ANOS1 gene molecular marker related to duck egg yolk ratio and its application
Through PCR amplification and sequencing methods of ANOS1 gene molecular markers and its primer pairs, the problem of difficulty in determining the duck egg yolk ratio is solved, fast and accurate breeding selection is achieved, and breeding efficiency and market adaptability are improved.
Patent Information
- Application Number
- CN202411692536.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-25
- Publication Date
- 2025-07-22
- Estimated Expiration
- 2044-11-25
AI Technical Summary
The prior art is difficult to quickly and accurately determine the duck egg yolk ratio, resulting in low breeding efficiency and high cost.
The ANOS1 gene molecular marker and specific primer pair were used for PCR amplification and Sanger sequencing to detect the duck egg yolk ratio, and the duck egg yolk ratio was determined by the A/A, A/G and G/G polymorphisms of the ANOS1 gene.
The rapid and accurate identification of duck egg yolk ratio is achieved, which improves breeding selection efficiency, meets market demand, and reduces breeding costs.
Smart Images

Figure CN119685485B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to an ANOS1 gene molecular marker related to the duck egg yolk ratio and its application, belonging to the field of biotechnology. Background Art
[0002] Poultry eggs are one of the most easily obtained and favorite foods of humans. They are rich in nutrients and low in price, containing nutrients such as protein, fat, fatty acids, minerals, and vitamins, and are one of the important animal-derived foods for humans. The egg yolk contains rich fat-soluble vitamins A, D, E, K, as well as nutrients such as lutein and zeaxanthin, among which lutein and zeaxanthin are beneficial to eye health. Usually, the yolk ratio of poultry eggs is generally about 30%-33%. Most of the nutritional and health care components in poultry eggs are in the egg yolk. Increasing the yolk ratio is equivalent to increasing the overall nutritional value of poultry eggs. Moreover, when processing mayonnaise, egg yolk powder, egg yolk liquid, etc., poultry eggs with a high yolk ratio are preferred. At the same time, the yolk ratio is also related to the hatching ability of poultry eggs. During the hatching process, the egg yolk provides nutrition for embryo development, and poultry eggs with a larger egg yolk weight often have a higher hatching rate.
[0003] In the production of laying ducks, duck eggs are usually made into various duck egg products, such as salted duck eggs and preserved eggs. The yolk ratio directly affects the quality and taste of the final product. Egg product processing enterprises will select duck eggs with a suitable yolk ratio for egg product processing according to market demand and supply them to the market. The yolk ratio is the abbreviation of the ratio of the yolk weight to the egg weight. The measurement method is to break a part of the eggshell, manually separate the egg white and egg yolk, weigh them, and then calculate. In variety breeding or production, by measuring the yolk ratio of duck eggs produced by laying ducks, female ducks are selected for breeding or production. The cycle is long and it is necessary to wait until the laying ducks start laying eggs and the egg production is stable before measurement and selection can be carried out. Moreover, it is costly. The data obtained from a single measurement is not representative, and accurate data needs to be obtained through multiple measurements before selection and retention. The selection efficiency is low. Under normal circumstances, gonadotropins act on the gonads, promoting the development of the gonads and the secretion of sex hormones, improving the reproductive performance of livestock and poultry. The hypothalamus secretes gonadotropin-releasing hormone (GnRH), and GnRH stimulates the pituitary gland to secrete gonadotropins, including follicle-stimulating hormone (FSH) and luteinizing hormone (LH). The ANOS1 gene, also known as the KAL1 gene, encodes an extracellular matrix protein that regulates the release of GnRH in the hypothalamus, and thus regulates the levels of gonadotropins (FSH and LH) secreted by the pituitary gland. There is currently no relevant report on detecting the duck egg yolk ratio using the ANOS1 gene or technology related to the ANOS1 gene. Summary of the Invention
[0004] The purpose of the present invention is to solve the deficiencies in the prior art and propose an ANOS1 gene molecular marker related to the duck egg yolk ratio and its application, which can quickly and accurately identify the duck egg yolk ratio.
[0005] To achieve the above object, the present invention is realized through the following technical solutions:
[0006] In a first aspect, the present invention provides an ANOS1 gene molecular marker related to the duck egg yolk ratio. The molecular marker is located at the 131855974th base of chromosome 1 of the duck reference genome GCF_015476345.1_ZJU1.0 version. This molecular marker locus has A / A and A / G polymorphisms. The egg yolk ratio of ducks with the A / A genotype at this locus is higher than that of ducks with the A / G genotype.
[0007] The nucleotide sequence of the ANOS1 gene (Anas platyrhynchos domestica) is shown in SEQ ID NO: 3.
[0008] Furthermore, the egg yolk ratio of ducks with the A / G genotype at the locus is higher than that of ducks with the G / G genotype.
[0009] In a second aspect, the present invention provides the application of the above-mentioned molecular marker in detecting the duck egg yolk ratio.
[0010] In a third aspect, the present invention provides a primer pair for detecting the above-mentioned molecular marker, including an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO: 1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 2.
[0011] In a fourth aspect, the present invention provides the application of the above-mentioned primer pair in detecting the duck egg yolk ratio.
[0012] In a fifth aspect, the present invention provides a method for detecting the duck egg yolk ratio, including the following steps:
[0013] Step S1: Use a duck DNA-specific primer pair to perform PCR amplification on the DNA sample of the duck to be tested to obtain an amplification product. The duck DNA-specific primer pair includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO: 1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 2;
[0014] Step S2: Perform Sanger sequencing on the amplification product;
[0015] Step S3: Determine the molecular marker genotype of the target locus according to the sequencing result of Step S2.
[0016] Furthermore, in Step S1, the final concentration of the PCR amplification reaction system is 25 μl, specifically:
[0017]
[0018] The reaction conditions for PCR amplification were as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 40 sec, annealing at 55°C for 40 sec, extension at 72°C for 60 sec, for a total of 40 cycles; extension at 72°C for 2 min; and storage at 20°C.
[0019] Further, the judgment criterion in step S3 was that the egg yolk ratio of ducks with the A / A genotype at the ANOS1 gene SNP locus was higher than that of ducks with the A / G genotype and the G / G genotype, and the egg yolk ratio of ducks with the A / G genotype at the locus was higher than that of ducks with the G / G genotype.
[0020] The present invention has the following beneficial effects: (1) The molecular marker and the molecular marker primer pair provided by the present invention can efficiently and rapidly identify the egg yolk ratio trait of ducks, providing a scientific basis for the early selection of high-quality ducks. In addition, the detection method disclosed by the present invention is simple and easy to operate, can be carried out in a laboratory, and can also be applied to genomic breeding technologies.
[0021] (2) The gene molecular marker in the present invention is used to increase the egg yolk ratio of duck eggs, improve the selection efficiency of female ducks, quickly meet the market requirements for the egg yolk ratio of duck eggs, and improve the production efficiency of enterprises. Description of the Drawings
[0022] Figure 1 is the Manhattan plot of the GWAS analysis of the egg yolk ratio of ducks at 40 weeks of age.
[0023] Figure 2 is the Sanger sequencing result of the PCR amplification products of the three genotypes of the ANOS1 gene.
[0024] Figure 3 is the phenotypic distribution map of individuals with three genotypes of the chr1:131855974 molecular marker.
[0025] SEQ ID NO: 1: GGGCTTATTAGCAACATC
[0026] SEQ ID NO: 2: CAGATTCCTACTGGGTTT
[0027] SEQ ID NO: 3:
[0028] GGGCTTATTAGCAACATCATTAGAAACTGGAGCTGCAAAGTGTGAGAGACAAAGGGAGA
[0029] GCAAAATGAAGCAAAAGGTCTGGGCTGGGCTCGATATGTCTTTGCACACATTCATTGGA
[0030] TCAGGATCTGTATTTCAGTTATCCCCACTCATTTTGGGACACCACATGGATAAAAAGCT
[0031] TGTTTAGGAAGAGAACGAGACAAGTAGACATGCCTTTCTTTTCTTCCACATGCACAACT
[0032] AGATAAAAACCCAGTAGGAATCTG Specific embodiments
[0033] The present invention will be further described below in conjunction with embodiments, but it shall not be used as a basis for limiting the present invention.
[0034] Example 1
[0035] In this example, the egg yolk ratio of Jinding female ducks at 40 weeks of age was measured. SNP genotyping was performed using whole-genome resequencing technology, and ANOS1 gene molecular markers significantly related to the egg yolk ratio were screened through genome-wide association analysis. The results are as Figure 1 shown.
[0036] In this example, the following experiments were conducted to identify and apply the ANOS1 gene molecular markers related to the duck egg yolk ratio
[0037] 1. Phenotypic determination and genotype detection
[0038] (1) Experimental materials and phenotypic determination of egg yolk ratio
[0039] 548 Jinding female ducks were selected as experimental animals and raised under the same feeding conditions, with free diet and water throughout the process. At 40 weeks of age, the egg yolk ratio of the eggs laid by each duck was recorded in sequence as the phenotypic data of the duck egg yolk ratio.
[0040] (2) Extraction of genomic DNA
[0041] Blood was collected from the wing vein of the individuals to be tested, lysed after anticoagulation treatment, digested with proteinase K, extracted by the saturated sodium chloride method, dissolved in TE, and stored at -20 °C.
[0042] (3) PCR amplification
[0043] Using the above-extracted genomic DNA as a template, a fragment containing the SNP molecular marker at the 131855974th base on duck chromosome 1 was amplified.
[0044] Forward primer: 5’-GGGCTTATTAGCAACATC-3’ (SEQ ID NO:1)
[0045] Downstream primer: 5’-CAGATTCCTACTGGGTTT-3’ (SEQ ID NO:2)
[0046] The final concentration of the reaction system (25 μl) is as follows:
[0047]
[0048] The reaction conditions for PCR amplification are as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 40 sec, annealing at 55°C for 40 sec, extension at 72°C for 60 sec, for a total of 40 cycles; extension at 72°C for 2 min; storage at 20°C; 10 μl is taken for agarose detection, and the amplified product with a single target band length of 260 bp of the ANOS1 gene is obtained, and it contains the base at position 131855974 on chromosome 1 of the duck.
[0049] (4) Sequencing verification and genotyping
[0050] The PCR products of each sample are subjected to Sanger sequencing respectively, and the sequencing peak maps are as shown in Figure 2 、 Figure 3 .
[0051] 2. Result analysis
[0052] A total of 511 Jingding female ducks at 40 weeks of age with clear phenotypic records of egg yolk ratio were selected for correlation analysis. The t.test function in R4.0 software was used for statistical testing, and the average comparison mode between pairs was selected to statistically test the genotypes and egg yolk ratios of the experimental duck population. P<0.05 indicates a significant difference, and P<0.01 indicates a highly significant difference. The results are shown in Table 1.1. Among the detected individuals, there are 299 individuals with the A / A genotype of the ANOS1 gene, 108 individuals with the A / G genotype, and 104 individuals with the G / G genotype. The egg yolk ratios of individuals with these three genotypes at 40 weeks of age are highly significantly different (p<0.01). The average egg yolk ratio of individuals with the A / A genotype at 40 weeks of age is 27.11, which is significantly higher than that of individuals with the A / G and G / G genotypes (p<0.01), 1.32 higher than that of individuals with the A / G genotype, and 2.54 higher than that of individuals with the G / G genotype. The average egg yolk ratio of individuals with the A / G genotype is 25.79, which is significantly higher than that of individuals with the G / G genotype (p<0.01), and 1.22 higher than that of individuals with the G / G genotype. The results show that the molecular marker of the duck ANOS1 gene is significantly correlated with the duck egg yolk ratio. According to the actual breeding goal, individuals with the A / A genotype of the ANOS1 gene can be selected to increase the duck egg yolk ratio, or individuals with the G / G genotype of the ANOS1 gene can be selected to decrease the duck egg yolk ratio, improve the overall uniformity of the egg yolk ratio, improve the breeding efficiency, and meet the market demand.
[0053] Table 1 Association analysis of the base molecular marker at position 131855974 on chromosome 1 with egg yolk ratio
[0054] Genotype Number / head Yolk ratio at 40 weeks of age (%) Standard deviation CV A / A 299 <![CDATA[35.11 a > 2.70 2.58% A / G 108 <![CDATA[31.79 b > 1.65 2.53% G / G 104 <![CDATA[28.57 c > 2.73 2.97%
[0055] Note: In the same column of data, the same letter superscript indicates no significant difference, and different letter superscripts indicate significant difference (P < 0.05).
[0056] The above shows and describes the basic principles, main features and advantages of the present invention. However, the above are only specific embodiments of the present invention, and the technical features of the present invention are not limited thereto. Any other embodiments obtained by those skilled in the art without departing from the technical solution of the present invention should be covered within the patent scope of the present invention.
Claims
1. Use of a reagent for detecting ANOS1 gene molecular markers in detecting the duck egg yolk ratio, characterized in that, The molecular marker is located at the 131855974th base of chromosome 1 of the duck reference genome GCF_015476345.1_ZJU1.0 version. This molecular marker locus has polymorphisms of A / A and A / G. The egg yolk ratio of ducks with the A / A genotype at this locus is higher than that of ducks with the A / G genotype.
2. The application according to claim 1, characterized in that The egg yolk ratio of ducks with the A / G genotype at the locus is higher than that of ducks with the G / G genotype.
3. The application according to claim 1, wherein The reagent includes a primer pair, and the primer pair includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is as shown in SEQ ID NO: 1, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO:
2.
4. The application according to claim 1, characterized in that, The detection method includes the following steps: Step S1: Use a duck DNA-specific primer pair to perform PCR amplification on the DNA sample of the duck to be tested to obtain an amplification product. The duck DNA-specific primer pair includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is as shown in SEQ ID NO: 1, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO: 2; Step S2: Perform Sanger sequencing on the amplification product; Step S3: Determine the molecular marker genotype of the target locus according to the sequencing result of Step S2.
5. The application according to claim 4, wherein In Step S1, the final concentration of the reaction system for PCR amplification is calculated as 25 μl, specifically: 50 ng of DNA of the duck to be tested 12.5 μl of 2 x Accurate Taq Master Mix 1 μl of the upstream primer 1 μl of the downstream primer Sterilized water is added to 25 μl. The reaction conditions for PCR amplification are: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 40 sec, annealing at 55°C for 40 sec, extension at 72°C for 60 sec, for a total of 40 cycles; extension at 72°C for 2 min; storage at 20°C.
6. The application according to claim 4, characterized in that The judgment criterion in Step S3 is that the egg yolk ratio of ducks with the A / A genotype at the SNP locus of the ANOS1 gene is higher than that of ducks with the A / G genotype and G / G genotype, and the egg yolk ratio of ducks with the A / G genotype at the locus is higher than that of ducks with the G / G genotype.