is replaced with 2'-O-allyl-T, Shanghai Bioengineering) into the microfluidic chip with an azide group, seal the chip in a vacuum, and place it in a 37°C oven for reaction for 12 hours; b. After the reaction, remove the unreacted primers with formamide, then wash the chip surface twice with 3xSSC, and blow dry with nitrogen.

[0159] The microfluidic chip for control experiment was prepared in the same way, except that DBCO-P7-8-oxo-G replaced DBCO-P7-2'-O-allyl-T.

[0160] Example 2 New linearization method for DNA chain cutting efficiency

[0161] This example evaluates the linearization cleavage efficiency of the FPG enzyme excision method and the novel linearization method of the present invention, i.e., the linearization cleavage efficiency of two primers containing linearization cleavage sites (P7-2'-O-allyl-T and P7-8-oxo-G) in their respective solutions. The specific method is as follows:

[0162] Experimental Group 1: New Linearization Method

[0163] 1. Mix two portions of 1 x Thermopol I reaction buffer (20 mM Tris-HCl, 10 mM (NH 4 ) 4 SO 4 , 10 mM KCl, 2 mM MgSO 4 and 0.1% Triton X-100, pH 8.8) 20uL was heated to 95°C and heated at 95°C for 5min, cooled to room temperature and incubated for half an hour to form double-stranded DNA.

[0164] 2. Take 5uL of each of the two double-stranded DNA solutions prepared in step 1 and add Na 2 PdCl 4 and P(PhSO 3 Na) 3 The final concentrations were 1.28 mM (Na 2 PdCl 4 ) and 9.78 mM (P(PhSO 3 Na) 3 ), incubated at 60°C for 1 min and 3 min respectively to cleave the 2'-O-allyl group. They are marked as sample 1 and sample 2 respectively.

[0165] 3. Add 100uL of cold ethanol to the solution treated in step 2, shake, mix thoroughly, and centrifuge at 10000xG and 4°C for 20 minutes to precipitate DNA. Carefully remove the supernatant, open the centrifuge tube, and dry.

[0166] 4. Add 25uL of 1x Thermopol I reaction buffer containing 20U of RNase HII to the centrifuge tube and incubate at 37℃ for 5min.

[0167] 5. Take out 2uL of the solution treated in step 4, dilute it 10 times, and then take out 2uL for 12% DNA PAGE gel electrophoresis analysis.

[0168] Experimental group 2: FPG enzymatic excision method

[0169] Experimental group 2 was the P7 primer containing 8-oxo-G cut by traditional linearization reagent.

[0170] 1. Add 1X NEBuffer containing 20uM P7-8-oxo-G and 40uM P7C (complementary chain of Cy3-labeled P7) TM 1. Heat 20uL of reaction buffer to 95℃, and heat at 95℃ for 5min, then cool to room temperature for half an hour to form double-stranded DNA. Prepare 6 tubes of double-stranded DNA sample solution under the same conditions.

[0171] 2. Dispense 5x FPG linearization reagent (Salus Pro Sequencing Reagent Set (PRM-PE150-500M)) produced in the same batch into 500 tubes and store in a -20°C refrigerator for one week. Randomly select 6 tubes and add them to 5uL of the DNA sample solution prepared in step 1 (labeled as sample 3-sample 8 respectively). Incubate at 37°C for 15 minutes to cut the 8-oxo-G in the primer.

[0172] 3. Take out 2uL of the solution treated in step 2, dilute it 10 times, and then take out 2uL for 12% DNA PAGE gel electrophoresis analysis.

[0173] Control group:

[0174] 1. Add 1XNEBuffer containing 20uM P7-2'-O-allyl-T and 40uM P7C (complementary chain of Cy3-labeled P7) TM 1. Heat 20uL of reaction buffer to 95℃ and heat at 95℃ for 5min, then cool to room temperature for half an hour to form double-stranded DNA as a negative control.

[0175] 2. Synthesize the P7 primer that is broken at the 2'-O-allyl-T position by standard solid phase synthesis method, and hybridize it with P7C in the same way as in step 1 as a positive control.

[0176] 2. Take out 2uL of negative control or positive control solution, dilute it 10 times, and then take out 2uL for 12% DNA PAGE gel electrophoresis analysis.

[0177] The experimental conditions of each test sample are shown in Table 1, and the results are shown in Figure 2 As shown: Figure 2 As shown in the gel electrophoresis diagram in , the double-stranded DNA formed by the hybridization of P7-2'-O-allyl-T and P7C migrates the slowest, forming the top band. The excess P7C single-stranded migration speed is the fastest, and the band is at the bottom. The middle band is formed by the broken P7 primer and P7C. Samples 1, 2 and samples 3-8 can all produce middle bands at the same position, indicating that both linearization methods can cut the primers at the specified position. Samples 1 and 2 using the new linearization method of the present invention can achieve 100% RNaseHII cutting efficiency after 1-3 minutes of palladium catalysis. However, the chain cutting efficiency of FPG linearization reagents in different packaging tubes of the same batch fluctuates greatly and is very unstable, and most of them cannot reach 100%.

[0178] Table 1 Experimental conditions for evaluating the efficiency of DNA chain cleavage by linearization reagents

[0179] Runner Experimental samples condition 1 Negative control P7-2'-O-allyl-T+P7C 2 Positive Control Artificially synthesized broken chain P7+P7C 3 Sample 1 P7-2'-O-allyl-T+P7C, palladium catalyst 1 minute+RNase HII 4 Sample 2 P7-2'-O-allyl-T+P7C, palladium catalyst 3 minutes+RNase HII 5 Sample 3 P7-8-oxo-T+P7C, FPG linearization reagent sampling 1, 15 minutes 6 Sample 4 P7-8-oxo-T+P7C, FPG linearization reagent sampling 2, 15 minutes 7 Sample 5 P7-8-oxo-T+P7C, FPG linearization reagent sampling 3, 15 minutes 8 Sample 6 P7-8-oxo-T+P7C, FPG linearization reagent sampling 4, 15 minutes 9 Sample 7 P7-8-oxo-T+P7C, FPG linearization reagent sampling 5, 15 minutes 10 Sample 8 P7-8-oxo-T+P7C, FPG linearization reagent sampling 6, 15 minutes

[0180] Example 3 Application of the new linearization method in sequencing

[0181] The microfluidic chip prepared in Example 1 was equipped on a Salus Pro NGS sequencer. The linearization 2 reagents in the kit equipped with the sequencer were replaced with the palladium catalyst solution and RNase HII solution used in the present invention. The operation was carried out according to the standard NSG sequencing process, except that the reaction conditions for the 2-chain linearization were palladium catalytic cleavage plus RNase HII cleavage conditions.

[0182] In this example, single-end sequencing was performed to directly cut the P7 strand in the surface double-stranded DNA, wherein the difference between the control group and the experimental group was only the linearization 2 reagent and the reaction conditions, and the other steps were the same, and all were operated according to the standard NSG sequencing process.

[0183] Control group: FPG digestion

[0184] 1) According to the standard Salus Pro NGS sequencing process, the Ecoli standard library (Escherichia coli ATCC8739) was denatured and prepared into a 5 pM library loading solution.

[0185] 2) The denatured library loading solution is loaded into the sample tube of the Salus Pro sequencing kit, and the microfluidic sequencing chip containing the P7 primer containing 8-oxo-G prepared in Example 1 is loaded into the designated position of the Salus Pro sequencing system.

[0186] 3) The linearization reagent 2 for cutting P7 in the Salus Pro sequencing kit is set to be a traditional linearization reagent 2 containing FPG enzyme, that is, the Salus Pro sequencing reagent set (PRM-PE150-500M).

[0187] 4) The sequencing process is as follows: hybridize the library and perform surface amplification to obtain the double-stranded DNA cluster to be tested fixed on the chip; do not perform first-strand sequencing (i.e., do not cut the P5 extended chain), and use the traditional linearization reagent 2 containing FPG enzyme to directly cut the P7 extended chain containing 8-oxo-G (cutting conditions are as in Example 2) to perform Read2 single-end 100 rounds of SBS sequencing (R2_SE100).

[0188] 5) The Salus Pro NGS sequencing system can automatically perform base calling based on the base fluorescence signals collected by the sequencer.

[0189] Experimental group: cleavage of RNA nucleosides

[0190] 1) According to the standard Salus Pro NGS sequencing process, the Ecoli standard library (Escherichia coli ATCC8739) was denatured and prepared into a 5 pM library loading solution.

[0191] 2) The denatured library loading solution is loaded into the sample tube of the Salus Pro sequencing kit, and the microfluidic sequencing chip containing the P7 primer (P7-2'-O-allyl-T) prepared in Example 1 and 2'-O-allyl-T is loaded into the designated position of the Salus Pro sequencing system.

[0192] 3) The linearization reagent 2 for cutting P7 in the Salus Pro sequencing kit is set to the novel linearization reagent 2 of the present invention.

[0193] The novel linearization reagent 2 includes a palladium catalyst solution and an RNase HII solution. The palladium catalyst is generated by sodium tetrachloropalladate and a ligand triphenylphosphine trisulfonate (TPPTS) and is used to mediate a deallylation reaction under aqueous conditions compatible with DNA. The composition of the palladium catalyst solution is: 1x Thermopol I reaction buffer (20 mM Tris-HCl, 10 mM (NH 4 ) 4 SO 4, 10 mM KCl, 2 mM MgSO 4 and 0.1% Triton X-100, pH 8.8) containing Na 2 PdCl 4 1.28 mM, P(PhSO 3 Na) 3 9.78mM. RNase HII solution is 1x Thermopol I reaction buffer containing 0.8U / uL RNase HII.

[0194] 4) The sequencing process is as follows: hybridize the library and perform surface amplification to obtain the double-stranded DNA cluster to be tested fixed on the chip; do not perform first-strand sequencing (i.e., do not cut the P5 extended chain), and the new linearization reagent 2 of the present invention directly cuts the P7 extended chain containing 2'-O-allyl-T to perform Read2 single-end 100 rounds of SBS sequencing (R2_SE100).

[0195] The cutting conditions are as follows: 800uL of palladium catalyst solution is passed into the chip and incubated at 60°C for 5 minutes to carry out deallylation reaction, and then 3M Tris-HCl buffer (pH 8.5) is passed and incubated at 60°C for 5 minutes to remove the palladium complex. The chip surface is then washed twice with 3xSSC, then washed twice with 1x Thermopol I reaction buffer, and then 800uL of RNase HII solution is passed and incubated at 37°C for 5 minutes to cut RNA nucleosides, and the chip surface is then washed twice with 3xSSC.

[0196] 5) The Salus Pro NGS sequencing system can automatically perform base calling based on the base fluorescence signals collected by the sequencer.

[0197] Result analysis: The sequencing signal in NGS sequencing can usually reflect the efficiency of double-stranded DNA cleavage in the surface amplification cluster. The higher the cleavage efficiency, the higher the sequencing signal in SBS sequencing. The higher the sequencing signal, the more favorable it is to the accuracy of base recognition, and the better the sequencing quality (Q30 and error rate).

[0198] From Table 2 and Figure 3-Figure 4It can be seen that in the present embodiment, when the experimental group and the control group have similar cluster density (density), Phasing / Prephasing, etc., the sequencing signal (AvgIntensity) of the experimental group is higher than that of the control group, that is, the sequencing signal of the RNA nucleoside cutting is higher. At the same time, from Q30 and error rate, it can be seen that the single-end 100-round sequencing quality of RNA nucleoside cutting in the experimental group is better than that of the traditional FPG enzyme cutting method, with higher sequencing Q30 and lower error rate. It shows that the new linearization method for cutting RNA nucleoside of the present invention can be sequenced and can effectively improve the sequencing quality.

[0199] Table 2 Comparison of SE100 sequencing results of two direct cutting P7 methods

[0200]

[0201] Example 4: Application of the new linearization method in double-end sequencing

[0202] The microfluidic chip prepared in Example 1 was equipped on a Salus Pro NGS sequencer. The linearization 2 reagents in the kit equipped with the sequencer were replaced with the palladium catalyst solution and RNase HII solution used in the present invention. The standard NSG double-end sequencing process was followed, except that the reaction conditions for the 2-chain linearization were palladium catalytic cleavage plus RNase HII cleavage conditions. The principle of the 2-chain linearization is as follows: Figure 5 shown.

[0203] In this example, the P7 chain was cut in PE150 sequencing, wherein the difference between the control group and the experimental group was only the linearization reagent and the reaction conditions, and the other steps were the same, and all were operated according to the standard NSG sequencing process.

[0204] Control group: FPG digestion

[0205] 1) According to the standard Salus Pro NGS sequencing process, the Ecoli standard library (Escherichia coli ATCC8739) was denatured and prepared into a 5 pM library loading solution.

[0206] 2) The denatured library loading solution is loaded into the sample tube of the Salus Pro sequencing kit, and the microfluidic sequencing chip containing the P7 primer containing 8-oxo-G prepared in Example 1 is loaded into the designated position of the Salus Pro sequencing system.

[0207] 3) The linearization reagent 2 for cutting P7 in the Salus Pro sequencing kit is set to be a traditional linearization reagent 2 containing FPG enzyme (same as Example 3).

[0208] 4) Perform PE150 sequencing: hybridize the library and perform surface amplification to obtain the double-stranded DNA cluster to be tested fixed on the chip; first perform 150 rounds of SBS sequencing on the first chain (the linearization method is the standard USER enzyme excision method), and after the second chain is generated, use the traditional linearization reagent 2 containing FPG enzyme to cut the P7 extended chain containing 8-oxo-G (the cutting conditions are as in Example 2) to perform 150 rounds of SBS sequencing on the second chain.

[0209] 5) The Salus Pro NGS sequencing system can automatically perform base calling based on the base fluorescence signals collected by the sequencer.

[0210] Experimental group: cleavage of RNA nucleosides

[0211] 1) According to the standard Salus Pro NGS sequencing process, the Ecoli standard library (Escherichia coli ATCC8739) was denatured and prepared into a 5 pM library loading solution.

[0212] 2) The denatured library loading solution is loaded into the sample tube of the Salus Pro sequencing kit, and the microfluidic sequencing chip containing the P7 primer (P7-2'-O-allyl-T) prepared in Example 1 is loaded into the designated position of the Salus Pro sequencing system.

[0213] 3) The linearization reagent 2 for cutting P7 in the Salus Pro sequencing kit is set to the novel linearization reagent 2 of the present invention (same as Example 3).

[0214] 4) Perform PE150 sequencing: hybridize the library and perform surface amplification to obtain the double-stranded DNA cluster to be tested fixed on the chip; first perform 150 rounds of SBS sequencing on the first chain (the linearization method is the standard USER enzyme excision method), and after the second chain is generated, use the new linearization reagent 2 of the present invention to cut the P7 extended chain containing 2'-O-allyl-T (the cutting conditions are the same as those in Example 3) to perform 150 rounds of SBS sequencing on the second chain.

[0215] 5) The Salus Pro NGS sequencing system can automatically perform base calling based on the base fluorescence signals collected by the sequencer.

[0216] Result analysis: In NGS PE sequencing, the positive strand (first strand, R1) and the reverse strand (second strand, R2) of the double-stranded DNA on the sequencing chip need to be sequenced in one run. The sequencing signal can usually reflect the efficiency of double-stranded DNA cleavage in the surface amplification cluster, and the signal maintenance rate (AvgIntensity_R2 / R1) can reflect the efficiency of cleavage under the same conditions. The higher the cleavage efficiency, the higher the sequencing signal in SBS sequencing. The higher the sequencing signal, the more favorable it is to the accuracy of base recognition, so that the sequencing quality (Q30 and error rate) is also better.

[0217] From Table 3 and Figure 6 and Figure 7 It can be seen that the experimental group and the control group are similar in cluster density (density), Phasing / Prephasing, etc., and the PE150 sequencing quality of the experimental group of this embodiment is better than that of the control group as a whole: the first chain sequencing signal (AvgIntensity_R1) experimental group is equivalent to the control group, and the second chain sequencing signal (AvgIntensity_R2) experimental group is higher than the control group; the PE150 signal maintenance rate (AvgIntensity_R2 / R1) experimental group of this embodiment is 91.89%, which is higher than 85.92% of the control group. The first chain Q30 experimental group is equivalent to the control group, the second chain Q30 experimental group is higher than the control group, the first chain error rate experimental group is equivalent to the control group, and the second chain error rate experimental group is lower than the control group. In summary, thanks to the high efficiency of the RNA nucleoside cutting efficiency of the experimental group, the sequencing quality is better than the traditional FPG enzyme cutting method in the double-end PE150 sequencing, the second chain Q30 is higher, the error rate is lower, and the overall quality is also better. It is explained that the new linearization method for cutting RNA nucleosides provided by the present invention can be used for PE sequencing, and the quality of PE sequencing can be improved.

[0218] Table 3 Comparison of PE150 sequencing results of two P7 cutting methods

[0219]

[0220]

[0221] Example 5: Cleavage stability of P7 chain in PE150 sequencing

[0222] Control group: FPG digestion

[0223] 1000 mL of conventional FPG enzyme linearization reagent 2 (same as Example 3) was prepared at one time, divided into 500 portions and stored in a -20°C refrigerator for 1 month.

[0224] Ten portions of the traditional FPG enzyme linearization reagent 2 frozen for one month were randomly selected as the linearization reagent 2 for cutting P7 in the Salus Pro sequencing kit, and 10 control groups were subjected to parallel PE150 sequencing in the same manner as in Example 4.

[0225] Experimental group: cleavage of RNA nucleosides

[0226] 1000 mL of the novel linearization reagent 2 of the present invention (same as in Examples 3 and 4) was prepared at one time, divided into 500 portions and stored in a -20°C refrigerator for 1 month.

[0227] Ten new linearization reagents 2 frozen for one month were randomly selected as linearization reagents 2 for cutting P7 in the Salus Pro sequencing kit, and 10 experimental groups were subjected to parallel PE150 sequencing in the same manner as in Example 4.

[0228] Results analysis: Table 4 and Figure 8 and Fig. 9 It can be seen that 10 samples were randomly selected from 500 samples of the linearization reagent 2 of the traditional FPG enzyme after being frozen for 1 month for parallel PE150 testing, which was the control group; under the conditions of similar cluster density (density), Phasing / Prephasing, etc., the consistency of the first-strand sequencing signal (AvgIntensity_R1) of the 10 parallel groups of the linearization reagent of the traditional FPG enzyme was good, but the consistency of the second-strand sequencing signal (AvgIntensity_R2) was poor, that is, the signal maintenance rate fluctuated greatly ( Fig.12 ), the relative deviations of parallel groups 5, 7, and 9 were large, which resulted in the second-chain sequencing Q30 being lower than the first-chain, and the sequencing error rate being significantly higher than the first-chain; that is, the traditional FPG enzyme cleavage has poor stability in practical applications.

[0229] From Table 5 and Fig.10 and Fig.11 It can be seen that 10 samples were randomly selected from 500 samples of the novel linearization reagent 2 of the present invention after being frozen for 1 month for parallel PE150 testing, which was the experimental group; under the conditions of similar cluster density (density), Phasing / Prephasing, etc., the consistency of the first-strand sequencing signal (AvgIntensity_R1) and the second-strand sequencing signal (AvgIntensity_R2) of the 10 parallel groups of the novel linearization reagent of the present invention was good, that is, the signal maintenance rate was relatively stable ( Fig.12 ); the Q30 and sequencing error rate of the first and second strands are consistent, and the sequencing quality and stability are very good in practical applications.

[0230] In summary, under the same conditions, the RNA nucleoside cleavage efficiency of the experimental group can maintain high cleavage efficiency in PE sequencing, and has good cryopreservation stability, which can maintain stable sequencing quality in actual PE sequencing applications.

[0231] Table 4 Control group - 10 groups of parallel PE150 sequencing results of linearization reagent 2 of traditional FPG enzyme

[0232]

[0233]

[0234]

[0235] Table 5 Experimental group - 10 sets of parallel PE150 sequencing results of the new linearization reagent 2 for cutting RNA nucleosides

[0236]

[0237]

[0238]

[0239] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A linearization method for NGS sequencing, characterized in that: The steps include: Introducing a single ribonucleoside into a DNA primer, wherein the 2'-OH position of the ribonucleoside is modified with a hydroxyl protecting group; During linearization, the hydroxyl protecting group is removed with a cleavage reagent to expose the 2'-OH of the ribonucleoside; Cutting the phosphodiester bond at the ribonucleoside position results in a break in one strand of the DNA primer; The linearized reaction is as follows: Wherein, R is a hydroxyl protecting group; Base is a heterocyclic base; and the cleavage reagent is a chemical reagent capable of removing the R group in the ribonucleoside.

2. The linearization method for NGS sequencing according to claim 1, characterized in that: R is selected from amino or the following groups: Wherein, R1, R2 and R3 are independently selected from: H, C1-C6 alkyl, C3-C8 cycloalkyl, phenyl-substituted C1-C6 alkyl, halogen-substituted C1-C6 alkyl; R4 is selected from the group consisting of cyanomethyl, azido, nitro, amino, sulfo, carboxyl, halogen, C1-C6 alkoxy, R6 substituted or unsubstituted C6-C 10 Aryl, R6 substituted or unsubstituted 5-10 membered heteroaryl; R5 is selected from the group consisting of C1-C6 alkyl, C3-C8 cycloalkyl, phenyl-substituted C1-C6 alkyl, halogen-substituted C1-C6 alkyl, C1-C6 alkoxy, halogen-substituted C1-C6 alkoxy, C1-C6 alkylthio, C1-C6 alkylamino, R6 substituted or unsubstituted C1-C 10 Aryl, R6 substituted or unsubstituted 5-10 membered heteroaryl; R6 is selected from: C1-C6 alkyl, cyano, azido, nitro, amino, sulfo, carboxyl, halogen, C3-C8 cycloalkyl, phenyl-substituted C1-C6 alkyl, halogen-substituted C1-C6 alkyl, C1-C6 alkoxy, halogen-substituted C1-C6 alkoxy, C1-C6 alkylthio, C1-C6 alkylamino.

3. The linearization method for NGS sequencing according to claim 1, characterized in that: R is selected from amino or the following groups: R1, R2 and R3 are independently selected from: H, methyl, ethyl; R4 is selected from: cyanomethyl, azido, nitro, R6 substituted or unsubstituted C6-C 10 Aryl, R6 substituted or unsubstituted 5-6 membered heteroaryl; R6 is selected from the group consisting of: methyl, ethyl, propyl, cyano, azido, nitro, amino, sulfo, carboxyl, halogen, C3-C6 cycloalkyl, methoxy, ethoxy; Preferably, R is selected from: More preferably, R is allyl.

4. The linearization method for NGS sequencing according to claim 1, characterized in that: Base is selected from the group consisting of adenine, guanine, cytosine, uracil, thymine, methyladenine, 1-methylguanine, isoguanine, 7-methylguanine, methylcytosine, isocytosine, pseudouracil, 5-hydroxymethylcytosine, hypoxanthine, R7-substituted adenine, R7-substituted guanine, R7-substituted cytosine, R7-substituted uracil, and R7-substituted thymine; wherein R7 is selected from the group consisting of H, benzoyl, and benzyloxymethyl.

5. The linearization method for NGS sequencing according to claim 1, characterized in that: R is an allyl group, and the cleavage reagent is a palladium catalyst; Preferably, the palladium catalyst is prepared from sodium tetrachloropalladate and sodium trisulfonate triphenylphosphine, and the ratio of sodium tetrachloropalladate to sodium trisulfonate triphenylphosphine is preferably 1:1-20, more preferably 1:6-9.

6. The linearization method for NGS sequencing according to claim 5, characterized in that: Removing the hydroxyl protecting group with a cleavage agent comprises: incubating the DNA primer with a palladium catalyst solution; Preferably, the palladium catalyst solution is a buffer solution containing Na2PdCl4 and P(PhSO3Na)3.

7. The linearization method for NGS sequencing according to claim 6, characterized in that: The concentration of Na2PdCl4 in the palladium catalyst solution is 0.5mM to 3mM, preferably 1mM to 2mM, and more preferably 1.1mM to 1.5mM; The concentration of P(PhSO3Na)3 in the palladium catalyst solution is 3mM to 27mM, preferably 6mM to 18mM, and more preferably 8mM to 12mM.

8. The linearization method for NGS sequencing according to claim 6, characterized in that: The buffer in the palladium catalyst solution is Thermopol I, Tris, MOPS, HEPES, or TE buffer; and / or, The incubation temperature with the palladium catalyst solution is 40°C to 80°C, preferably 50°C to 70°C, more preferably 55°C to 65°C; and / or, The incubation time with the palladium catalyst solution is 0.1 min to 30 min, preferably 0.5 min to 10 min, and more preferably 1 min to 5 min.

9. The linearization method for NGS sequencing according to any one of claims 1 to 8, characterized in that: Cutting the phosphodiester bond at the ribonucleoside position includes: using RNase to recognize and cut the phosphodiester bond at the ribonucleoside position, or using an alkaline reagent to cut the phosphodiester bond at the ribonucleoside position; the RNase is preferably RNaseHII, RNaseHI or RNaseHIII.

10. The linearization method for NGS sequencing according to claim 9, characterized in that: The method of using RNase to identify and cut the phosphodiester bond at the ribonucleoside position comprises: incubating the DNA primer exposing the 2'-OH of the ribonucleoside with an RNase solution; Preferably, the RNase solution is a buffer solution containing RNaseHII.

11. The linearization method for NGS sequencing according to claim 10, characterized in that: The enzyme activity of the RNaseHII in the RNase solution is 0.1U / uL to 5U / uL, preferably 0.5U / uL to 1.5U / uL, preferably 0.7U / uL to 1.0U / uL; and / or, The buffer in the RNase solution is Thermopol I, Tris, MOPS, HEPES, or TE buffer; and / or, The temperature of incubation with the RNase solution is 35°C to 40°C; and / or, The incubation time with the RNase solution is 0.5 min to 30 min, preferably 1 min to 10 min, and more preferably 3 min to 8 min.

12. An NGS sequencing chip, characterized in that: At least one DNA primer is connected to the surface of the NGS sequencing chip, wherein a single ribonucleoside is introduced into the at least one DNA primer, and the 2'-OH position of the ribonucleoside is modified with a hydroxyl protecting group; A DNA primer incorporating a single ribonucleoside is shown in the following formula (I): wherein R and Base are as described in any one of claims 1-4.

13. The NGS sequencing chip according to claim 12, characterized in that: Two DNA primers are connected to the surface of the NGS sequencing chip, the two DNA primers are P5 primer and P7 primer, a single ribonucleoside is introduced into the P7 primer, and the 2'-OH position of the ribonucleoside is modified with a hydroxyl protecting group; the P5 primer sequence has a dU base modification in the middle; The P7 primer incorporating a single ribonucleoside is shown in the following formula (I):

14. A method for preparing the NGS sequencing chip according to claim 12 or 13, characterized in that: The steps include: The DNA primers are prepared, and at least one DNA primer is as shown in formula (I); The DNA primers are modified onto the surface of the NGS sequencing chip.

15. Use of the linearization method according to any one of claims 1 to 11, or the NGS sequencing chip according to claim 12 or 13 in NGS sequencing; preferably, the NGS sequencing is double-end NGS sequencing.

16. An NGS sequencing method, characterized in that: The steps include: Sample preparation and amplification: preparing a sequencing library from a DNA sample to be tested, hybridizing the sequencing library with the NGS sequencing chip according to claim 12 or 13 and performing surface amplification to obtain a double-stranded DNA cluster to be tested fixed on the surface of the NGS sequencing chip; Linearization: Pass a cutting reagent solution into the NGS sequencing chip and incubate to remove the R group in the DNA primer; then pass an RNase solution or an alkaline reagent and incubate to cut the ribonucleosides to obtain single-stranded DNA fixed on the surface of the NGS sequencing chip; The sequencing primer is combined with the single-stranded DNA fixed on the surface of the NGS sequencing chip to perform SBS sequencing.

17. A double-end NGS sequencing method, characterized in that: The steps include: Sample preparation and amplification: preparing a sequencing library from a DNA sample to be tested, hybridizing the sequencing library with the NGS sequencing chip of claim 13 and performing surface amplification to obtain a double-stranded DNA cluster to be tested fixed on the surface of the NGS sequencing chip; First-strand linearization and sequencing: USER enzyme excision method is used to cut the P5 primer in the first strand to obtain single-stranded DNA fixed on the surface of the NGS sequencing chip. The sequencing primer is combined with the single-stranded DNA fixed on the surface of the NGS sequencing chip to perform first-strand SBS sequencing; Linearization and sequencing of the second strand: Pass a cutting reagent solution into the NGS sequencing chip and incubate to remove the R group in the P7 primer in the second strand; then pass an RNase solution or an alkaline reagent and incubate to cut the ribonucleoside in the P7 primer to obtain single-stranded DNA fixed on the surface of the NGS sequencing chip; The sequencing primer is combined with the single-stranded DNA fixed on the surface of the NGS sequencing chip to perform second-strand SBS sequencing.

18. The NGS sequencing method according to claim 16 or 17, characterized in that: R is an allyl group, and the cleavage reagent is a palladium catalyst; Preferably, the palladium catalyst is prepared from sodium tetrachloropalladate and sodium trisulfonate triphenylphosphine, and the ratio of sodium tetrachloropalladate to sodium trisulfonate triphenylphosphine is preferably 1:1-20, more preferably 1:6-9.

19. The NGS sequencing method according to claim 18, characterized in that: The cutting reagent solution is a buffer solution containing Na2PdCl4 and P(PhSO3Na)3; Preferably, the concentration of Na2PdCl4 in the cutting reagent solution is 0.5mM to 3mM, preferably 1mM to 2mM, more preferably 1.1mM to 1.5mM; Preferably, the concentration of P(PhSO3Na)3 in the cutting reagent solution is 3mM to 27mM, preferably 6mM to 18mM, and more preferably 8mM to 12mM; Preferably, the buffer in the cutting reagent solution is Thermopol I, Tris, MOPS, HEPES, or TE buffer; Preferably, the incubation temperature after the cutting reagent solution is passed is 40°C to 80°C, preferably 50°C to 70°C, more preferably 55°C to 65°C; Preferably, the incubation time after the cutting reagent solution is introduced is 0.1 min to 30 min, preferably 0.5 min to 10 min, and more preferably 1 min to 5 min.

20. The NGS sequencing method according to claim 16 or 17, characterized in that: The RNase is RNase HII, RNase HI or RNase HIII.

21. The NGS sequencing method according to claim 20, characterized in that: The RNase solution is a buffer solution containing RNaseHII; Preferably, the enzyme activity of the RNase HII in the RNase solution is 0.1U / uL to 5U / uL, preferably 0.5U / uL to 1.5U / uL, preferably 0.7U / uL to 1.0U / uL; Preferably, the buffer in the RNase solution is Thermopol I, Tris, MOPS, HEPES, or TE buffer; Preferably, the incubation temperature after the RNase solution is passed is 35°C to 40°C; Preferably, the incubation time after the RNase solution is introduced is 0.5 min to 30 min, preferably 1 min to 10 min, and more preferably 3 min to 8 min.

Images