SV Molecular Markers Related to the Height of Cassava Main Stem and Their Applications

Abstract

The present invention provides an SV molecular marker related to the main stem height of cassava and its application, belonging to the field of molecular biotechnology. The SV molecular marker is Chr05_14733340_14734987, which is used to judge the main stem height of cassava. The primer set for amplifying the SV molecular marker includes: the forward primer has a sequence of 5'-TGCTTCCTCGGTCGTTCC-3'; the reverse primer has a sequence of 5'-CGGCGACATCAAACACCA-3'. A kit is prepared using this primer set. The DNA of the cassava to be tested is subjected to PCR amplification using the above primer set or the above kit to identify the main stem height of the cassava to be tested. The SV molecular marker of the present invention can accurately and efficiently predict whether the main stem height of cassava is high or low without waiting for the cassava to grow into a mature plant by planting, greatly improving the selection efficiency of cassava breeding and reducing the cost.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and relates to an SV molecular marker related to the main stem height of cassava and its application, solving the problems of long breeding time and high breeding cost for new cassava varieties related to the main stem height index in the prior art. Background Art

[0002] Cassava, also known as tapioca, tree sweet potato, woody root, etc., is a tropical and subtropical perennial shrub crop widely cultivated in tropical and subtropical regions around the world. Cassava has thick and fleshy roots rich in starch. Its appearance is rough and simple. The root shape is diverse and the epidermis is rough, but the internal starch content is extremely high, with a delicate texture, white powder quality, and soft taste. It is an important food and industrial raw material, and has elegant names such as "king of starch", "treasure of tropical crops", and "energy crop". Mature cassava roots are rich in starch, with large and pure starch granules, excellent processing performance, and important edible and industrial values. Therefore, the development of cassava production will greatly promote the development of related industries such as food processing, bioenergy, papermaking, textile, and feed, and has important significance.

[0003] The suitable machine-type dwarf cassava is a selected cassava variety, which has the characteristics of short stems, neat growth, and strong lodging resistance. This cassava variety usually has high yield and good adaptability, and is suitable for planting in agricultural production with a high degree of mechanization. The plant type of dwarf cassava is compact, with fewer branches, which is beneficial to increasing the planting density and facilitating field management. In addition, the roots of dwarf cassava are usually larger and more concentrated, which is convenient for harvesting and processing.

[0004] In traditional cassava molecular breeding, farmers or breeders mainly select individual plants with excellent traits and fix the excellent traits through hybridization or backcrossing. At present, to obtain a cassava variety with a lower main stem height, it is necessary to wait until the plants reach maturity and measure the main stem height of cassava to screen for excellent plants. This breeding method has a long breeding time and high breeding cost. Therefore, it is necessary to establish a method for accurately and quickly identifying the main stem height of cassava to solve the problems of long breeding time and high breeding cost for new cassava varieties related to the main stem height index in the prior art. Summary of the Invention

[0005] In view of the above problems, the present invention provides an SV molecular marker related to the main stem height of cassava and its application.

[0006] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0007] An SV molecular marker related to the main stem height of cassava, where the SV molecular marker is a large fragment deletion occurring at positions 14733340 - 14734987 on chromosome 5 (Chr05) of the cassava genome. The sequence deletion length is 1648 bp, named Chr05_14733340_14734987, and the sequence is as shown in SEQ ID NO: 1;

[0008] Among them, the main stem height of cassava lacking the SV molecular marker is lower than that of cassava carrying the SV molecular marker;

[0009] Cassava lacking the SV molecular marker is dwarf cassava;

[0010] Cassava carrying the SV molecular marker is tall cassava.

[0011] An application of the above-mentioned SV molecular marker related to the main stem height of cassava, where the application is to determine the main stem height of cassava by detecting whether the cassava carries the SV molecular marker.

[0012] A primer set for amplifying the above-mentioned SV molecular marker related to the main stem height of cassava. The primer set is a set of primers designed upstream and downstream of the above-mentioned SV molecular marker. That is, the upstream primer is designed according to the sequence upstream of the 14733340th nucleotide on chromosome 5 of the cassava genome, and the downstream primer is designed according to the sequence downstream of the 14734987th nucleotide on chromosome 5 of the cassava genome, including:

[0013] The sequence of the forward primer is 5'-TGCTTCCTCGGTCGTTCC-3';

[0014] The sequence of the reverse primer is 5'-CGGCGACATCAAACACCA-3'.

[0015] A kit including the above-mentioned primer set.

[0016] Furthermore, the kit includes conventional reagents for PCR amplification.

[0017] Furthermore, the kit includes: 2× Rapid Taq Master Mix and ddH 2 O.

[0018] A method for identifying the main stem height of cassava, where the method is to perform PCR amplification on the DNA of the cassava to be tested using the above-mentioned primer set to identify the main stem height of the cassava to be tested;

[0019] Alternatively, perform PCR amplification on the DNA of the cassava to be tested using the above-mentioned kit to identify the main stem height of the cassava to be tested.

[0020] Further, to identify the main stem height of the cassava to be tested, sequence the PCR amplification product to determine whether it carries the SV molecular marker, so as to judge the main stem height of the cassava;

[0021] When the nucleotide sequence of the PCR amplification product is as shown in SEQ ID NO: 2, the 32nd to 1679th bases from the 5' end of this sequence are the SV molecular marker fragment. At this time, the cassava to be tested carries this SV molecular marker, and the main stem height of this cassava to be tested is relatively high, being a tall-stem cassava; otherwise, the cassava to be tested lacks this SV molecular marker, that is, a large fragment deletion has occurred at the 14733340th to 14734987th bases of chromosome No. 5 (Chr05) in the genome of the cassava to be tested, and the main stem height of this cassava to be tested is relatively low, being a suitable dwarf-stem cassava.

[0022] Further, to identify the main stem height of the cassava to be tested, perform electrophoresis detection on the PCR amplification product and interpret the electrophoresis detection result to judge the main stem height of the cassava to be tested;

[0023] When only a 1826bp band appears in the electrophoresis detection result, the cassava to be tested carries this SV molecular marker, and the main stem height of this cassava to be tested is relatively high, being a tall-stem cassava;

[0024] When only a 178bp band appears in the electrophoresis detection result, the cassava to be tested lacks this SV molecular marker, and the main stem height of this cassava to be tested is relatively low, being a suitable dwarf-stem cassava.

[0025] Further, the system for PCR amplification includes: 12.5 μL of 2× Rapid Taq Master Mix, 1 μL of the forward primer with a concentration of 10 μM, 1 μL of the reverse primer with a concentration of 10 μM, 1 μL of the DNA template of the cassava to be tested, and 9.5 μL of ddH 2 O;

[0026] The reaction program for PCR amplification is: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, 72°C for 30 s, for 35 cycles; 72°C for 5 min.

[0027] The beneficial effects of the SV molecular marker related to the main stem height of cassava and its application in the present invention are:

[0028] The present invention has developed an SV molecular marker related to the main stem height of cassava. Using this SV molecular marker, it is possible to accurately and efficiently predict whether the main stem height of cassava is high or low without having to plant and wait for the cassava to grow into a mature plant. This greatly improves the selection efficiency of suitable dwarf-stem cassava breeding, reduces costs, can efficiently assist in the breeding selection of cassava, and has extremely high economic value;

[0029] The present invention has developed an SV molecular marker related to the height of the main stem of cassava, and established a method for accurately and rapidly identifying the height of the main stem of cassava, providing a more effective theoretical and practical basis for molecular marker-assisted breeding of suitable dwarf cassava varieties; by using this molecular marker-assisted breeding technology, the breeding of new suitable dwarf cassava varieties can be accelerated, the breeding cycle can be shortened, and the breeding efficiency can be improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 is the association analysis and mapping result of the main stem height data of 337 cassava samples in Example 1 of the present invention on chromosome No. 5;

[0031] Figure 2 is the T-test result of the main stem height trait of 251 cassava samples in Example 5 of the present invention; among them, REF represents cassava carrying the SV molecular marker, n = 18 represents the sample size of 18; SV represents cassava lacking the SV molecular marker, n = 233 represents the sample size of 233. DETAILED DESCRIPTION OF THE INVENTION

[0032] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Many specific details are set forth in the following description in order to fully understand the present invention, but the present invention can also be implemented in other ways different from those described herein. Those skilled in the art can make similar extensions without departing from the connotation of the present invention, so the present invention is not limited by the specific embodiments disclosed below. The present invention will be further described in detail below with reference to specific embodiments for those skilled in the art to understand.

[0033] Example 1 Obtaining of the SV Molecular Marker Related to the Height of the Main Stem of Cassava

[0034] Take the genome resequencing data of 337 cassava samples planted in Danzhou City, Hainan Province, China (109.5° east longitude, 19.5° north latitude), align the quality-controlled sequencing data to the cassava reference gene, obtain the whole-genome SV molecular marker map of cassava, and perform a genome-wide association analysis in combination with the cassava phenotype data. The results are as Figure 1 shown, and the results show that there is an SV molecular marker on the cassava genome that is significantly associated with the main stem height trait.

[0035] The SV molecular marker related to the height of the main stem of cassava is a large fragment deletion occurring at positions 14733340 - 14734987 on chromosome No. 5 (Chr05) of the cassava genome. The sequence deletion length is 1648 bp, named Chr05_14733340_14734987, and the sequence is as shown in SEQ ID NO: 1.

[0036] Using this SV molecular marker to detect cassava breeding materials, the average main stem height of cassava lacking this SV molecular marker (i.e., a large fragment deletion occurring at bases 14733340 - 14734987 on chromosome 5 (Chr05)) is lower than that of cassava carrying this SV molecular marker. Therefore, without waiting for cassava to grow into adult plants by planting, the high or low of cassava main stem height can be accurately and efficiently predicted, greatly improving the selection efficiency of cassava breeding, efficiently assisting the breeding selection of cassava, and having extremely high economic value.

[0037] Example 2 Primer Sets and Kits for Identifying Cassava Main Stem Height

[0038] Using the characteristics of the SV molecular marker related to cassava main stem height in Example 1 on the cassava genome, a set of primers was designed upstream and downstream of this SV molecular marker. That is, the upstream primer was designed according to the sequence upstream of nucleotide 14733340 on chromosome 5 of the cassava genome, and the downstream primer was designed according to the sequence downstream of nucleotide 14734987 on chromosome 5 of the cassava genome. The specific primer sets are as follows:

[0039] The sequence of the forward primer is 5'-TGCTTCCTCGGTCGTTCC-3';

[0040] The sequence of the reverse primer is 5'-CGGCGACATCAAACACCA-3'.

[0041] Among them, the sequence upstream of nucleotide 14733340 on chromosome 5 of the cassava genome on which the upstream primer is based is: 5'-ATTTCATCTCCAGGGGTGTCCATCACGACTGTTGGAGAGGCAGGTGGTGGCGCAATCATCGTCGCTTTGTTTTGCCGGCTGTATTTCTGGACATTCGGCATGTCAGGACGTCTGGTCTATGCTTCCTCGGTCGTTCCGGTGTCGGCATTG-3';

[0042] The sequence downstream of nucleotide 14734987 on chromosome 5 of the cassava genome on which the downstream primer is based is: 5'-TGTTGGGGATGGGTGGGGGGTTGTCCATTGCCTCCTCATCACTGTCAGTGGGAATGCATATAGGTCTGGGCATCCCTCGTCTCCTCCACATGCCGGGGCCGCCGGTGACCATCATCTTGGTTCTGGCCATGGTGTTTGATGTCGCCGATG-3'.

[0043] When designing primers, in order to enhance the applicability and sensitivity of the primers, the designed primers have a length between 18 and 25 bp, and the primers do not interfere with each other. The above two primers can be obtained by artificial synthesis.

[0044] This embodiment also provides a kit for identifying the height of the main stem of cassava. The kit includes the above primer set.

[0045] The kit also includes conventional reagents for PCR amplification, such as 2× Rapid Taq Master Mix and ddH 2 O.

[0046] The primer set designed by the present invention has strong specificity and can accurately amplify the sequence carrying / deleting the SV molecular marker of the present invention.

[0047] Using the primer set or kit of the present invention, it is possible to accurately and efficiently predict the high or low of the height of the main stem of cassava without waiting for the cassava to grow into a mature plant by planting.

[0048] Example 3 Method for Identifying the Height of the Main Stem of Cassava

[0049] This embodiment provides a method for identifying the height of the main stem of cassava. The specific method includes the following steps:

[0050] S1. Extract the DNA of the cassava to be tested as a DNA template;

[0051] S2. Use the primer set in Example 2 to perform PCR amplification on the DNA template of the cassava to be tested;

[0052] The reaction system for PCR amplification is: 2× Rapid Taq Master Mix 12.5 μL, forward primer with a concentration of 10 μM 1 μL, reverse primer with a concentration of 10 μM 1 μL, DNA template 1 μL, and ddH 2 O 9.5 μL. Among them, 2× Rapid TaqMaster Mix (amplification buffer) is purchased from Novoprotein Scientific Inc., and the primer set is synthesized by Beijing Aoke Dingsheng Biotechnology Co., Ltd.

[0053] The reaction program for PCR amplification is: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, 72°C for 30 s, 35 cycles; 72°C for 5 min.

[0054] S3. Sequence the obtained PCR amplification product to determine whether it carries the SV molecular marker fragment.

[0055] When the nucleotide sequence of the PCR amplification product is as shown in SEQ ID NO: 2, the bases at positions 32 to 1679 from the 5' end (i.e., the front end of the sequence) are the SV molecular marker fragment. At this time, the tested cassava carries this SV molecular marker, and the main stem height of the tested cassava is relatively high, being a tall-stem cassava; otherwise, the tested cassava lacks this SV molecular marker, that is, a large fragment deletion has occurred at the bases 14733340 to 14734987 on chromosome No. 5 (Chr05) in the genome of the tested cassava, and the main stem height of the tested cassava is relatively low, being a short-stem cassava of the suitable model.

[0056] Alternatively, perform electrophoresis detection on the PCR amplification product and interpret the electrophoresis detection result;

[0057] When only a 1826bp band appears in the electrophoresis detection result, the tested cassava carries this SV molecular marker, and the main stem height of the tested cassava is relatively high, being a tall-stem cassava;

[0058] When only a 178bp band appears in the electrophoresis detection result, the tested cassava lacks this SV molecular marker, and the main stem height of the tested cassava is relatively low, being a short-stem cassava of the suitable model.

[0059] Among them, the height of the short-stem cassava is generally ≤140 cm; the height of the tall-stem cassava is generally >160 cm.

[0060] Example 4 Detection and verification of SV molecular marker in cassava

[0061] To verify the practicability of this SV molecular marker, several cassavas (excluding the 337 cassavas used for the development of the SV molecular marker) were randomly selected in the cassava planting area of Danzhou City, Hainan Province, China (east longitude 109.5°, north latitude 19.5°). Using the method in Example 3, determine whether to carry the SV molecular marker through PCR amplification, and plant and investigate the main stem height trait. The obtained results are shown in Tables 1 to 2 below.

[0062] Table 1 The situation of 20 cassavas in different genotypes and main stem heights (cm)

[0063]

[0064] Table 2 Statistical table of different genotypes and main stem heights of 20 cassavas

[0065]

[0066] It can be seen from Tables 1 and 2 that the method of the present invention can identify that the main stem heights of the cassavas lacking the SV molecular marker are all relatively low, belonging to the short-stem cassavas of the suitable model, indicating that the method of the present invention can be used to identify the main stem height of cassava.

[0067] Example 5 Detection of SV molecular marker in cassava

[0068] Furthermore, the method in Example 3 was used to genotype 251 cassava samples, and the results are as Figure 2 shown. Among them, 18 samples carried this SV molecular marker, and 233 samples lacked this SV molecular marker. The data of the main stem height trait of the samples were sorted out and a T-test was conducted. The results showed that the P value was 0.00032. The cassava lacking this SV molecular marker was lower than the cassava carrying this SV molecular marker in the main stem height trait, and there was a significant difference, which could further prove that the main stem height of the cassava lacking this SV molecular marker was lower, and it was a suitable dwarf cassava variety.

[0069] Other parts not described in detail are all prior arts. Although the above embodiments have made a detailed description of the present invention, they are only a part of the embodiments of the present invention, not all embodiments. Those of ordinary skill in the art can also obtain other embodiments according to this embodiment without creative efforts, and these embodiments all fall within the protection scope of the present invention.

Claims

1. An SV molecular marker highly correlated with the main stem of cassava, characterized in that: The sequence of the SV molecular marker is shown in SEQ ID NO: 1; Among them, if the cassava carries the SV molecular marker, the main stem height of the cassava is relatively high, and it is a tall cassava; otherwise, if the cassava lacks the SV molecular marker, the main stem height of the cassava is relatively low, and it is a short cassava suitable for machine type; The height of short-stem cassava is generally ≤140cm; the height of tall-stem cassava is generally >160cm.

2. Use of a reagent for detecting the SV molecular marker associated with the cassava main stem height according to claim 1, characterized in that: The application is to detect whether cassava carries SV molecular markers by using the reagent to determine the main stem height of cassava; If the cassava carries the SV molecular marker, the main stem height of the cassava is relatively high, and it is a tall cassava; otherwise, if the cassava lacks the SV molecular marker, the main stem height of the cassava is relatively low, and it is a short cassava suitable for machine type; The height of short-stem cassava is generally ≤140cm; the height of tall-stem cassava is generally >160cm.

3. A primer set for detecting the SV molecular marker associated with the cassava main stem height according to claim 1, characterized in that: The primer set comprises: The sequence of the forward primer was 5′-TGCTTCCTCGGTCGTTCC-3′; The sequence of the reverse primer was 5'-CGGCGACATCAAACACCA-3'. A kit comprising the primer set according to claim 3.

5. The kit according to claim 4, characterized in that The kit includes reagents for PCR amplification.

6. The kit according to claim 4 or 5, characterized in that The kit includes: 2× Rapid TaqMaster Mix and ddH2O.

7. A method for identifying the height of the main stem of cassava, characterized in that: The method comprises using the primer set of claim 3 to perform PCR amplification on the DNA of the cassava to be tested, and then sequencing the obtained PCR amplification product to determine whether it carries the SV molecular marker to determine the main stem height of the cassava; Alternatively, the kit according to claim 4 or 5 is used to perform PCR amplification on the DNA of the cassava to be tested, and then the obtained PCR amplification product is sequenced to determine whether it carries the SV molecular marker to determine the main stem height of the cassava; If the cassava to be tested carries the SV molecular marker, the main stem height of the cassava to be tested is relatively high, and it is a tall cassava; otherwise, if the cassava to be tested lacks the SV molecular marker, the main stem height of the cassava to be tested is relatively low, and it is a short cassava suitable for machine type; The height of short-stem cassava is generally ≤140cm; the height of tall-stem cassava is generally >160cm.

8. The method for identifying the height of the cassava main stem according to claim 7, characterized in that: The PCR amplification system includes: 2× Rapid Taq Master Mix, the forward primer, the reverse primer, the DNA template of cassava to be tested and ddH2O; The reaction program of PCR amplification was: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s, 35 cycles; 72°C for 5 min.

9. A method for identifying the height of the main stem of cassava, characterized in that: The method comprises the following steps: using the primer set described in claim 3 to perform PCR amplification on the DNA of the cassava to be tested, then performing electrophoresis detection on the obtained PCR amplification product, and interpreting the electrophoresis detection result to determine the main stem height of the cassava to be tested; Alternatively, the DNA of the cassava to be tested is amplified by PCR using the kit described in claim 4 or 5, and the obtained PCR amplification product is then subjected to electrophoresis detection, and the electrophoresis detection result is interpreted to determine the main stem height of the cassava to be tested; When only a band of 1826 bp appears in the electrophoresis detection result, the cassava to be tested carries the SV molecular marker, and the main stem height of the cassava to be tested is relatively high, that is, the cassava with a tall stem; When only a 178bp band appears in the electrophoresis test result, the cassava to be tested lacks the SV molecular marker, and the main stem height of the cassava to be tested is relatively low, which is a dwarf cassava suitable for the machine; The height of short-stem cassava is generally ≤140cm; the height of tall-stem cassava is generally >160cm.

10. The method for identifying the height of the main stem of cassava according to claim 9, characterized in that: The PCR amplification system includes: 2× Rapid Taq Master Mix, the forward primer, the reverse primer, the DNA template of cassava to be tested and ddH2O; The reaction program of PCR amplification was: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s, 35 cycles; 72°C for 5 min.

Images