SNP loci related to growth traits of golden pomfret and their application

Abstract

The invention discloses a SNP site related to the growth trait of golden pomfret and its application in breeding golden pomfret with excellent growth trait, belonging to the technical field of molecular biology. The invention provides 15 SNP sites, wherein the SNP1 to SNP15 sites are sequentially located at the 399th, 578th, 579th, 603rd, 615th, 727th, 732nd, 1072nd, 1100th, 1101st, 1455th, 1457th, 1482nd, 1521st and 2115th positions of the gene sequence shown in SEQ ID NO.1, and can be used for molecular marker-assisted breeding of golden pomfret to help breed golden pomfret strains with excellent growth traits.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and specifically relates to SNP loci related to the growth traits of Trachinotus ovatus and their applications. Background Art

[0002] Trachinotus ovatus Trachinotus ovatus ), belonging to Osteichthyes Osteichthyes ), Perciformes Perciformes ), Carangidae Carangidae ), Trachinotus Trachinotus ), is mainly distributed in the temperate and tropical waters of countries such as China, Australia, Vietnam, and Japan. It is one of the main seawater aquaculture fish species in China, with the characteristics of adapting to large-scale cage aquaculture, and is an important aquaculture variety for the development of deep-sea fishery. With the long-term artificial aquaculture and the continuous expansion of the aquaculture scale, problems such as the decline in the genetic diversity of the Trachinotus ovatus aquaculture population, the germplasm degradation caused by inbreeding, and the accumulation of unfavorable traits have become increasingly obvious during the long-term high-density artificial aquaculture. During the development process, the lack of good varieties has become a bottleneck restricting the healthy and sustainable development of the Trachinotus ovatus industry, and the cultivation of excellent varieties is one of the effective ways to address the industrial problems.

[0003] Growth is the most important economic trait in aquaculture. Improving the traits related to growth can increase the yield, reduce the cost and time for cultured fish to reach the market size. The traditional breeding methods for Trachinotus ovatus mainly rely on phenotypic selection. However, this method has problems such as a long cycle and low efficiency. With the development of molecular biology technology, finding molecular markers related to growth traits and realizing molecular marker-assisted breeding have become important ways to improve the breeding efficiency and accuracy. In the breeding research of Trachinotus ovatus, although there have been some reports on the association between genes and growth traits in the past, most of them are not systematic and comprehensive enough, the discovered marker loci are limited, and their accuracy and stability need to be improved. In addition, the research on the genes related to the growth traits of Trachinotus ovatus in the existing technology is not deep enough, and the specific association mechanism between the polymorphic loci inside the genes and the growth traits is not clear. This results in a lack of effective molecular marker tools in actual breeding work to accurately screen Trachinotus ovatus individuals with excellent growth traits. Summary of the Invention

[0004] In view of the deficiencies of the existing technology, the present invention proposes a series of SNP loci related to the growth traits of Trachinotus ovatus and their applications.

[0005] The technical solution of the present invention mainly includes the following content:

[0006] Use of SNP loci or reagents for detecting SNP loci in breeding golden pompano with excellent growth traits, including 15 SNP loci from SNP1 to SNP15. The SNP1 to SNP15 loci are sequentially located at positions 399, 578, 579, 603, 615, 727, 732, 1072, 1100, 1101, 1455, 1457, 1482, 1521 and 2115 of the gene sequence shown in SEQ ID NO.1; these loci have polymorphisms of C / A, A / T, G / C, C / T, C / G, A / C, C / G, C / T, T / C, G / A, T / C, T / G, C / T, T / C, G / A in sequence. When the SNP1 to SNP15 loci are homozygous genotypes of C, A, G, C, C, A, C, C, T, G, T, T, C, T, G in sequence, the golden pompano is a strain with excellent growth traits.

[0007] Further, the growth traits include growth rate, body height and body weight.

[0008] Further, the excellent growth trait is a relatively high body height.

[0009] A method for identifying the body height of golden pompano, which identifies the body height of golden pompano by detecting the SNP loci described above. When the SNP1 to SNP15 loci are homozygous genotypes of C, A, G, C, C, A, C, C, T, G, T, T, C, T, G in sequence, the body height of the tested golden pompano is higher than that of individuals with other genotypes.

[0010] A method for cultivating a strain of golden pompano with excellent growth traits, comprising the following steps: taking golden pompano, determining the genotypes of the SNP1 to SNP15 loci by genotyping technology; during the breeding season of golden pompano, selecting parent fish with homozygous genotypes of C, A, G, C, C, A, C, C, T, G, T, T, C, T, G at the SNP1 to SNP15 loci in sequence for mating to obtain golden pompano with excellent growth traits.

[0011] Further, the growth traits include growth rate, body height and body weight.

[0012] Advantages of the present invention:

[0013] The present invention discovers that 15 SNP loci are closely associated with the growth traits of golden pompano. Using the SNP molecular markers provided by the present invention can more accurately screen out individuals with excellent growth traits, which can greatly shorten the breeding cycle, reduce unnecessary breeding and screening processes, and save manpower, material resources and financial resources.

[0014] The proposal of the present invention helps to cultivate golden pompano varieties with better quality and faster growth, and improves the economic benefits of the aquaculture industry. Description of the Drawings

[0015] Figure 1 : Haplotype distribution map of 15 SNP loci. Allele: allele, hap001: hap1 haplotype, hap002: hap2 haplotype.

[0016] Figure 2 : Statistical chart of the distribution of haplotypes Hap1 and Hap2. The vertical axis Body - Heigtht represents body height. Detailed implementation manners

[0017] To better understand the technical content of the present invention, the present invention will be further described below in conjunction with specific embodiments and drawings.

[0018] Example 1 Rapid growth improved variety selection of Trachinotus ovatus based on genome-wide selection

[0019] 1. Construction of reference population and determination of growth traits

[0020] Collect 600 three-year-old Trachinotus ovatus broodstock from different sources in Hainan area. After cultivation and nutritional enhancement, select the broodstock with well-developed gonads for artificial induced spawning to breed offspring individuals. After the offspring individuals are cultivated according to the standard cultivation system, they are the reference population; randomly select 1000 ten-month-old individuals from the reference population, measure their phenotypic traits, including body length, body weight, total length, body height, body thickness, fin length, and conduct statistical analysis on the phenotypic traits. At the same time, cut the caudal fin rays and store them in alcohol for later use.

[0021] 2. Construction of selected population and phenotypic determination

[0022] In the cage culture area of Lingshui, Hainan, select 500 three-year-old Trachinotus ovatus broodstock that are about to reach sexual maturity as the selected population. Collect phenotypic traits of the above individuals, implant an electronic chip into each individual, and at the same time take the caudal fin rays for later use. After completing the above work, disinfect them and conduct conservation and nutritional enhancement according to the broodstock cultivation standard.

[0023] 3. Genotyping of reference population and selected population

[0024] Select 700 individuals for the reference population and 300 individuals for the selected breeding population. Extract the DNA of Trachinotus ovatus using the phenol / chloroform method. After detection by 1% agarose gel electrophoresis, quantify the DNA using Qubit; fragment the DNA, with the fragmentation range around 350 bp; complete the construction of the re-sequencing library using the standard library construction process; after Qubit quantification, sequence the libraries that pass the quality inspection using the Illumina HiSeq XTen platform, with a sequencing depth of 5×. After sequencing is completed, filter the Raw data (raw sequencing data) to obtain Clean data (filtered valid data), use the BWA software to construct a reference sequence index, and align the Clean data to the Trachinotus ovatus reference genome sequence. Use the samtools software to calculate the sequencing depth, coverage rate, and alignment rate; use the GATK software to perform SNP calling (SNP interpretation) on the reference population and the selected breeding population to obtain gene analysis results and generate a vcf file. Use the plink software to perform quality control on the SNP sites, with the quality control conditions being maf > 0.05 and the missing rate < 0.1. After obtaining the high-quality SNP dataset, impute the missing genotypes. Finally, obtain the dataset for GS (genomic selection), including 694 individuals in the reference population, 4,886,850 SNPs, 227 individuals in the selected breeding population, and 2,793,860 SNPs.

[0025] 4. Screening of the number of molecular markers

[0026] Using the growth traits and genotyping data of the reference population, conduct a genome-wide association analysis of growth traits using plink, calculate the P value of each SNP site, and arrange them in ascending order according to the P value; select molecular markers with different densities of 500, 1000, 2000, 5000, 10000, 20000, 30000, 40000, and 50000, and use 7 models including gBLUP, rrBLUP, Bayes A, Bayes B, Bayes C, Bayesian Lasso, and Bayes Ridge Regression to estimate the accuracy of GEBV. When the number of SNPs is 5000, the accuracy of GEBV reaches the highest value.

[0027] 5. Establishment of the best genome-wide breeding model

[0028] Based on the above SNP locus numbers and reference population phenotypic data, seven breeding models, namely gBLUP, rrBLUP, Bayes A, Bayes B, Bayes C, Bayesian Lasso, and Bayes Ridge Regression, were selected and 5-fold cross-validation was used. The method is as follows: ① Randomly divide the experimental population into 5 subgroups with equal numbers; ② Take 4 of them and combine (retaining phenotypes and genotypes) as the reference population, and the remaining 1 group (with phenotypes set as missing) as the candidate population; ③ The reference population is used to estimate the marker effect values, and then based on this, the GEBV of the candidate population is predicted; ④ Each subgroup is used as the candidate population once, and repeat step ①, that is, repeat the breeding value estimation 5 times; ⑤ Calculate the Pearson correlation coefficient (i.e., prediction ability) between the GEBV and the phenotypic value. Five sets of prediction results will be obtained for each trait, and finally the mean value of the prediction accuracy is used as the evaluation index of the prediction model. The prediction results are Bayesian Lasso < Bayes B < Bayes C < Bayes Ridge Regression < Bayes A < rrBLUP < gBLUP. Among the BLUP algorithms, the gBLUP model has the highest accuracy, and among the Bayesian algorithms, the Bayes A model has the highest accuracy.

[0029] 6. Estimation of GEBV of the selected breeding population

[0030] According to the best breeding model and the number of molecular markers selected from the reference population, using the genotyping data of the selected breeding population, estimate the GEBV of the selected breeding population, perform normalization processing, arrange them according to the estimated values, and at the same time perform correction using the polygenic risk score.

[0031] 7. Cultivation of the first-generation offspring. According to the GEBV values in the selected breeding population, select the individuals with the top GEBV values in the selected breeding population as parents to breed the first-generation offspring at a 5% selection intensity, and cultivate the first-generation offspring with excellent growth traits according to the commercial fish farming technical system, and compare them with the unselected control population to evaluate their growth performance. The growth trait test at 6 months of age shows that the growth rate of the first-generation offspring individuals is 17.6% higher than that of the selected individuals, and the first-generation offspring shows good growth traits.

[0032] Example 2

[0033] Furthermore, we performed a genome-wide association analysis on the body height (BH) trait of golden pompano because this trait has a significant impact on growth.

[0034] The results showed a strong association between body height and chromosome 6 (Chr06), with 77 SNPs exceeding the significance threshold (P-value = 1e-5). A total of 11 significant regions containing protein-coding genes were identified, and gene function annotation indicated that multiple genes were closely related to growth and development. In addition, linkage disequilibrium (LD) analysis based on peak sites revealed a strong linkage pattern in the region of 19.92 - 19.97 Mb. Notably, a gene from the serine protease family was found in this linkage region and was homologously annotated as granzyme E (gzme). A mutation site in the third exon (Chr06:19952318, G / A) led to a nonsense mutation, and the genotype AA at this site was significantly higher than GG and was associated with the genotype CC. The nonsense mutation might cause premature termination of translation, severely affecting the normal function of the protein. Therefore, we selected the gzme gene as a candidate gene for further gene haplotype analysis. Through SNPs from the exon of the gzme gene, 686 individuals were divided into two haplotype groups. The results showed that the hap1 haplotype was significantly superior to other haplotypes in terms of phenotypic distribution.

[0035] The gzme gene sequence (SEQ ID NO.1):

[0036] TTGTCTTTGTTTTTGGTTTAATTGATGTTCAAACAGAGAAGTGTACAGAGGCACTGAGAGAACATAGTGACAGAGCAACAGTTTATTGTTTCAAAATATGAAACAAAACAAACTTGTCTAAAGGAGGATGCACAAAGCAGTAACATGTTTAATATATGCAATGCTGTATTTAGGAGCATAGGACAGATTGTCTCTAACATCAATGGATTACACCTATTGAGACAGCATTGAGTCTATGATTACATTTCTGATTTCAAGCCATACCTCATGAGTGGTTTGTTTGAAGGTTTAAATTATCAAATGTTAAACATGTTTCATAATGTTATTGATCCACTTCCTGTACTCAGGAATTTTGGTATAGGAATAGATTTTTTTTGACGGTCCATTTTTTGCGGCGG CCACCACACCATACGCCTTTCCATCTTCACAGACCAACGGACCACCAGAGTCTCCCTGGAAGTATATACACATTTTGCAGTGATTGCTTCAGCAACAGTTATTTAATTATCATTGTTGATGAGAATGTGTTTTTATTTATTATGTTTCATAAATAATACATACCTTACCTGGTCCAGTC AG TCCCTCAGAGCAGTACAACTTAT C CTTGGCACACT C CTCATTGCAAATGAGTGTTATGTTGACTTCCATGAGTGTTGAAGTCATATATTTACTGTGTCTGTTGCTGCTTCCCCAGCCAGACACTGTACATGATTTTGGCAGAGAGTC A TCAT C TTGGTCTGCGAGAGCAATGGGACTCACATTATGGTTGAGATGTGCCTTGGTCTTCAACTTGAGGAAAAAAGAGAGAGATTCAAAAAATACAGATATGAAGCTAACATATCAATTCACATATATATTCACATTTGTCCAGTGTTCACATTTGCTTGTTGTCTAAGACATTTCCTGCTCACATGTTGTATTTCAACAAAGAATTGAATGTAAATAATGTTATGAGAAAAAAAAATAGGACAAAAATAGACAAAAGTGAGTTTTTACAGTTCACTGCAGTGATTTTCCTACCTTAAGAAGCATTATGTCATTTTTAAATGTAGCTGGATCGTAGTCTCCATG C GGAAATTTGTTTTCCACAGATACACGC TGTATGTCATTACTGTTACTGAAATTGTGAAGTCCTAGTAAGACTGTGTAGGACCTGAAATGACAACATTTAATGTAGAGAGTTATATGGGAGTAAACAGATTTCTGGTAAGAGCATTGGGTTCCAAAAATAAAGATGTTAAAAGACTATTATTTATGTCACAGTTTATGAAAACATCATGAAGCACATCTGCCAGCGTCAATACATGAGTCTAGGCTGTTGTTGGGTTAAGAAATCTCATCATAGGCACCAGAATAACTAATACATAAACATAAAGTGTGTTAAACTTACTCAGCTTCACAGTGGGCTGCAGTCATCACAAAATCCTTATTCAGAAGGAAGCCACCACAGTATG T T T TTTTGCCATCCTTCATGTGCTGCT C CAAAAGCACCATGTACGGCCTGCTATGTGGCACAGCCT TGTGGCCTCCATAGATTTCTCCTGCGTACACTGGGGAAAACAGTTAATGCTGAAACTGCTTTTGAGAGGTTTGGATTCTACATTATTCTCATTTACTCTTGTTACTGTTACAAAGTAGTTTTTTGTGTACTTGTCAATTTTGGAGTATTTCTAAAAATCAGTCATTTCATGCACACATCAGTATTTTTTAACTCGGCTGTCAGCTGCAGCTGCTCTGCAGTTTATGTTGTTTAGAAATCTTCACCTTTTCTGCTGCTTTTTTCTGCTGTCAATTCTATTAGAAGTGACAGCTATTTGATTTATATAGCTTAACATTGCTACACATTTCAGGACACCAGCCATGTTGTTGTAATTATCAGCCATATGCACAGGCTGCAAAGTGCCTGACTGGGTTTGATGACTTACATGTCTGCATGTATGTCTGGTAGCCTAAACATCCTTCATAATTTAATAGTTTGTCACATATTATTATTGTTTTTACCATATAATTTTAACACACACACACATACACATGTCTAAGTATATGCACAATATATTTAAACTTACCTTGACCATCAAGAGTCAGTGCAAGCATCAATATGACCAGCTTACAGT G GAAAAACATGACGAGATCACAGTCCAGCTGAGCTACTGAAGAACAGTGGTACACATCACTGACAAGTTCAGTCTTTAAATGTGTCAGAGAGAGAAGGAAGTG

[0037] Among them, the underlined positions are SNP positions, with a total of 15 SNPs. From top to bottom, they are: 19951616, 19951795, 19951796, 19951820, 19951832, 19951944, 19951949, 19952289, 19952317, 19952318, 19952672, 19952674, 19952699, 19952738, 19953332.

[0038] Example 3 Breeding Method of Golden Pompano Strains with Excellent Growth Traits

[0039] Take golden pompano and determine the genotypes of the above 15 SNP loci in golden pompano through genotyping technology. During the breeding season of golden pompano, select broodstock with excellent genotypes (i.e., the homozygous genotypes of SNP1 to SNP15 are C, A, G, C, C, A, C, C, T, G, T, T, C, T, G in sequence) for mating. The offspring fish hatched are superior to the offspring fish of ordinary mating combinations in terms of growth rate, body height, and weight gain.

[0040] The above are only partial embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall fall within the protection scope of the present invention.

Claims

1. Use of a reagent for detecting SNP sites in breeding golden pomfret with excellent growth traits, characterized in that: The invention comprises 15 SNP sites, namely SNP1 to SNP15, wherein the SNP1 to SNP15 sites are located at positions 399, 578, 579, 603, 615, 727, 732, 1072, 1100, 1101, 1455, 1457, 1482, 1521 and 2115 of the gene sequence shown in SEQ ID NO.1 in sequence; when the bases of the SNP1 to SNP15 sites are homozygous genotypes of C, A, G, C, C, A, C, C, T, G, T, T, C, T, and G in sequence, the golden pomfret is a strain with excellent growth traits; and the growth trait is body height.

2. The use according to claim 1, characterized in that: The excellent growth trait is high body height.

3. A method for identifying the height of golden pomfret, characterized in that: The height of golden pomfret is identified by detecting the SNP sites described in claim 1. When the bases of sites SNP1 to SNP15 are homozygous genotypes of C, A, G, C, C, A, C, C, T, G, T, T, C, T, and G in sequence, the height of the golden pomfret to be tested is higher than that of individuals with other genotypes.

4. A method for breeding a golden pomfret strain having excellent growth traits, characterized in that: The following steps are involved: Take golden pomfret, and determine the genotype of the SNP1-SNP15 sites described in claim 1 by genotyping technology; select broodstock with homozygous genotypes of the bases of the SNP1-SNP15 sites being C, A, G, C, C, A, C, C, T, G, T, T, C, T, G in sequence for mating, and obtain golden pomfret with excellent growth traits; the growth trait is body height.

Images