InDel molecular markers, primers and their applications for identifying the coffee variety 'Reyan 2'

Through the PCR amplification method of InDel molecular markers and primers, the problem of difficult identification of the "Reyan No. 2" coffee variety was solved, its accurate identification and brand protection were achieved, and the healthy development of the coffee industry was promoted.

CN119685514BActive Publication Date: 2025-09-23SPICE & BEVERAGE RES INST CHINESE ACAD OF TROPICAL AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411932974.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-26
Publication Date
2025-09-23
Estimated Expiration
2044-12-26

AI Technical Summary

Technical Problem

Existing technology makes it difficult to effectively identify the 'Reyan No. 2' coffee variety, resulting in the phenomenon of inferior products being passed off as good ones and counterfeit products in the market, affecting the healthy development of the coffee industry.

Method used

InDel molecular markers and specific primers were used for PCR amplification, and coffee genomic DNA was detected by agarose gel electrophoresis. The polymorphism of InDel primers at Chr8c 46060432_46060977 on the coffee genome chromosome was used to distinguish the 'Reyan 2' coffee variety from other varieties.

Benefits of technology

It has achieved accurate identification of the 'Reyan No. 2' coffee variety, provided brand protection, ensured the identity of the coffee variety, and promoted the healthy development of the coffee industry.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119685514B_ABST
    Figure CN119685514B_ABST
Patent Text Reader

Abstract

The present invention provides an InDel molecular marker, primers, and applications thereof for identifying the 'Reyan 2' coffee variety, belonging to the technical field of coffee variety identification. The InDel molecular marker used to identify the 'Reyan 2' coffee variety is located on chromosome Chr8c 46060432_46060977 of the coffee genome; the primers are shown in SEQ ID NOs. 1 and 2. When the primers provided herein amplify 'Reyan 2' coffee genomic DNA, three amplified bands appear at positions 387 bp, 460 bp, and 689 bp, which are significantly different from the banding patterns of other coffee varieties. This demonstrates that the primers provided herein can accurately identify the 'Reyan 2' coffee variety, which is of great significance for the protection and utilization of this coffee resource.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of coffee variety identification, and in particular to InDel molecular markers, primers and applications thereof for identifying the 'Reyan No. 2' coffee variety. Background Art

[0002] Coffee (Coffea spp.), considered one of the world's three most popular beverage plants, is a perennial evergreen shrub or small tree in the Rubiaceae family. Its unique flavor and rich biological functions have made it widely favored by consumers. Hainan, the birthplace of large-scale coffee cultivation in my country, possesses unique geographical and climatic conditions for the development of specialty coffee. After years of development, it has developed distinctive national geographical indication products such as "Xinglong Coffee" and "Fushan Coffee." In 2020, "Xinglong Coffee" was selected as one of the first 100 Chinese products protected by the European Union with geographical indications. Currently, Hainan cultivates 20,000 mu (approximately 16,000 mu) of medium-grain coffee, producing 1,900 tons of coffee beans and 8,000 tons of processed coffee products annually, with an annual output value of 1.44 billion yuan. This has created prominent coffee-producing regions such as Chengmai, Wanning, Baisha, and Qiongzhong. Cultivating high-quality coffee varieties suited to Hainan's regional characteristics is a prerequisite for the development of Hainan's specialty coffee industry.

[0003] 'Reyan No. 2' coffee is the primary medium-grained coffee variety cultivated in Hainan Province. Developed by the Spice and Beverage Research Institute of the Chinese Academy of Tropical Agricultural Sciences, it passed tropical crop variety approval in 2013. This variety has short, open-bottomed plants. It blooms early, matures early, and matures in a concentrated period, with the fruit developing over a 300-330-day period. The fruit is oval, with a 100-bean weight of 16.2g. After budding and planting, seedlings begin to produce a small amount of fruit in the second year, with full production in the third year and peak production in the fourth and fifth years. The average annual yield is 4.19 kg of fresh fruit per plant, with a fresh-to-dry fruit ratio of 4.39:1, equivalent to an annual dry bean yield of 0.96 kg per plant, or 106 kg per mu. Green coffee beans contain 19.22% protein, 5.92% fat, 11.68% total sugars, 4.57% reducing sugars, 4.73% total ash, and 2.4% caffeine. Cultivation and production practices in many places have proved that this variety has strong resistance to rust and has extremely high economic value and promotion and application value.

[0004] Reyan No. 2 coffee boasts excellent quality, a high price, and a high return. However, during marketing and sales, its finished product is difficult to distinguish from other varieties due to its appearance. Furthermore, lack of varietal identification technology for Reyan No. 2 coffee has made it difficult to establish brand identity and protection. Consequently, inferior products are often passed off as genuine products, and misbranding is common. Therefore, establishing varietal identification technology for Reyan No. 2 coffee is urgently needed to establish a clear identity for the coffee variety, which is crucial for promoting the healthy development of Hainan's coffee industry. Summary of the Invention

[0005] The purpose of the present invention is to provide InDel primers for identifying the 'Reyan 2' coffee variety and applications thereof, so as to achieve identification of coffee varieties.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides an InDel molecular marker for identifying the 'Reyan 2' coffee variety. The InDel molecular marker is located at Chr8c 46060432_46060977 of the coffee genome chromosome.

[0008] The present invention also provides InDel primers for identifying the 'Reyan 2' coffee variety, wherein the InDel primers are shown as SEQ ID NO.1 and SEQ ID NO.2.

[0009] The present invention also provides the use of the InDel primer in identifying the 'Reyan No. 2' coffee variety.

[0010] The present invention also provides the use of the InDel primers in preparing a kit for identifying the 'Reyan No. 2' coffee variety.

[0011] The present invention also provides a kit for identifying the 'Reyan No. 2' coffee variety, comprising the InDel primers.

[0012] The present invention also provides a method for identifying the 'Reyan No. 2' coffee variety, comprising the following steps:

[0013] S1. Extracting genomic DNA from coffee samples;

[0014] S2. Using the genomic DNA of the coffee sample to be tested as a template, PCR amplification is performed using the InDel primers to obtain a PCR product;

[0015] S3. Perform electrophoresis on the PCR product. If the band pattern of the sample to be tested is consistent with the band of the 'Reyan No. 2' coffee variety, the sample to be tested is determined to be the 'Reyan No. 2' coffee variety.

[0016] Preferably, when PCR amplification is performed using the InDel primers, if fragments of 387 bp, 460 bp, and 689 bp are amplified, it indicates that the coffee sample to be tested is 'Reyan No. 2' coffee.

[0017] Preferably, the PCR amplification reaction system is 10 μL, including 1 μL of genomic DNA of the coffee sample to be tested, 0.5 μL of upstream and downstream primers, 5 μL of 2×TaqPCR premix reagent II, and 3 μL of ddH2O.

[0018] Preferably, the reaction procedure of the PCR amplification is: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 20 s, annealing at 68°C for 20 s, extension at 72°C for 30 s, with the annealing temperature decreasing by 2°C in each cycle, for a total of 6 cycles; denaturation at 94°C for 20 s, annealing at 58°C for 20 s, extension at 72°C for 30 s, with the annealing temperature decreasing by 1°C in each cycle, for a total of 8 cycles; denaturation at 94°C for 20 s, annealing at 50°C for 20 s, extension at 72°C for 30 s, for a total of 20 cycles; final extension at 72°C for 5 min.

[0019] Preferably, the initial concentrations of the upstream and downstream primers are 8 to 12 μM, respectively.

[0020] By employing the above-described technical solution, the present invention has the following beneficial effects: the InDel molecular marker for identifying the 'Reyan 2' coffee variety is located on chromosome Chr8c46060432_46060977 of the coffee genome; the primers are shown in SEQ ID NOs. 1 and 2. When the primers provided by the present invention are used to amplify 'Reyan 2' coffee genomic DNA, three amplified bands appear at 387 bp, 460 bp, and 689 bp, which are significantly different from the banding patterns of other coffee varieties. This demonstrates that the primers provided by the present invention can accurately identify the 'Reyan 2' coffee variety, which is of great significance for the protection and utilization of this coffee resource. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the electrophoresis diagram of INDEL marker polymorphism detection of Reyan 2 coffee variety.

[0022] Figure 2 This is the agarose gel electrophoresis diagram of 51 samples of 'Reyan No. 2' coffee and other medium-grain coffee varieties. DETAILED DESCRIPTION

[0023] The present invention provides an InDel molecular marker for identifying the 'Reyan 2' coffee variety. The InDel molecular marker is located at Chr8c 46060432_46060977 of the coffee genome chromosome.

[0024] The present invention also provides InDel primers for identifying the 'Reyan 2' coffee variety, wherein the InDel primers are shown as SEQ ID NO.1 and SEQ ID NO.2:

[0025] SEQ ID NO.1: GTCTTCTAAAAATCATTATACA;

[0026] SEQ ID NO. 2: GGTACATACCTAAAACTGTCACTA.

[0027] The present invention also provides the use of the InDel primer in identifying the 'Reyan No. 2' coffee variety.

[0028] The present invention also provides a kit for identifying the 'Reyan No. 2' coffee variety, comprising the InDel primers.

[0029] The present invention also provides a method for identifying the 'Reyan No. 2' coffee variety, comprising the following steps:

[0030] S1. Extracting genomic DNA from coffee samples;

[0031] S2. Using the genomic DNA of the coffee sample to be tested as a template, PCR amplification is performed using the InDel primers to obtain a PCR product;

[0032] S3. Perform electrophoresis on the PCR product. If the band pattern of the sample to be tested is consistent with the band of the 'Reyan No. 2' coffee variety, the sample to be tested is determined to be the 'Reyan No. 2' coffee variety.

[0033] The present invention first extracts genomic DNA from a coffee sample to be tested, preferably from leaves of coffee plants. The method for extracting genomic DNA from coffee leaves is not particularly limited; conventional methods for extracting genomic DNA in the art can be used. PCR amplification is then performed using the genomic DNA of the coffee sample to be tested as a template and the described InDel primers to obtain a PCR product. The PCR amplification reaction system is 10 μL, comprising 1 μL of genomic DNA from the coffee sample to be tested, 0.5 μL of each of the 10 μM upstream and downstream primers, 5 μL of 2× TaqPCR premix II, and 3 μL of ddH2O. The PCR amplification reaction procedure was as follows: initial denaturation at 95°C for 5 minutes; denaturation at 94°C for 20 seconds, annealing at 68°C for 20 seconds, and extension at 72°C for 30 seconds, with the annealing temperature decreasing by 2°C each cycle, for a total of 6 cycles; denaturation at 94°C for 20 seconds, annealing at 58°C for 20 seconds, and extension at 72°C for 30 seconds, with the annealing temperature decreasing by 1°C each cycle, for a total of 8 cycles; denaturation at 94°C for 20 seconds, annealing at 50°C for 20 seconds, and extension at 72°C for 30 seconds, for a total of 20 cycles; and a final extension at 72°C for 5 minutes. PCR amplification products were analyzed by 2% agarose gel electrophoresis at 120 V for 25 minutes. If the banding pattern of the sample was consistent with that of the 'Reyan 2' coffee variety, the sample was identified as the 'Reyan 2' coffee variety.

[0034] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0035] Example 1. Design and synthesis of primers

[0036] Acquisition of molecular marker primers: First, based on the second generation sequencing technology, 19 coffee varieties (Reyan 2, RY4, RY3, 4-1, 33-1, 26-1, 29-3, 30-1, 18-2, 20-1, 31-4, 31-2, 28-1, 33-5, 33-4, ZLKF, 24, 24-10, 24-11) were constructed and resequenced. Then, bioinformatics software was used to mine specific InDel sites, and 10 pairs of InDel markers with large deletions or insertions were screened. The primer information is shown in Table 1. Polymorphism detection was performed on these markers ( Figure 1 ), ultimately obtaining a pair of polymorphic InDel markers (Chr8c_46060432_46060977). Primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0037] Table 1 InDel marker details and primers

[0038]

[0039]

[0040] Example 2. Identification of the coffee variety 'Reyan No. 2'

[0041] A total of 51 leaf samples of the coffee variety 'Reyan No. 2' and other medium-grain coffee varieties were collected from the National Tropical Spice Beverage Crop Germplasm Resource Garden. The varieties are shown in Table 1:

[0042] Table 1 Varieties of coffee samples tested

[0043]

[0044]

[0045] The genomic DNA of the coffee leaf samples was extracted using the CTAB method, and PCR amplification was performed using SEQ ID NO.1 and SEQ ID NO.2, respectively:

[0046] SEQ ID NO.1: GTCTTCTAAAAATCATTATACA;

[0047] SEQ ID NO. 2: GGTACATACCTAAAACTGTCACTA.

[0048] The PCR system was as follows: 1 μL of sample DNA, 0.5 μL each of 10 μM InDel upstream and downstream primers, 5 μL of 2×Taq PCR Mix, and 3 μL of ddH2O, for a total of 10 μL.

[0049] The PCR amplification program was as follows: initial denaturation at 95°C for 5 minutes; denaturation at 94°C for 20 seconds, annealing at 68°C for 20 seconds, and extension at 72°C for 30 seconds, with the annealing temperature decreasing by 2°C each cycle, for a total of 6 cycles; denaturation at 94°C for 20 seconds, annealing at 58°C for 20 seconds, and extension at 72°C for 30 seconds, with the annealing temperature decreasing by 1°C each cycle, for a total of 8 cycles; denaturation at 94°C for 20 seconds, annealing at 50°C for 20 seconds, and extension at 72°C for 30 seconds, for a total of 20 cycles; and a final extension at 72°C for 5 minutes. The amplified products of the 'Reyan 2' coffee variety PCR are shown in SEQ ID NOs. 21 to 23, respectively.

[0050] SEQ ID NO.21:

[0051] GTCTTCTAAAAATCCATTATACAAAGAAAAATTGTTCTGCTACACAAGACATTGTGCCTATTAACGCAGCTGGAGCAAAACAAATCGGTAATCTACTAATATTTTTCTCATGTTACCATAATTAATATTTCTTGCTATATGTTCTTGGGCATACAATTATTATGTGCTTTATACTTTTCCCATGTTACCATAAT TAATATTTCTTGCTACATGTCCTGGGGCATACAAATGTTATGAGCTTCATACTTTGCTTAATTCTTCTCACATATTATCTCTTGCTATATGTCCTGGTATATGCTCATGTTATGAGCTTTATACCTTTCTTAAAACGACACTTTTAGGGATGTACCTAGGTATGTACCATAGTGACAGTTTTAGGTATGTACC.

[0052] SEQ ID NO.22:

[0053] GTCTTCTAAAAATCCATTATACAACTCCTGAGAATTGTTCTGCTACACAGACATTGTGCCTATTAACGCAGCTGGAGCAAAACAAATCGGTAATCTACTAATATTTTTCTCATGTTACCATAATTAATATTTCTTGCTATATGTTCTTGGGCATACAATTATTATGTGCTTTATACTTTTCTCATGTTATCATAATTAATACCATAATTAATATTTCTTGCTACATGTTTTTGGGCATACAAATATTATGTGCTTTATACTTTTCTCAATTTTTCATAATTAATATTTCTTGCTATATGTTCTTGGGCATACAAATATTATGTGCTTTATACTTTTCTTATATTTACATAATAAATATTTCTTGATATATATATTCTTGGGCATACAAATATTATGTGCTTTATACCTTTCATATAGTGACAGTTTTAGGTATGTACCTAGTGACAGTTTTAGGTATGTACC.

[0054] SEQ ID NO.23:

[0055] .

[0056] After PCR amplification, band detection was performed using 2% agarose gel electrophoresis with the electrophoresis condition set at 120V for 25min. Figure 2 shown. Figure 2 The results of agarose analysis of 51 samples of Reyan 2 coffee and other medium-grain coffee varieties in this example are shown. Sample 5 is the Reyan 2 coffee variety, and three bands appear at 387 bp, 460 bp, and 689 bp, respectively. The banding patterns of the other varieties differ from those of Reyan 2, indicating that the primers of this application can effectively distinguish the Reyan 2 coffee variety.

[0057] As demonstrated in the above examples, the present invention provides InDel molecular markers, primers, and applications for identifying the 'Reyan 2' coffee variety. Using these primers in PCR amplification of test samples directly yields identification results. This method offers high accuracy, high throughput, and low cost, effectively protecting the brand of the 'Reyan 2' coffee variety.

[0058] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. InDel primers for identifying the Reyan 2 coffee variety, characterized in that: The InDel primers are shown as SEQ ID NO.1 and SEQ ID NO.

2.

2. Use of the InDel primer according to claim 1 in identifying the Reyan No. 2 coffee variety.

3. Use of the InDel primer according to claim 1 in preparing a kit for identifying the Reyan No. 2 coffee variety.

4. A kit for identifying the Reyan No. 2 coffee variety, characterized in that: Comprising the InDel primer according to claim 1.

5. A method for identifying the Reyan No. 2 coffee variety, characterized in that: The following steps are involved: S1. Extracting genomic DNA from coffee samples; S2. Using the genomic DNA of the coffee sample to be tested as a template, PCR amplification is performed using the InDel primers described in claim 1 to obtain a PCR product; S3. Perform electrophoresis on the PCR product. If the band pattern of the sample to be tested is consistent with the band of the Reyan No. 2 coffee variety, the sample to be tested is determined to be the Reyan No. 2 coffee variety.

6. The method according to claim 5, characterized in that PCR amplification was performed using the InDel primers. If fragments of 387 bp, 460 bp, and 689 bp were amplified, it indicated that the coffee sample to be tested was Reyan No. 2 coffee.

7. The method according to claim 5, characterized in that The PCR amplification reaction system was 10 μL, including 1 μL of genomic DNA of the coffee sample to be tested, 0.5 μL of each of the upstream and downstream primers, 5 μL of 2×Taq PCR premix reagent II, and 3 μL of ddH2O.

8. The method according to claim 5, characterized in that The PCR amplification reaction program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 20 s, annealing at 68°C for 20 s, and extension at 72°C for 30 s, with the annealing temperature decreasing by 2°C in each cycle, for a total of 6 cycles; denaturation at 94°C for 20 s, annealing at 58°C for 20 s, and extension at 72°C for 30 s, with the annealing temperature decreasing by 1°C in each cycle, for a total of 8 cycles; denaturation at 94°C for 20 s, annealing at 50°C for 20 s, and extension at 72°C for 30 s, for a total of 20 cycles; and final extension at 72°C for 5 min.

9. The method according to claim 7, characterized in that The initial concentrations of the upstream and downstream primers were 8-12 μM, respectively.

Citation Information

Patent Citations

  • Method for verifying coffee germplasm resources

    CN103740840A

  • Method for identifying coffee germplasm resource by using ISSR (inter-simple sequence repeat) fingerprint chromatography

    CN105063223A