Molecular marker related to yellow leaves of Chinese cabbage and application of molecular marker

Abstract

The invention belongs to the technical field of crop molecular marker assisted breeding, and particularly relates to a molecular marker related to yellow leaves of Chinese cabbage and application of the molecular marker. The molecular marker is a molecular marker in a yellow leaf gene BrYL1, the site of the molecular marker is located at the 70th site from the 5'end on SEQ ID NO.1 shown in a nucleotide sequence table, and the original basic group C is deleted at the 6557852nd site from the 5 'end on a BrapaChiifuV3.0 reference gene A066 chromosome. Results of embodiments show that the molecular marker is closely linked with a leaf color gene, green and yellow leaf Chinese cabbage materials can be accurately and efficiently distinguished by using the molecular marker (BrYL1-FunK1), and the leaf color breeding efficiency can be greatly improved when the molecular marker is used for breeding new leaf color varieties of Chinese cabbages.

Description

Technical Field

[0001] The invention belongs to the technical field of crop molecular marker-assisted breeding, and particularly relates to a molecular marker related to yellow leaves of Chinese cabbage and an application thereof. Background Art

[0002] Leaves are the main tissues for photosynthesis and respiration in plants, which directly affect the yield and quality of crops. Chloroplasts are the main organs for photosynthesis, and chlorophyll is the main pigment for photosynthesis. Mutations in genes related to chlorophyll synthesis and metabolism and genes related to chloroplast development will cause leaf color mutations to varying degrees. Cabbage crops (Brassica rapa L.) belong to the genus Brassica in the family Cruciferae, including Chinese cabbage (B.rapa.pekinensis), Chinese cabbage (B.rapa.chinensis), turnip (B.rapa.rapifera), and Chinese cabbage (B.rapa.chinensis var.utilis Tsen et Lee) and many other leafy vegetables. Since consumers in different places like cabbage vegetables of different colors, leaf color is an important commercial trait of cabbage vegetables and an important breeding target. By finding molecular markers closely linked to leaf color genes, molecular marker-assisted selection breeding can greatly improve the efficiency of leaf color breeding.

[0003] KASP (Kompetitive Allele Specific PCR) can accurately judge SNPs or InDels widely present in genomic DNA and can detect a large number of samples at the same time. It is a high-throughput, economical and effective SNP typing technology. Therefore, screening out SNPs related to leaf color traits and further developing them into KASP markers suitable for high-throughput and high-efficiency detection and applying them to the selection of yellow leaf materials of cabbage is of great significance to improving cabbage yield and quality.

[0004] Therefore, there is an urgent need to provide a new molecular marker for the detection of Chinese cabbage leaf color traits or molecular marker-assisted breeding. Summary of the invention

[0005] The purpose of the present invention is to provide a molecular marker related to yellow leaves of Chinese cabbage. The molecular marker provided by the present invention can not only accurately and efficiently distinguish Chinese cabbage materials with green and yellow leaves, but also can be used for the breeding of new varieties of Chinese cabbage leaf color, which can greatly improve the leaf color breeding efficiency.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] The invention provides a molecular marker related to leaf color traits of Chinese cabbage. The molecular marker is located at the 70th position from the 5' end on SEQ ID NO.1 as shown in the nucleotide sequence table, corresponding to the 6557852nd position from the 5' end on the A066 chromosome of the Brapa_Chiifu_V3.0 reference genome, in which the original base C is deleted.

[0008] Preferably, the growth trait is the leaf color of Chinese cabbage, including yellow and green.

[0009] The present invention also provides a primer pair for detecting the above-mentioned molecular marker, the primer pair comprising three primers BrYL1-funK1Fa, BrYL1-funK1Fb and BrYL1-funK1R; the nucleotide sequence of the BrYL1-funK1Fa is shown in the sequence table SEQ ID NO.3; the nucleotide sequence of the BrYL1-funK1Fb is shown in the sequence table SEQ ID NO.4; the nucleotide sequence of the BrYL1-funK1R is shown in the sequence table SEQ ID NO.5.

[0010] Preferably, the BrYL1-funK1Fa is a specific primer for the green leaf genotype; the BrYL1-funK1Fb is a specific primer for the yellow leaf genotype; and BrYL1-funK1R is a common reverse primer.

[0011] More preferably, the 5' ends of the primers BrYL1-funK1Fa and BrYL1-funK1Fb are added with FAM and HEX fluorescent sequences, respectively.

[0012] The present invention also provides a method for detecting Chinese cabbage leaf color traits, which comprises detecting the above molecular markers.

[0013] Preferably, the detection method may be polyacrylamide gel electrophoresis, competitive allele-specific PCR, fluorescent labeling capillary electrophoresis or sequencing, preferably competitive allele-specific PCR.

[0014] Preferably, the detection method comprises the following steps: using the primer pair to amplify the nucleotide sequence of the molecular marker site to obtain an amplification product, performing fluorescence quantification on the amplification product, reading the fluorescence signal and analyzing the typing result.

[0015] The present invention also provides the use of a molecular marker in the Chinese cabbage BrYL1 gene in detecting the leaf color trait of the Chinese cabbage, wherein the molecular marker is the above-mentioned molecular marker.

[0016] The present invention also provides the use of a specific primer pair of a molecular marker related to the leaf color trait of Chinese cabbage in Chinese cabbage breeding. The molecular marker related to the leaf color trait of Chinese cabbage is the above molecular marker; and the specific primer pair is the above primer pair.

[0017] Beneficial effects of the present invention:

[0018] The invention relates to a SNP marker A06-6557852 related to the yellow leaf gene BrYL1 of Chinese cabbage, and designs a detection primer BrYL1-funK1 for detecting the marker. The SNP marker and its detection primer BrYL1-funK1 can accurately and efficiently detect green leaf and yellow leaf material types. The screening method is not affected by environmental factors, can greatly reduce the workload of field selection, and is helpful to assist and accelerate the breeding of Chinese cabbage leaf color. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0020] Figure 1 The BSA-Seq positioning result of the leaf color gene BrYL1, the plotting window is 1Mb, the step length is 50kb, the yellow line is the 95% confidence interval, the blue line is the 99% confidence interval, and the positioning interval is the candidate region on chromosome A06 (6.20-7.25Mb);

[0021] Figure 2 This is the KASP genotyping result of the F2 population;

[0022] Figure 3 This is the KASP genotyping result of natural population. DETAILED DESCRIPTION

[0023] The invention provides a molecular marker associated with yellow leaves of Chinese cabbage. The molecular marker is an InDel molecular marker in a yellow leaf gene BrYL1. The site of the molecular marker is located at the 70th position from the 5' end on SEQ ID NO.1 as shown in a nucleotide sequence table, and the original base C is deleted at the 655785th position from the 5' end on the chromosome of Brapa_Chiifu_V3.0 reference gene A066.

[0024] The present invention also provides a method for detecting Chinese cabbage leaf color traits, comprising detecting the above molecular markers. The detection method of the present invention can be polyacrylamide gel electrophoresis, competitive allele-specific PCR, fluorescent labeling capillary electrophoresis or sequencing, preferably competitive allele-specific PCR.

[0025] The nucleotide sequence of the SNP molecular marker of the present invention is: TACCTGTTATAGCAGATGGA GGGATATCAAACTCAGGTCACATTGTGAAGGCTCTAGTCCTTGGAGCAT CAACTGTGATGATGGGAAGCTTCTTAGCTGGAAGCACTGAGGCTCCTG GTGCTTACGAATATCGAGTAAT (SEQ ID NO. 1).

[0026] The nucleotide sequence A06-6557852 of the yellow leaf material of the present invention is: TACCTGTTATAG CAGATGGAGGGATATCAAACTCAGGTCACATTGTGAAGGCTCTAGTCC TTGGAGCATAACTGTGATGATGGGAAGCTTCTTAGCTGGAAGCACTGA GGCTCCTGGTGCTTACGAATATCGAGTAAT (SEQ ID NO. 2)

[0027] In order to detect the above molecular markers, the present invention designed a KASP-labeled BrYL1-funK1 primer pair, including three primers:

[0028] BrYL1-funK1Fa:5'- GAAGGTGACCAAGTTCATGCT CTCTAGTCCTTG GAGCATC-3'(SEQ IDNO.3);

[0029] BrYL1-funK1Fb:5'- GAAGGTCGGAGTCAACGGATT GGCTCTAGTCCTTGGAGCATAA-3'(SEQID NO.4);

[0030] BrYL1-funK1R: 5'-CAGTGCTTTCCAGCTAAGAAGCTTCC-3' (SEQ ID NO. 5).

[0031] BrYL1-funK1Fa and BrYL1-funK1Fb are two allele-specific forward primers, BrYL1-funK1Fa is a specific primer for the green leaf genotype, and BrYL1-funK1Fb is a specific primer for the yellow leaf genotype; the 5' ends of the BrYL1-funK1Fa and BrYL1-funK1Fb primers are respectively added with FAM and HEX tag sequences, and the tag sequences are complementary to the fluorescent signal sequence. BrYL1-funK1R is a common reverse primer.

[0032] The embodiment of the present invention shows that the SNP molecular marker BrYL1-funK1 primer pair has good versatility and accuracy, and can be used for molecular marker-assisted selection of yellow leaf traits of Chinese cabbage.

[0033] The Chiifu_V3.0 reference genome of the present invention is a genome version of the Chinese cabbage (Brassica rapa) variety Chiifu.

[0034] DH materials usually refer to plant materials obtained through doubled haploid (DH) technology. Homozygous diploid plant materials obtained through haploid breeding technology. Doubled haploid technology is a method to accelerate the breeding process. It can obtain homozygous plants within one generation, thus greatly shortening the breeding cycle.

[0035] The CTAB method is a commonly used DNA extraction method, which uses cetyltrimethylammonium bromide (CTAB) as a cationic detergent to extract nucleic acids.

[0036] BSA-Seq (Bulked Segregant Analysis Sequencing) technology is a gene localization method that combines the traditional BSA (Bulked Segregant Analysis) method with high-throughput sequencing technology. It is mainly used to quickly locate genes or quantitative trait loci (QTLs) associated with specific phenotypes.

[0037] Clean reads refer to high-quality sequence reads obtained after quality control and filtering in high-throughput sequencing data. In the process of sequencing data analysis, raw sequencing data (rawreads) often contain some low-quality sequence reads, which may affect the accuracy and reliability of subsequent analysis due to sequencing errors, adapter contamination, repeated sequences, etc. Therefore, it is a very important step to preprocess the raw data, remove low-quality reads, and obtain cleanreads.

[0038] △SNP-index (Delta SNP-index) is an indicator used to quantify the difference in SNP (single nucleotide polymorphism) frequency between two bulks in BSA (Bulk Segregant Analysis) analysis. In BSA analysis, two or more bulks are usually constructed, each containing a mixture of DNA from individuals with similar phenotypes. By comparing the differences in SNP frequencies between these bulks, genes or quantitative trait loci (QTLs) associated with specific phenotypes can be located.

[0039] Candidate genes are genes that are known to have specific biological functions and sequences and may be involved in the development of specific traits. These genes may directly affect the expression of traits or indirectly affect traits by regulating the expression of other genes.

[0040] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0041] The production processes, experimental methods or detection methods involved in the embodiments of the present invention, unless otherwise specified, are all conventional methods in the prior art, and their names and / or abbreviations are all conventional names in the field, and are very clear and unambiguous in the relevant application fields. Technical personnel in the field can understand the conventional process steps based on the names and apply the corresponding equipment, and implement them according to conventional conditions or the conditions recommended by the manufacturer.

[0042] The various instruments, equipment, raw materials or reagents used in the embodiments of the present invention are not particularly limited in terms of their sources, and are all conventional products that can be purchased through regular commercial channels, or can be prepared according to conventional methods well known to those skilled in the art.

[0043] Example 1 Development of KASP molecular markers for gene BrYL1

[0044] 1.1 Extraction of leaf color gene BrYL1

[0045] The green DH material R16-11 (P1) and the yellow material Y706-1 (P2) of Chinese cabbage were selected as parents, and the two materials were hybridized to obtain F1 generation seeds, and the F1 material was self-pollinated to obtain F2 generation seeds. All materials were planted in the Henan Modern Agriculture Research and Development Base, and the fields were uniformly managed. The leaf color of each plant was investigated during the seedling stage of all materials.

[0046] Through the investigation of offspring phenotypes, it was found that in the F1 population, all plants had green leaves. In the F2 population, the phenotype was separated. In the small F2 population, the number of plants with green leaves and yellow leaves was 168 and 52, respectively, which met the separation ratio of 3:1 by the chi-square test. In the large F2 population, the number of plants with green leaves and yellow leaves was 2716 and 944, respectively, which met the separation ratio of 3:1 by the chi-square test.

[0047] The results are shown in Table 1, indicating that the yellow leaf phenotype of Y706-1 is controlled by a recessive single gene, and the leaf color gene was named BrYL1.

[0048] Table 1 Separation of green and yellow plants in Chinese cabbage parents and their offspring

[0049]

[0050] 1.2. Extraction of genomic DNA

[0051] The modified CTAB method was used to extract genomic DNA from the two parents, F1 and F2. The specific steps are as follows.

[0052] Take an appropriate amount of fresh leaves, place them in a 2.0 mL centrifuge tube, add a 5 mm diameter steel ball, then add 1000 μL 2% CTAB extraction buffer. Place the centrifuge tube in a tissue disruptor (model: German Retsch MM400) and disrupt at a frequency of 30 times / second for 1 min.

[0053] Place the crushed sample in a 65℃ warm bath for 1 hour, and shake it up and down 2-3 times during this period. After cooling, add 500μL of chloroform, shake it up and down thoroughly, and then centrifuge it at 12000r / min for 10min. Pipette 500μL of supernatant, transfer it to a new 1.5mL centrifuge tube, add 500μL of isopropanol that has been pre-ice-bathed, mix thoroughly and ice-bath for 30min, then centrifuge it at 12000r / min for 5min. Discard the supernatant, add 1000μL of 75% ethanol to wash the DNA precipitate, centrifuge it again at 12000r / min for 2min, and discard the supernatant. Dry the DNA precipitate at room temperature, add 100μL of ddH2O to dissolve the DNA, and store the dissolved DNA in a -20℃ refrigerator for later use.

[0054] 1.3 Mapping the cabbage yellow leaf gene BrYL1

[0055] Thirty green leaf materials and 30 yellow leaf materials were screened from the F2 population to construct a green leaf pool (G-pool) and a yellow leaf pool (Y-pool), respectively. The whole genome of the two mixed pools was resequenced using BSA-Seq technology.

[0056] The clean reads were aligned with the Chinese cabbage Chiifu genome sequence (V3.0) using BWA software, and the variant site information was obtained using Samtools software. Then, the △SNP-index between the green leaf pool and the yellow leaf pool was calculated, and the distribution of the candidate gene BrYL1 on the genome was determined by sliding window analysis with 1Mb as the drawing window and 50kb as the step length. Figure 1 As shown, the yellow leaf gene BrYL1 was located in the 6.20-7.25Mb interval of chromosome A06, with a length of 1.05Mb.

[0057] 1.4 Development of KASP molecular markers for the yellow leaf gene BrYL1

[0058] The candidate gene of the yellow leaf gene BrYL1 of cabbage was determined by gene mapping method. The candidate gene was sequenced and aligned, and it was found that there was a SNP deletion C / - at the 6557852bp position of chromosome A066 (Brapa_Chiifu_V3.0 reference gene). As shown below, at the 70bp position, the base in the green leaf material is C, and this base is missing in the yellow leaf material. This variation is called SNP marker A06-6557852.

[0059] TACCTGTTATAGCAGATGGAGGGATATCAAACTCAGGTCACATTGTGAAGGCTCTAGTCCTTGGAGCAT[C / -]AACTGTGATGATGGGAAGCTTC TTAGCTGGAAGCACTGAGGCTCCTGGTGCTTACGAATATCGAGTAAT

[0060] The KASP marker BrYL1-funK1 was designed for this SNP marker A06-6557852, including three primers:

[0061] BrYL1-funK1Fa: 5'-GAAGGTGACCAAGTTCATGCTCTCTAGTCCTTG GAGCATC-3' (SEQ IDNO.3);

[0062] BrYL1-funK1Fb: 5'-GAAGGTCGGAGTCAACGGATTGGCTCTAGTCC TTGGAGCATAA-3' (SEQ ID NO. 4);

[0063] BrYL1-funK1R: 5'-CAGTGCTTTCCAGCTAAGAAGCTTCC-3' (SEQ ID NO. 5).

[0064] BrYL1-funK1Fa and BrYL1-funK1Fb are two allele-specific forward primers, BrYL1-funK1Fa is a specific primer for the green leaf genotype, BrYL1-funK1Fb is a specific primer for the yellow leaf genotype, and the 5' ends of BrYL1-funK1Fa and BrYL1-funK1Fb are added with FAM and HEX tag sequences, respectively. BrYL1-funK1R is a common reverse primer.

[0065] The KASP-PCR reaction was carried out in a 96-well PCR instrument. The reaction system was 8 μL: 1.5 μL DNA (80 ng / μL), 4 μL KASP Master mix (2×), 0.14 μL primer mixture (obtained by mixing BrYL1-funK1Fa, BrYL1-funK1b, BrYL1-funK1R at a concentration of 100 μmol / L and ddH2O in a volume ratio of 12:12:30:46), and the rest was filled with ddH2O.

[0066] The KASP-PCR amplification program was as follows: the first stage was denaturation at 94°C for 15 min; the second stage was denaturation at 94°C for 20 s and annealing at 61°C for 60 s, for a total of 10 cycles (starting from the second cycle, the temperature was reduced by 0.6°C each cycle); the third stage was denaturation at 94°C for 20 s and annealing at 55°C for 60 s, for a total of 26 cycles; the fourth stage was 37°C for 1 min.

[0067] The KASP-PCR amplification product was read using the Roche fluorescent quantitative PCR instrument LightCycler 480Instrument II (LC480II) for endpoint fluorescence signal reading. The SNP typing results were analyzed using LC480 software v1.5.1: Figure 2 As shown, the signal point of the homozygous green material is blue, and the primer with the FAM fluorescent label sequence connected to the 5' end is competitively amplified and aggregated near the X axis; the signal point of the homozygous yellow material is green, and the primer with the HEX fluorescent label sequence connected to the 5' end is competitively amplified and aggregated near the Y axis; the signal point of the heterozygous green material is red, and aggregated near the diagonal line. The BrYL1-funK1 marker can significantly distinguish the two homozygous genotypes, and can identify the heterozygous genotype, with the characteristics of a co-dominant marker, and the marker development is successful.

[0068] Example 2 Validation of KASP molecular marker BrYL1-funK1

[0069] The BrYL1-funK1 marker was used to genotype 86 individuals in the F2 population, and the homozygous green genotype was recorded as a, the homozygous yellow genotype was recorded as b, and the heterozygous type was recorded as h.

[0070] The results are as follows Figure 3 As shown, there are 18 plants with genotype a, 21 plants with genotype h, and 47 plants with genotype b. The genotype and phenotype consistency rate of marker BrYL1-funK1 in 86 F2 plants reached 100%. It further shows that the BrYL1-funK1 marker can be used for molecular assisted breeding of Chinese cabbage leaf color traits.

[0071] Example 3 Application of KASP molecular marker BrYL1-funK1

[0072] All natural populations were green materials. The DNA of individual strains of natural populations was extracted according to the above-mentioned method for extracting genomic DNA and stored in the refrigerator for future use. KASP marker BrYL1-funK1 was used to verify the parents R16-11, Y706-1 and natural populations described in Example 1. The results are as follows Figure 3 As shown, all natural populations are clustered on the X axis, and the typing results are consistent with R16-11, with a 100% consistency between genotype and phenotype. This further indicates that the marker BrYL1-funK1 has good versatility and accuracy, and can be used for molecular marker-assisted selection of yellow leaf traits in Chinese cabbage.

[0073] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A molecular marker related to leaf color traits of Chinese cabbage, the molecular marker being located at position 70 from the 5' end on SEQ ID NO.1 as shown in the nucleotide sequence table, corresponding to the missing original base C at position 6557852 from the 5' end on chromosome A066 of the Brapa_Chiifu_V3.0 reference genome.

2. The molecular marker related to leaf color traits of Chinese cabbage according to claim 1, characterized in that: The growth trait is the leaf color of Chinese cabbage, including yellow and green.

3. A primer pair for detecting the molecular marker according to claim 1, characterized in that: The primer pair includes three primers, BrYL1-funK1Fa, BrYL1-funK1Fb and BrYL1-funK1R; the nucleotide sequence of the BrYL1-funK1Fa is shown in the sequence list SEQ ID NO.3; the nucleotide sequence of the BrYL1-funK1Fb is shown in the sequence list SEQ ID NO.4; the nucleotide sequence of the BrYL1-funK1R is shown in the sequence list SEQ ID NO.

5.

4. The primer pair according to claim 3, characterized in that: The BrYL1-funK1Fa is a specific primer for the green leaf genotype; the BrYL1-funK1Fb is a specific primer for the yellow leaf genotype; and BrYL1-funK1R is a common reverse primer.

5. The primer pair according to claim 4, characterized in that: The 5' ends of the primers BrYL1-funK1Fa and BrYL1-funK1Fb are added with FAM and HEX fluorescent sequences respectively.

6. A method for detecting leaf color traits of Chinese cabbage, characterized in that: The method comprises detecting the molecular marker of claim 1.

7. The method according to claim 6, characterized in that: The detection method can be polyacrylamide gel electrophoresis, competitive allele-specific PCR, fluorescent labeling capillary electrophoresis or sequencing.

8. The method according to claim 6, characterized in that The detection method comprises the following steps: using the primer pair described in claim 3 to amplify the nucleotide sequence of the molecular marker site described in claim 1 to obtain an amplified product, performing fluorescence quantification on the amplified product, reading the fluorescence signal and analyzing the typing result.

9. Application of molecular markers in the BrYL1 gene of Chinese cabbage in detecting leaf color traits of Chinese cabbage, characterized in that: The molecular marker is the molecular marker according to claim 1.

10. Application of a specific primer pair of a molecular marker related to the leaf color trait of Chinese cabbage in Chinese cabbage breeding, characterized in that: The molecular marker related to the leaf color trait of Chinese cabbage is the molecular marker described in claim 1; the specific primer pair is the primer pair described in claim 3.

Images