SV molecular marker related to cassava stem height and application

Abstract

The invention provides an SV molecular marker related to cassava stem height and application, and belongs to the technical field of molecular biology, the SV molecular marker is Chr0514733334014734987 and is used for judging the cassava stem height; a primer group for amplifying the SV molecular marker comprises a forward primer, a reverse primer, a forward primer, a reverse primer and a reverse primer, wherein the sequence of the forward primer is 5 '-TGCTTCCTGGTCGTTCC-3'; the sequence of the reverse primer is 5 '-CGGCGACATAAACACCA-3'; the sequence of the reverse primer is 5 '-CGGCGACATAAACACA-3 The primer group is used for preparing the kit; the primer group or the kit is used for carrying out PCR amplification on the DNA of the cassava to be detected so as to identify the stem height of the cassava to be detected. The SV molecular marker provided by the invention can accurately and efficiently predict the height of the main stem of the cassava without planting and waiting for the adult plant of the cassava, so that the selection efficiency of cassava breeding is greatly improved, and the cost is reduced.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and relates to an SV molecular marker related to the main stem height of cassava and an application thereof, which solves the problems of long breeding time and high breeding cost for new cassava varieties related to the main stem height index in the prior art. Background Art

[0002] Cassava, also known as sweet potato, tree sweet potato, and wood root, is a tropical and subtropical perennial shrub crop that is widely cultivated in tropical and subtropical regions around the world. Cassava tubers are large and rich in starch. They have a rough and rustic appearance. The tubers are of various shapes and rough skin, but the internal starch content is extremely high, the texture is fine, the powder is white, and the taste is soft. It is an important food and industrial raw material, and is known as the "king of starch", "treasure of tropical crops", and "energy crop". Mature cassava tubers are rich in starch, and their starch particles are large and high in purity. They have excellent processing properties and important edible and industrial value. Therefore, the development of cassava production will greatly promote the development of related industries such as food processing, bioenergy, papermaking, textiles, and feed, which is of great significance.

[0003] Dwarf cassava is a cassava variety that has been selected for its short stems, neat growth, and strong resistance to lodging. This cassava variety usually has a higher yield and better adaptability, and is suitable for planting in agricultural production with a high degree of mechanization. The plant shape of dwarf cassava is compact and has fewer branches, which is conducive to increasing planting density and facilitating field management. In addition, the tubers of dwarf cassava are usually larger and more concentrated, which is convenient for harvesting and processing.

[0004] In traditional cassava molecular breeding, farmers or breeders mainly select individual plants with excellent traits and fix the excellent traits through hybridization or backcrossing. At present, if you want to obtain cassava varieties with lower main stem height, you need to wait for the plants to mature and measure the main stem height of cassava to screen excellent plants. This breeding method takes a long time and has high breeding costs. Therefore, it is necessary to establish a method for accurately and quickly identifying the main stem height of cassava to solve the problem of long breeding time and high breeding cost of new cassava varieties related to the main stem height index in the prior art. Summary of the invention

[0005] In view of the above problems, the present invention provides an SV molecular marker highly correlated with the main stem of cassava and its application.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is: An SV molecular marker highly correlated with the main stem of cassava, the SV molecular marker is located at a large fragment deletion at bases 14733340 to 14734987 of chromosome 5 (Chr05) of the cassava genome, the sequence deletion length is 1648 bp, named Chr05_14733340_14734987, and the sequence is shown in SEQ ID NO: 1; Among them, the main stem height of cassava lacking SV molecular markers was lower than that of cassava carrying SV molecular markers; The cassava lacking the SV molecular marker is dwarf cassava; The cassava carrying the SV molecular marker is tall cassava.

[0007] An application of the SV molecular marker related to the main stem height of cassava is to determine the main stem height of cassava by detecting whether cassava carries the SV molecular marker.

[0008] A primer set for amplifying the SV molecular marker associated with the main stem height of cassava, wherein the primer set is a set of primers designed upstream and downstream of the SV molecular marker, that is, the upstream primer is designed based on the sequence upstream of the 14733340th nucleotide of chromosome 5 of the cassava genome, and the downstream primer is designed based on the sequence downstream of the 14734987th nucleotide of chromosome 5 of the cassava genome, comprising: The sequence of the forward primer was 5′-TGCTTCCTCGGTCGTTCC-3′; The sequence of the reverse primer was 5'-CGGCGACATCAAACACCA-3'.

[0009] A kit comprising the above primer set.

[0010] Furthermore, the kit includes conventional reagents for PCR amplification.

[0011] Furthermore, the kit includes: 2× Rapid Taq Master Mix and ddH2O.

[0012] A method for identifying the height of the main stem of cassava, the method comprising using the above primer set to perform PCR amplification on the DNA of the cassava to be tested, so as to identify the height of the main stem of the cassava to be tested; Alternatively, the above kit is used to perform PCR amplification on the DNA of the cassava to be tested, so as to identify the main stem height of the cassava to be tested.

[0013] Further, the main stem height of the cassava to be tested is identified by sequencing the PCR amplification product to determine whether it carries the SV molecular marker to determine the main stem height of the cassava; When the nucleotide sequence of the PCR amplification product is as shown in SEQ ID NO: 2, the 32nd to 1679th bases of the sequence from the 5' end are SV molecular marker fragments, and at this time, the cassava to be tested carries the SV molecular marker, and the main stem height of the cassava to be tested is relatively high, and it is a tall cassava; otherwise, the cassava to be tested lacks the SV molecular marker, that is, a large fragment deletion occurs in the 14733340th to 14734987th bases of the fifth chromosome (Chr05) in the cassava genome to be tested, and the main stem height of the cassava to be tested is relatively low, and it is a suitable short-stem cassava.

[0014] Further, the main stem height of the cassava to be tested is identified by performing electrophoresis detection on the PCR amplification product and interpreting the electrophoresis detection result to determine the main stem height of the cassava to be tested; When only a band of 1826 bp appears in the electrophoresis detection result, the cassava to be tested carries the SV molecular marker, and the main stem height of the cassava to be tested is relatively high, that is, the cassava to be tested is tall; When only a 178 bp band appears in the electrophoresis detection result, the cassava to be tested lacks the SV molecular marker, and the main stem height of the cassava to be tested is relatively low, which is a suitable dwarf cassava.

[0015] Furthermore, the PCR amplification system includes: 2× Rapid Taq Master Mix 12.5 μL, the forward primer 1 μL at a concentration of 10 μM, the reverse primer 1 μL at a concentration of 10 μM, the cassava DNA template 1 μL to be tested and ddH2O 9.5 μL; The reaction program of PCR amplification was: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s, for 35 cycles; and 72°C for 5 min.

[0016] The beneficial effects of the SV molecular markers related to the cassava main stem height and the application of the present invention are: The present invention develops an SV molecular marker related to the height of the main stem of cassava. The SV molecular marker can be used to accurately and efficiently predict the height of the main stem of cassava without planting and waiting for the cassava to mature, which greatly improves the selection efficiency of machine-friendly short-stem cassava breeding, reduces costs, can efficiently assist in the breeding selection of cassava, and has extremely high economic value. The present invention develops an SV molecular marker related to the height of the main stem of cassava, and establishes a method for accurately and quickly identifying the height of the main stem of cassava, which provides a more effective theoretical and practical basis for the molecular marker-assisted breeding of machine-friendly dwarf cassava. The molecular marker-assisted breeding technology can accelerate the breeding of new varieties of machine-friendly dwarf cassava, shorten the breeding cycle, and improve the breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1It is the result of association analysis positioning of 337 cassava main stem height data on chromosome 5 in Example 1 of the present invention; Figure 2 It is the T-test result of the main stem height trait of 251 cassavas in Example 5 of the present invention; wherein, REF represents cassava carrying SV molecular marker, n=18 represents the sample size of 18; SV represents cassava lacking SV molecular marker, n=233 represents the sample size of 233. DETAILED DESCRIPTION

[0018] The technical solutions in the embodiments of the present invention are described clearly and completely below. In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention can also be implemented in other ways different from those described herein, and those skilled in the art can make similar generalizations without violating the connotation of the present invention, so the present invention is not limited by the specific embodiments disclosed below. The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand.

[0019] Example 1 Obtaining SV molecular markers associated with cassava main stem height The genome resequencing data of 337 cassava samples grown in Danzhou City, Hainan Province, China (109.5°E, 19.5°N) were obtained. The quality-controlled sequencing data were aligned to the cassava reference gene to obtain the cassava whole-genome SV molecular marker map, and combined with the cassava phenotypic data for genome-wide association analysis. The results are as follows Figure 1 As shown, the results showed that there was an SV molecular marker on the cassava genome that was significantly associated with the main stem height trait.

[0020] The SV molecular marker highly related to the main stem of cassava is located in the large fragment deletion at bases 14733340-14734987 of chromosome 5 (Chr05) of the cassava genome. The sequence deletion length is 1648 bp, named Chr05_14733340_14734987, and the sequence is shown in SEQ ID NO: 1.

[0021] Using this SV molecular marker, cassava breeding materials were tested, and the average main stem height of cassavas lacking this SV molecular marker (i.e., a large fragment deletion occurred at bases 14733340 to 14734987 of chromosome 5 (Chr05)) was lower than the main stem height of cassavas carrying this SV molecular marker. Therefore, without planting and waiting for cassava to mature, the height of the main stem of cassava can be accurately and efficiently predicted, which greatly improves the selection efficiency of cassava breeding, can efficiently assist in the breeding selection of cassava, and has extremely high economic value.

[0022] Example 2 Primer set and kit for identifying the height of cassava main stem Using the characteristics of the SV molecular marker highly correlated with the cassava main stem in Example 1 on the cassava genome, a set of primers were designed upstream and downstream of the SV molecular marker, that is, the upstream primer was designed based on the sequence upstream of the 14733340th nucleotide of chromosome 5 of the cassava genome, and the downstream primer was designed based on the sequence downstream of the 14734987th nucleotide of chromosome 5 of the cassava genome. The specific primer set is as follows: The sequence of the forward primer was 5′-TGCTTCCTCGGTCGTTCC-3′; The sequence of the reverse primer was 5'-CGGCGACATCAAACACCA-3'.

[0023] Among them, the sequence upstream of nucleotide 14733340 of chromosome 5 of the cassava genome based on the upstream primer is: 5'-ATTTCATCTCCAGGGGTGTCCATCACGACTGTTGGAGAGGCAGGTGGTGGCGCAATCATCGTCGCTTTGTTTTGCCGGCTGTATTTCTGGACATTCGGCATGTCAGGACGTCTGGTCTATGCTTCCTCGGTCGTTCCGGTGTCGGCATTG-3'; The sequence downstream of nucleotide 14734987 of chromosome 5 of the cassava genome based on the downstream primer is: 5'-TGTTGGGGATGGGTGGGGGGTTGTCCATTGCCTCCTCATCACTGTCAGTGGGAATGCATATAGGTCTGGGCATCCCTCGTCTCCTCCACATGCCGGGGCCGCCGGTGACCATCATCTTGGTTCTGGCCATGGTGTTTGATGTCGCCGATG-3'.

[0024] When designing primers, in order to enhance the applicability and sensitivity of the primers, the designed primer length is between 18 and 25 bp, and the primers do not interfere with each other. The above two primers can be obtained by artificial synthesis.

[0025] This embodiment also provides a kit for identifying the height of the main stem of cassava, which includes the above primer set.

[0026] The kit also includes common reagents for PCR amplification, such as 2× Rapid Taq Master Mix and ddH2O.

[0027] The primer set designed by the present invention has strong specificity and can accurately amplify the sequence carrying / lacking the SV molecular marker of the present invention.

[0028] By adopting the primer set or the kit of the present invention, the height of the main stem of cassava can be accurately and efficiently predicted without planting and waiting for the cassava to mature.

[0029] Example 3 Method for Identifying the Height of Cassava Main Stem This embodiment provides a method for identifying the height of the main stem of cassava, and the specific method comprises the following steps: S1, extracting the DNA of the cassava to be tested as a DNA template; S2, using the primer set in Example 2 to perform PCR amplification on the DNA template of cassava to be tested; The reaction system for PCR amplification was: 2× Rapid Taq Master Mix 12.5 μL, 1 μL forward primer at a concentration of 10 μM, 1 μL reverse primer at a concentration of 10 μM, 1 μL DNA template, and 9.5 μL ddH2O. Among them, 2× Rapid Taq Master Mix (amplification buffer) was purchased from Novozyme Biotech Co., Ltd., and the primer set was commissioned to be synthesized by Beijing Aoke Dingsheng Biotechnology Co., Ltd.

[0030] The reaction program of PCR amplification was: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s, for 35 cycles; and 72°C for 5 min.

[0031] S3. Sequence the obtained PCR amplification product to determine whether it carries the SV molecular marker fragment.

[0032] When the nucleotide sequence of the PCR amplification product is as shown in SEQ ID NO: 2, the 32nd to 1679th bases of the sequence from the 5' end (i.e., the front end of the sequence) are SV molecular marker fragments, and at this time, the cassava to be tested carries the SV molecular marker, and the main stem height of the cassava to be tested is relatively high, and it is a tall cassava; otherwise, the cassava to be tested lacks the SV molecular marker, that is, a large fragment deletion occurs in the 14733340-14734987th bases of the fifth chromosome (Chr05) in the cassava genome to be tested, and the main stem height of the cassava to be tested is relatively low, and it is a suitable short-stem cassava.

[0033] Alternatively, the PCR amplification product is subjected to electrophoresis detection, and the electrophoresis detection result is interpreted; When only a band of 1826 bp appears in the electrophoresis detection result, the cassava to be tested carries the SV molecular marker, and the main stem height of the cassava to be tested is relatively high, that is, the cassava to be tested is tall; When only a 178 bp band appears in the electrophoresis detection result, the cassava to be tested lacks the SV molecular marker, and the main stem height of the cassava to be tested is relatively low, which is a suitable dwarf cassava.

[0034] Among them, the height of short-stem cassava is generally ≤140cm; the height of tall-stem cassava is generally >160cm.

[0035] Example 4 Detection and verification of SV molecular markers in cassava To verify the practicality of the SV molecular marker, several cassava plants (excluding 337 cassava plants used for SV molecular marker development) were randomly selected in the cassava planting area of ​​Danzhou City, Hainan Province, China (109.5° east longitude, 19.5° north latitude). The method in Example 3 was used to determine whether they carried the SV molecular marker through PCR amplification, and the main stem height traits were investigated after planting. The results are shown in Tables 1 and 2 below.

[0036] Table 1 20 cassava plants with different genotypes and main stem heights (cm)

[0037] Table 2 Statistics of different genotypes and main stem heights of 20 cassava plants

[0038] It can be seen from Table 1 and Table 2 that the method of the present invention can identify that the main stem height of cassava lacking SV molecular markers is relatively low, belonging to the machine-friendly short-stem cassava, indicating that the method of the present invention can be used to identify the main stem height of cassava.

[0039] Example 5 Detection of SV molecular markers in cassava Further, 251 cassava samples were typed using the method in Example 3. The results are as follows: Figure 2 As shown in the figure, 18 samples carried the SV molecular marker and 233 samples lacked the SV molecular marker. The data of the main stem height traits of the samples were sorted out and T-test was performed. The results showed that the P value was 0.00032. The cassava lacking the SV molecular marker had a lower main stem height trait than the cassava carrying the SV molecular marker, and there was a significant difference. This can further prove that the main stem height of the cassava lacking the SV molecular marker is lower, and it is a short-stem cassava suitable for machine type.

[0040] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, rather than all the embodiments. A person skilled in the art can also obtain other embodiments based on the embodiments without inventiveness, and these embodiments all belong to the protection scope of the present invention.

Claims

1. An SV molecular marker highly correlated with the main stem of cassava, characterized in that: The sequence of the SV molecular marker is shown in SEQ ID NO: 1; Among them, the cassava lacking the SV molecular marker is dwarf cassava.

2. An application of the SV molecular marker associated with the cassava main stem height according to claim 1, characterized in that: The application is to determine the main stem height of cassava by detecting whether cassava carries SV molecular markers.

3. A primer set for amplifying the SV molecular marker associated with the cassava main stem height according to claim 1, characterized in that: The primer set comprises: The sequence of the forward primer was 5′-TGCTTCCTCGGTCGTTCC-3′; The sequence of the reverse primer was 5'-CGGCGACATCAAACACCA-3'. A kit comprising the primer set according to claim 3.

5. The kit according to claim 4, characterized in that The kit includes conventional reagents for PCR amplification.

6. The kit according to claim 4 or 5, characterized in that The kit includes: 2× Rapid TaqMaster Mix and ddH2O.

7. A method for identifying the height of the main stem of cassava, characterized in that: The method comprises using the primer set of claim 3 to perform PCR amplification on the DNA of the cassava to be tested, so as to identify the main stem height of the cassava to be tested; Alternatively, the kit according to claim 4 or 5 is used to perform PCR amplification on the DNA of the cassava to be tested, so as to identify the main stem height of the cassava to be tested.

8. The method for identifying the height of the cassava main stem according to claim 7, characterized in that: The main stem height of the cassava to be tested is identified by sequencing the PCR amplification product to determine whether it carries the SV molecular marker to determine the main stem height of the cassava.

9. The method for identifying the height of the cassava main stem according to claim 7, characterized in that: Identifying the main stem height of the cassava to be tested is to perform electrophoresis detection on the PCR amplification product and interpret the electrophoresis detection result to determine the main stem height of the cassava to be tested; When only a band of 1826 bp appears in the electrophoresis test results, the cassava to be tested carries the SV molecular marker; When only a 178 bp band appears in the electrophoresis detection result, the cassava to be tested is lacking the SV molecular marker.

10. The method for identifying the height of the main stem of cassava according to claim 7, characterized in that: The PCR amplification system includes: 2× Rapid Taq Master Mix, the forward primer, the reverse primer, the DNA template of cassava to be tested and ddH2O; The reaction program of PCR amplification was: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s, 35 cycles; 72°C for 5 min.

Images