InDel molecular marker of BcAPX6 gene as well as primer and application of InDel molecular marker

Abstract

The invention provides an InDel molecular marker of a BcAPX6 gene as well as primers and application of the InDel molecular marker. An upstream primer of a sequence of the InDel molecular marker is CTCCTCTCTCTGAGAGTAGAC; the downstream primer is GTTAAAGAAGAAGAAGAGTGGC, and the downstream primer is GTTAAAGAAGAAGAAGGGGC; 39 parts of non-heading Chinese cabbage germplasm are used for verifying the molecular marker. The APX6Indel can be used for assistant breeding of genes and identification of the ascorbic acid content of the non-heading Chinese cabbage, so that field screening work is reduced, the breeding cost is reduced, the breeding process is accelerated, and the APX6Indel has very high practical value. The method is beneficial to establishment of a marker-assisted breeding system for the high ascorbic acid content of the non-heading Chinese cabbages, and can be simply and quickly applied to breeding practice of the non-heading Chinese cabbages with high throughput.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular assisted breeding of non-heading cabbage, and specifically relates to a BcAPX6 gene InDel molecular marker for assisting selection of ascorbic acid content in non-heading cabbage, a primer thereof and an application thereof. Background Art

[0002] Ascorbic acid (L-Ascorbic acid, AsA), also known as vitamin C, is one of the important members of the vitamin family and an indispensable nutrient for maintaining human health. Lack of AsA will lead to decreased human immunity, decreased detoxification function of the human body, dry and dull skin, etc., and severe deficiency will cause scurvy. However, humans cannot synthesize AsA by themselves and mainly rely on vegetables, fruits and other foods to obtain it. Non-heading cabbage is a popular vegetable widely planted and cultivated in the middle and lower reaches of the Yangtze River in China. Due to its rich germplasm resources, short growth cycle, high yield per unit area, and easy cultivation, it occupies an important share of the market economy. AsA is an important nutrient in non-heading cabbage, and cultivating varieties with high AsA content is one of the breeding goals of non-heading cabbage. Molecular marker-assisted breeding is an important means in molecular biological breeding now, which has the characteristics of high efficiency and accuracy. Therefore, the development of molecular markers related to AsA content is of great significance to the breeding of high-quality non-heading cabbage.

[0003] Ascorbate peroxidase (APX) gene is a key enzyme in the ascorbate-glutathione cycle (AsA-GSH). When plants face abiotic stress, APX can oxidize AsA to generate dehydroascorbic acid and H2O, and GR reduces oxidized glutathione (GSSG) to GSH and dehydroascorbic acid to AsA. At present, it has been shown in plants such as Arabidopsis, cherry, and soybean that APX activity is significantly increased under adverse conditions and shows a high degree of specificity for ascorbic acid. The changes in ascorbic acid content in transgenic tomato leaves and fruits are consistent with the changes in APX gene activity, with APX activity decreasing and AsA content increasing.

[0004] At present, in the breeding process of non-heading cabbage with high ascorbic acid content, the ascorbic acid content needs to be determined by cultivating seedlings, which takes a long time and is costly. A detection method that can be used to quickly identify the ascorbic acid content of non-heading cabbage at the seed stage has not yet been developed. Summary of the invention

[0005] In order to solve the above technical problems existing in the prior art, the present invention takes non-heading cabbage as the research object, detects the allelic variation of the BcAPX6 gene based on the resequencing of various varieties of non-heading cabbage, and develops the Indel molecular marker of BcAPX6 using the variation; the molecular marker is verified using 39 core germplasms of non-heading cabbage. The molecular marker obtained by the present invention can be used for gene-assisted breeding, and the ascorbic acid content of non-heading cabbage is identified, thereby reducing field screening work, reducing breeding costs, and accelerating the breeding process, which has high practical value.

[0006] The technical method of the present invention is as follows:

[0007] The first object of the present invention is to provide an InDel molecular marker, wherein the InDel molecular marker is a 198 bp DNA fragment molecule with a nucleotide sequence as shown in SEQ ID No.3 and / or a 201 bp DNA fragment molecule as shown in SEQ ID No.4.

[0008] SEQ ID No.3:

[0009] CTCCTTCTCTGAGAGTAGACTCCAATAATCCTATTGGCTAAAACGTTTCCTTACTATACGCTTATGCGTAGAATAAAACCTCCCGAATACATTAAAAAACAGTCTGCCGCTCGGTGATTCTCGTCCCACCGTTAAAGATGACGACGACGACTACTGCGTCTCTGTTTTCTCGGTGCCACTCTTCTTCTTCTTTTAAAC

[0010] SEQ ID No.4:

[0011] CTCCTTCTCTGAGAGTAGACTCCAATAATCCTATTGGCTAAAACGTTTCCTTACTATACGCTTATGCGTAGAATAAAACCTCCCGAATACATTAAAAAAACTCAGTCTGCCGCTCGGTGATTCTCGTCCCACCGTTAAAGATGACGACGACGACTACTGCGTCTCTGTTTTCTCGGTGCCACTCTTCTTCTTCTTTTAAAC

[0012] The second object of the present invention is to provide a specific primer pair, which consists of primer BcAPX6indel-F and primer BcAPX6indel-R;

[0013] The primer BcAPX6indel-F is a single-stranded DNA molecule shown in SEQ ID NO.1 of the sequence table: CTCCTCTCTCTGAGAGTAGAC;

[0014] The primer BcAPX6indel-R is a single-stranded DNA molecule shown in SEQ ID NO.2 in the sequence table: GTTTAAAGAAGAAGAAGAGTGGC.

[0015] The third object of the present invention is to provide a kit for detecting the aforementioned InDel molecular markers.

[0016] The present invention also provides a kit containing the above-mentioned specific primer pair.

[0017] A fourth object of the present invention is to provide a method for identifying or assisting in identifying the ascorbic acid content of non-heading Chinese cabbage, comprising the following steps:

[0018] Using the genomic DNA of the non-heading cabbage to be tested as a template, PCR amplification is performed using the aforementioned specific primer pair. If the amplified product contains the 198 bp DNA fragment shown in SEQ ID No. 3 and does not contain the 201 bp DNA fragment of SEQ ID No. 4, the non-heading cabbage to be tested is a non-heading cabbage with a low ascorbic acid content;

[0019] If the amplified product contains the 201 bp DNA fragment shown in SEQ ID No. 4 and does not contain the 198 bp DNA fragment of SEQ ID No. 3, the non-heading Chinese cabbage to be tested is a non-heading Chinese cabbage with a high ascorbic acid content;

[0020] If the amplified product contains both the 198 bp DNA fragment shown in SEQ ID No. 3 and the 201 bp DNA fragment shown in SEQ ID No. 4, the non-heading cabbage to be tested is non-heading cabbage with low ascorbic acid content.

[0021] The fourth object of the present invention is to provide the use of the aforementioned InDel molecular marker or the aforementioned specific primer pair or the aforementioned kit in identifying or assisting in identifying the ascorbic acid content of non-heading Chinese cabbage.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The invention discloses an InDel molecular marker for regulating the ascorbic acid content gene of non-heading Chinese cabbage, and designs a pair of specific primers according to the molecular marker, wherein the primers can generate specific markers of high ascorbic acid content materials and specific markers of low ascorbic acid content materials, and have good repeatability and strong specificity. The InDel molecular marker is applied to identify the ascorbic acid content, and the quality of non-heading Chinese cabbage can be quickly identified at the seedling stage, and can be simply, quickly and high-throughput applied to the breeding practice of non-heading Chinese cabbage.

[0024] The advantages of the present invention are:

[0025] (1) The InDel molecular marker in the present invention can reflect the ascorbic acid content of non-heading cabbage, and the primer of the InDel molecular marker has strong specificity and high stability;

[0026] (2) The method of the present invention can quickly select non-heading cabbages with high ascorbic acid content at the seedling stage, thereby improving the selection efficiency;

[0027] (3) The present invention is conducive to the establishment of a marker-assisted breeding system for non-heading cabbage with high ascorbic acid content, and can be applied to the breeding practice of non-heading cabbage in a simple, rapid and high-throughput manner. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Genotyping of InDel molecular markers of APX6 gene;

[0029] Figure 2 Ascorbic acid content of 39 core collections of different genotypes. DETAILED DESCRIPTION

[0030] The present invention is further explained below with reference to the examples, but the examples do not limit the present invention in any form.

[0031] The experimental methods in the following examples are all conventional methods unless otherwise specified. The experimental materials used in the following examples are all purchased from conventional biochemical reagent stores unless otherwise specified.

[0032] The primers were prepared by Beijing Qingke Biotechnology Co., Ltd. The non-heading cabbage varieties used in the following examples were all from the Cabbage Systems Biology Laboratory of the College of Horticulture, Nanjing Agricultural University.

[0033] Example 1

[0034] Step 1, according to the sites provided by resequencing, whole genome resequencing was performed on the inbred lines Wutacai and Erqing and 127 recombinant inbred lines obtained by selfing for multiple generations after hybridization. The 127 recombinant inbred lines were planted in Nanjing, Huzhou and Jurong for three years and their ascorbic acid content was determined. 21 QTL sites were obtained by QTL positioning, among which a gene APX6 related to the ascorbic acid cycle was found at the AsAA03.2 site on the A03 linkage group. The expression levels of this gene in Wutacai and Erqing were significantly different. At the same time, an InDel molecular marker was found in the upstream promoter region of the gene. The marker had a three-base (ACT) deletion in the promoter region of the APX6 gene of Erqing, and the site was located in the 31459561bp region of chromosome A03 of non-heading cabbage.

[0035] Step 2, design specific primers 100 bp away from the InDel site. The upstream primer of the APX6indel sequence is BcAPX6indel-F: CTCCTCTCTCTGAGAGTAGAC; the downstream primer is BcAPX6indel-R: GTTTAAAGAAGAAGAAGAGTGGC. PCR amplification is performed using the genomic DNA of non-heading cabbage as a template. The length of the amplified fragment is about 201 bp. The DNA will not change due to the environment and growth cycle and is relatively stable. The PCR amplification product is genotyped by polyacrylamide gel electrophoresis. The difference in electrophoresis bands can be used to distinguish genotypes. The long fragment of 201 bp is recorded as In, the short fragment of 198 bp is recorded as Del, and the fragment containing both long and short fragments is recorded as H( Figure 1 ).

[0036] The reaction system for PCR amplification is 10ul, including:

[0037] (1) 1 μL of the forward amplification primer shown in SEQ ID No. 1 at a concentration of 10 μmol / L;

[0038] (2) 1 μL of the reverse amplification primer shown in SEQ ID No. 2 at a concentration of 10 μmol / L;

[0039] (3) 1 μL of DNA template at a concentration of 50 ng / μL;

[0040] (4) 5 μL 2×Taq PCR

[0041] (5) 2 μL ddH2O.

[0042] The procedure for PCR amplification is as follows:

[0043] (1) Pre-denaturation at 95°C for 5 min;

[0044] (2) Denaturation at 95°C for 15 seconds,

[0045] (3) Annealing at 57°C for 15 seconds,

[0046] (4) extension at 72°C for 20 s, 30 cycles;

[0047] (5) 72°C extension for 5 min;

[0048] (6) Store at 4℃.

[0049] Step 3, genotyping and association analysis of the InDel molecular marker of the BcAPX6 gene were performed in 39 non-heading cabbage germplasms (Table 1). The results verified that among the 39 non-heading cabbage germplasms, 19 were detected as In gene bands, with an average AsA content of 105.47 mg / 100 g; 13 were Del genotypes, with an average AsA content of 57.88 mg / 100 g; 7 were detected as H genotypes with two bands, with an average ascorbic acid content of 60.19 mg / 100 g, indicating that the In genotype variety is a plant with a high ascorbic acid content, the Del genotype is a plant with a low ascorbic acid content, and the H genotype is a plant with a low ascorbic acid content; and the test results of the present invention correspond to the actual conditions of each variety, with high accuracy ( Figure 2 Ascorbic acid is easily affected by the environment. The samples for measuring ascorbic acid content in this implementation plan came from different cultivation areas. Some strains were subjected to adverse stress in certain environments, and the ascorbic acid content increased. Figure 2 The ascorbic acid content of some plants of the In genotype was higher than that of the Del type, but it still did not exceed the maximum ascorbic acid content value of the Del plants.

[0050] The significant difference analysis (P<0.001) showed significant difference. The person correlation analysis of marker genotype and AsA content phenotype showed that the correlation between ASA content and marker gene was 0.74, which was significantly correlated at the 0.01 level.

[0051] Table 1 Summary of 39 non-heading cabbage germplasms

[0052]

[0053] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. InDel molecular marker, characterized in that: The InDel molecular marker is a 198 bp DNA fragment with a nucleotide sequence as shown in SEQ ID No.3 and / or a 201 bp DNA fragment as shown in SEQ ID No.4: SEQ ID No.3: CTCCTTCTCTGAGAGTAGACTCCAATAATCCTATTGGCTAAAACGTTTCCTTACTATACGCTTATGCGTAGAATAAAACCTCCCGAATACATTAAAAAACAGTCTGCCGCTCGGTGATTCTCGTCCCACCGTTAAAGATGACGACGACGACTACTGCGTCTCTGTTTTCTCGGTGCCACTCTTCTTCTTCTTTTAAAC; SEQ ID No.4: CTCCTTCTCTGAGAGTAGACTCCAATAATCCTATTGGCTAAAACGTTTCCTTACTATACGCTTATGCGTAGAATAAAACCTCCCGAATACATTAAAAAAACTCAGTTCTGCCGCTCGGTGATTCTCGTCCCACCGTTAAAGATGACGACGACGACTACTGCGTCTCTGTTTTCTCGGTGCCACTCTTCTTCTTCTTTTAAAC.

2. A specific primer pair, characterized in that: The specific primer pair consists of primer BcAPX6indel-F and primer BcAPX6indel-R; The primer BcAPX6indel-F is a single-stranded DNA molecule shown in SEQ ID NO.1 of the sequence table: CTCCTCTCTCTGAGAGTAGAC; The primer BcAPX6indel-R is a single-stranded DNA molecule shown in SEQ ID NO.2 in the sequence table: GTTTAAAGAAGAAGAAGAGTGGC.

3. A kit for detecting the InDel molecular marker according to claim 1.

4. A kit comprising the specific primer pair according to claim 2.

5. A method for identifying or assisting in identifying the ascorbic acid content of non-heading Chinese cabbage, characterized in that: The steps include: Using the genomic DNA of the non-heading cabbage to be tested as a template, PCR amplification is performed using the specific primer pair described in claim 2. If the amplified product contains the 198 bp DNA fragment shown in SEQ ID No. 3 and does not contain the 201 bp DNA fragment shown in SEQ ID No. 4, the non-heading cabbage to be tested is a non-heading cabbage with a low ascorbic acid content; If the amplified product contains the 201 bp DNA fragment shown in SEQ ID No. 4 and does not contain the 198 bp DNA fragment of SEQ ID No. 3, the non-heading Chinese cabbage to be tested is a non-heading Chinese cabbage with a high ascorbic acid content; If the amplified product contains both the 198 bp DNA fragment shown in SEQ ID No. 3 and the 201 bp DNA fragment shown in SEQ ID No. 4, the non-heading cabbage to be tested is a non-heading cabbage with a low ascorbic acid content.

6. Use of the InDel molecular marker according to claim 1, the specific primer pair according to claim 2, or the kit according to claim 3 or claim 4 in identifying or assisting in identifying the ascorbic acid content of non-heading Chinese cabbage.

Images