An SSR core primer combination, kit and application for identifying the tea tree variety "Danxia No. 1"

Abstract

The present invention discloses an SSR core primer combination, a kit and an application for identifying the tea cultivar "Danxia No. 1". By using the SSR fluorescence labeling detection technology, the present invention screens out 3 pairs of SSR core primers, and these 3 pairs of SSR core primers can quickly identify and detect "Danxia No. 1" from other tea cultivars. The SSR core primer combination disclosed by the present invention can be used for cultivar identification of "Danxia No. 1", overcomes the uncertainty of identification based on external morphological characteristics, has reliable and intuitive results, high detection efficiency, simple operation, and is also conducive to the popularization, utilization and protection of the cultivar "Danxia No. 1".

Description

Technical Field

[0001] The present invention relates to the technical field of identification of variety resources and germplasm innovation, and particularly relates to an SSR core primer combination, a kit and an application for identifying the tea tree variety "Danxia No. 1". Background Art

[0002] "Danxia No. 1" is an excellent tea tree variety selected from the wild population of Renhua white hair tea, belonging to small arbors. Its characteristics are as follows: middle leaf type, semi-spreading tree posture, relatively dense branches, plump buds and leaves, yellowish-green leaf color, abundant pubescence, strong cold and drought resistance, and suitable for making famous and high-quality black and white teas. The made black tea has a beautiful appearance, full of golden hairs, strong floral fragrance, strong and refreshing taste, and bright red soup color. The made white tea has a straight appearance, plump buds, full of white hairs, apricot-yellow and bright soup color, fresh and mellow taste, and tender and even leaf bottom.

[0003] The growth cycle of tea trees is relatively long. The traditional method for its identification only judges and identifies based on its external morphological characteristics, which is affected by factors such as the identification environment, cultivation measures, development stage, and the ability of the identifier, resulting in a problem of poor accuracy in its identification. Therefore, developing a better method for accurately and quickly identifying the "Danxia No. 1" variety has become a technical problem that needs to be solved urgently by those skilled in the art.

[0004] Molecular marker technology has become the future development direction of variety identification and protection due to its characteristics of being unaffected by the environment, high polymorphism, and short test cycle. Summary of the Invention

[0005] To overcome the above-mentioned defects and deficiencies in the prior art, the present invention provides an SSR core primer combination, a kit and an application for identifying the tea tree variety "Danxia No. 1".

[0006] The first object of the present invention is to provide an SSR core primer combination for identifying the tea tree variety "Danxia No. 1".

[0007] The second object of the present invention is to provide the application of the above SSR core primer combination in the preparation of an identification product for the tea tree variety "Danxia No. 1".

[0008] The third object of the present invention is to provide the application of a product containing the above SSR core primer combination in identifying the tea tree variety "Danxia No. 1".

[0009] The fourth object of the present invention is to provide a kit for identifying the tea tree variety "Danxia No. 1".

[0010] The fifth object of the present invention is to provide a method for identifying the tea tree variety "Danxia No. 1".

[0011] To achieve the above object, the present invention provides an SSR core primer combination for identifying the tea tree variety "Danxia No. 1", and the SSR core primer combination includes SSR core primers with nucleotide sequences shown as DX1.SSR-1-F, DX1.SSR-1-R, DX1.SSR-2-F, DX1.SSR-2-R, DX1.SSR-3-F, and DX1.SSR-3-R; wherein: the primer sequence of DX1.SSR-1-F is CCAAACACACCTGTCCCTGT; the primer sequence of DX1.SSR-1-R is TTGAAACGCCACCAGCAATG; the primer sequence of DX1.SSR-2-F is CTATGCACCACCACCGTCTT; the primer sequence of DX1.SSR-2-R is AATCGTTCCGTCCAACCGAA; the primer sequence of DX1.SSR-3-F is CCCGATCGAACCATCCGATT; the primer sequence of DX1.SSR-3-R is GTCACGACCGGAGTAGCAAT.

[0012] The 5' end of the SSR core primer shown by the nucleotide sequence DX1.SSR-1-F, the 5' end of the SSR core primer shown by the nucleotide sequence DX1.SSR-2-F, and / or the 5' end of the SSR core primer shown by the nucleotide sequence DX1.SSR-3-F are labeled with a fluorescent reporter group.

[0013] The fluorescent reporter group is FAM, HEX, TAMRA, or ROX.

[0014] Use of any of the above SSR core primer combinations in the preparation of an identification product for the tea tree variety "Danxia No. 1".

[0015] Use of a product containing any of the above SSR core primer combinations in the identification of the tea tree variety "Danxia No. 1".

[0016] A kit for identifying the tea tree variety "Danxia No. 1", which includes any of the above SSR core primer combinations.

[0017] The kit further includes HSTaq DNA polymerase, dNTPs, 10×Buffer, a positive control reference, a negative control reference, and ultrapure water.

[0018] A method for identifying the tea tree variety "Danxia No. 1", which uses any of the above SSR core primer combinations or kits for identification.

[0019] The method includes the following steps:

[0020] S1. Extract the genomic DNA of the tea tree sample to be tested;

[0021] S2. Using the genomic DNA extracted in step S1 as a template, perform PCR amplification using any of the above SSR core primer combinations.

[0022] S3. Type the PCR amplification products obtained in step S2, and perform band discrimination on the typing results:

[0023] The SSR core primers with nucleotide sequences shown as DX1.SSR-1-F and DX1.SSR-1-R amplify two characteristic bands of 180 bp and 182 bp, the SSR core primers with nucleotide sequences shown as DX1.SSR-2-F and DX1.SSR-2-R amplify a characteristic band of 170 bp, and the SSR core primers with nucleotide sequences shown as DX1.SSR-3-F and DX1.SSR-3-R only amplify a characteristic band of 170 bp, indicating that the tea tree sample to be tested is "Danxia No. 1"; the appearance of other bands indicates that the tea tree sample to be tested is not "Danxia No. 1".

[0024] The typing method in step S3 described above is to perform capillary electrophoresis on the PCR amplification products; for PCR amplification, the total reaction system is 10 μL, including: 1 μL of 10×Buffer I, 0.8 μL of 2.5 mM dNTPs, 0.6 μL of 2.5 μM upstream primer, 0.6 μL of 2.5 μM downstream primer, 0.1 μL of TAKARA HSTaq, 1 μL of DNA, and ddH2O is added to make up 10 μL; the PCR amplification reaction conditions are: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s; annealing at 60°C for 30 s for 35 cycles; extension at 72°C for 30 s; and finally extension at 60°C for 30 min.

[0025] Advantages and effects of the present invention:

[0026] The present invention discloses an SSR core primer combination, a kit and an application for identifying the tea tree variety "Danxia No. 1". The present invention uses SSR fluorescence labeling detection technology to screen out 3 pairs of SSR core primers, and these 3 pairs of SSR core primers can quickly identify and detect "Danxia No. 1" from other tea tree varieties. The SSR core primer combination disclosed by the present invention can accurately identify the variety of "Danxia No. 1", overcome the uncertainty of identification based on external morphological characteristics, has reliable and intuitive results, high detection efficiency, simple operation, and is also conducive to the popularization, utilization and protection of the variety of "Danxia No. 1". Description of the Drawings

[0027] Figure 1 Capillary electrophoresis bands of 22 tea tree varieties / lines amplified by the specific SSR core primers DX1.SSR-1-F and DX1.SSR-1-R in Example 1.

[0028] Figure 2 The capillary electrophoresis bands of 22 tea cultivars / lines amplified by the specific SSR core primers DX1.SSR-2-F and DX1.SSR-2-R in Example 1.

[0029] Figure 3 The capillary electrophoresis bands of 22 tea cultivars / lines amplified by the specific SSR core primers DX1.SSR-3-F and DX1.SSR-3-R in Example 1.

[0030] Figure 4 The capillary electrophoresis bands of 26 tea cultivars / lines amplified by the specific SSR core primers DX1.SSR-1-F and DX1.SSR-1-R in Example 2.

[0031] Figure 5 The capillary electrophoresis bands of 26 tea cultivars / lines amplified by the specific SSR core primers DX1.SSR-2-F and DX1.SSR-2-R in Example 2.

[0032] Figure 6 The capillary electrophoresis bands of 26 tea cultivars / lines amplified by the specific SSR core primers DX1.SSR-3-F and DX1.SSR-3-R in Example 2. Detailed implementation manners

[0033] The following specific examples are used to further illustrate the present invention, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the technical field.

[0034] Unless otherwise specified, the reagents and materials used in the following examples are all commercially available.

[0035] Example 1 Obtaining of the specific primer sequences of "Danxia No.1"

[0036] I. Experimental methods

[0037] 1. SSR primer design

[0038] The MISA software was used to retrieve the genomic sequences in the tea genome database (http: / / tpia.teaplants.cn / ), and the SSR loci in the genomic sequences were retrieved. 200 pairs of SSR primers were designed in batches using Primer 5.0, and the primers were synthesized by Beijing Yuewei Gene Technology Co., Ltd.

[0039] 2. Extraction of tea cultivar DNA

[0040] Twenty-two tea tree varieties / lines with similar genetic relationships and phenotypes, such as "Danxia No. 1", "Danxia No. 4", and "Danxia No. 30", were preliminarily screened. The specific tea tree varieties / lines used for the preliminary screening are shown in Table 1 (obtained from the Tea Germplasm Resource Bank of Guangdong Province).

[0041] Table 1 Twenty-two tea tree varieties / lines used for the preliminary screening

[0042]

[0043] Extract the DNA of the 22 tea tree varieties / lines (Table 1) used for the preliminary screening. The specific steps for DNA extraction are as follows:

[0044] a) Add liquid nitrogen to the tea tree leaves and grind them thoroughly. Weigh about 100 mg of the ground powder.

[0045] b) Quickly add 400 μL of buffer GPS and 10 μL of RNase A to the ground powder. After quickly vortexing and mixing evenly, place the centrifuge tube in a 65°C water bath for 15 minutes. During the water bath, invert the centrifuge tube several times to mix the samples.

[0046] c) Add 100 μL of buffer GPA, vortex for 1 minute, centrifuge at 12000 rpm for 5 minutes, transfer the supernatant to the filter column CS, then centrifuge at 12000 rpm for 1 minute, and transfer the filtrate to a new centrifuge tube.

[0047] d) Add an equal volume of absolute ethanol and mix well. At this time, flocculent precipitates may appear.

[0048] e) Transfer both the solution and the flocculent precipitate obtained in the previous step to the RNase-Free adsorption column CR2, centrifuge at 12000 rpm for 1 minute, pour out the waste liquid, and place the RNase-Free adsorption column CR2 in the collection tube.

[0049] f) Add 550 μL of deproteinization solution RD to the RNase-Free adsorption column CR2, centrifuge at 12000 rpm for 1 minute, pour out the waste liquid, and place the RNase-Free adsorption column CR2 in the collection tube.

[0050] g) Add 700 μL of washing solution PW to the RNase-Free adsorption column CR2, centrifuge at 12000 rpm for 1 minute, pour out the waste liquid, and place the RNase-Free adsorption column CR2 in the collection tube.

[0051] h) Repeat step g.

[0052] i) Place the RNase-Free adsorption column CR2 back into the collection tube, centrifuge at 12,000 rpm for 2 min, discard the collection tube, then transfer the RNase-Free adsorption column CR2 to a new centrifuge tube and air dry at room temperature for 5 - 10 min.

[0053] j) Add 50 - 100 μL of elution buffer TB to the RNase-Free adsorption column CR2, let it stand at room temperature for 3 - 5 min, centrifuge at 12,000 rpm for 2 min, and collect the solution into a centrifuge tube to obtain the genomic DNA of tea tree.

[0054] 3. PCR Amplification

[0055] Using the genomic DNA of tea tree extracted in step 2 above as a template, perform PCR amplification using SSR fluorescence labeling detection technology. The primers include an upstream primer labeled with a fluorescent reporter group at the 5' end (the fluorescent reporter group is FAM, HEX, TAMRA, or ROX, and FAM fluorescence labeling is used in the present invention) and a downstream primer. PCR amplification guided by the upstream primer labeled with a fluorescent reporter group at the 5' end produces a fluorescent PCR product.

[0056] For the PCR amplification, the total reaction system is 10 μL, including: 1 μL of 10×Buffer I, 0.8 μL of 2.5 mM dNTPs, 0.6 μL of 2.5 μM upstream primer, 0.6 μL of 2.5 μM downstream primer, 0.1 μL of TAKARA HSTaq, 1 μL of DNA, and ddH2O to make up to 10 μL.

[0057] The PCR amplification reaction conditions are: pre-denaturation at 95℃ for 5 min; denaturation at 94℃ for 30 s; annealing at 60℃ for 30 s for 35 cycles; extension at 72℃ for 30 s; and finally extension at 60℃ for 30 min.

[0058] 4. Genotyping Detection

[0059] Capillary electrophoresis detection: Add 9 μL of a mixture of molecular weight internal standard and formamide (volume ratio 0.5:8.5) and 1.0 μL of PCR product to each well of a 96-well plate; denature at 95℃ for 3 min and perform genotyping detection using a 3730XL DNA analyzer.

[0060] 5. Data Analysis

[0061] Import the original data file obtained by the 3730XL DNA analyzer into the analysis software genemapper ID 3.2 for band discrimination analysis.

[0062] II. Experimental Results

[0063] Three pairs of specific SSR core primers were screened out from 200 pairs of SSR primers, namely DX1.SSR-1-F, DX1.SSR-1-R, DX1.SSR-2-F, DX1.SSR-2-R, DX1.SSR-3-F and DX1.SSR-3-R. The primer sequences are shown in Table 2.

[0064] Table 2 Specific SSR core primer sequences

[0065]

[0066] The capillary electrophoresis band statistics results of these three pairs of specific SSR core primers amplifying 22 tea tree varieties / lines (Table 1) are shown in Table 3 and Figures 1 to 3 as follows. The results show that "Danxia No. 1" has characteristic bands, specifically:

[0067] (1) The specific SSR core primers DX1.SSR-1-F and DX1.SSR-1-R amplified two characteristic bands of 180bp and 182bp;

[0068] (2) The specific SSR core primers DX1.SSR-2-F and DX1.SSR-2-R amplified a characteristic band of 170bp;

[0069] (3) The specific SSR core primers DX1.SSR-3-F and DX1.SSR-3-R amplified a characteristic band of 170bp.

[0070] The above results indicate that the three pairs of specific SSR core primers can amplify characteristic bands for the tea tree variety "Danxia No. 1". Therefore, "Danxia No. 1" can be distinguished from the other 21 tea tree varieties / lines with similar genetic relationships and phenotypes.

[0071] Table 3 Capillary electrophoresis band statistics of three pairs of specific SSR core primers for 22 tea tree varieties / lines

[0072] Example 2

[0073] Further verification of three pairs of specific SSR core primers

[0074] I. Experimental method

[0075] The three pairs of specific SSR core primers DX1.SSR-1-F and DX1.SSR-1-R, DX1.SSR-2-F and DX1.SSR-2-R, DX1.SSR-3-F and DX1.SSR-3-R for identifying "Danxia No. 1" obtained by screening were further verified. Twenty-five tea tree varieties currently promoted and applied in production were selected for amplification detection simultaneously with "Danxia No. 1". The specific 26 tea tree varieties are shown in Table 4.

[0076] Table 4 shows 26 tea tree varieties currently promoted and applied in production

[0077]

[0078] The methods for extracting DNA of tea tree varieties, PCR amplification, genotyping detection, and data analysis were carried out according to Example 1.

[0079] II. Experimental Results

[0080] The capillary electrophoresis band statistical results of the three pairs of specific SSR core primers amplifying 26 tea tree varieties (Table 4) are shown in Table 5 and Figures 4 to 6 as follows. The results show that only "Danxia No. 1" showed characteristic bands, specifically:

[0081] (1) The specific SSR core primers DX1.SSR-1-F and DX1.SSR-1-R amplified two characteristic bands of 180 bp and 182 bp;

[0082] (2) The specific SSR core primers DX1.SSR-2-F and DX1.SSR-2-R amplified a characteristic band of 170 bp;

[0083] (3) The specific SSR core primers DX1.SSR-3-F and DX1.SSR-3-R amplified a characteristic band of 170 bp.

[0084] The above results show that the three pairs of specific SSR core primers can amplify specific allelic loci for the tea tree variety "Danxia No. 1". Therefore, "Danxia No. 1" can be distinguished from the other 25 tea tree varieties currently promoted and applied in production.

[0085] Table 5 Statistical results of capillary electrophoresis bands of 26 promoted and applied tea tree varieties

[0086]

[0087] Example 3

[0088] A method for identifying "Danxia No. 1" using a specific SSR core primer combination

[0089] 1. Extract the DNA of the tea tree variety "Danxia No. 1" according to the method of Example 1;

[0090] 2. Using the DNA extracted in step 1 as a template, perform PCR amplification with 3 pairs of specific SSR core primers DX1.SSR-1-F and DX1.SSR-1-R, DX1.SSR-2-F and DX1.SSR-2-R, DX1.SSR-3-F and DX1.SSR-3-R. The sequences of the 3 pairs of specific SSR core primers are as follows, where the 5' end of the upstream primer is labeled with a fluorescent reporter group (the fluorescent reporter group can be FAM, HEX, TAMRA or ROX, and HEX fluorescent labeling is used in the present invention):

[0091] DX1.SSR-1-F: CCAAACACACCTGTCCCTGT;

[0092] DX1.SSR-1-R: TTGAAACGCCACCAGCAATG;

[0093] DX1.SSR-2-F: CTATGCACCACCACCGTCTT;

[0094] DX1.SSR-2-R: AATCGTTCCGTCCAACCGAA;

[0095] DX1.SSR-3-F: CCCGATCGAACCATCCGATT;

[0096] DX1.SSR-3-R: GTCACGACCGGAGTAGCAAT.

[0097] 3. The PCR amplification method is carried out according to Example 1:

[0098] Perform genotyping detection and data analysis on the PCR products obtained in step 2. Both the genotyping detection and data analysis methods are carried out according to Example 1.

[0099] 4. Result interpretation:

[0100] If the amplification products of the 3 pairs of specific SSR core primers respectively show the following characteristic bands, it indicates that the tea tree variety to be tested is "Danxia No. 1"; if the following characteristic bands do not appear respectively, it indicates that the tea tree variety to be tested is not "Danxia No. 1":

[0101] (1) The specific SSR core primers DX1.SSR-1-F and DX1.SSR-1-R amplify two characteristic bands of 180bp and 182bp;

[0102] (2)The specific SSR core primers DX1.SSR-2-F and DX1.SSR-2-R amplified a characteristic band of 170 bp;

[0103] (3)The specific SSR core primers DX1.SSR-3-F and DX1.SSR-3-R amplified a characteristic band of 170 bp.

[0104] Example 4

[0105] A kit for identifying the tea cultivar "Danxia No. 1"

[0106] I. Composition

[0107] (1)3 pairs of specific SSR core primers, with the 5' ends of the upstream primers labeled with fluorescent reporter groups (the fluorescent reporter groups can be FAM, HEX, TAMRA or ROX, and HEX fluorescent labeling is used in the present invention):

[0108] DX1.SSR-1-F: CCAAACACACCTGTCCCTGT;

[0109] DX1.SSR-1-R: TTGAAACGCCACCAGCAATG;

[0110] DX1.SSR-2-F: CTATGCACCACCACCGTCTT;

[0111] DX1.SSR-2-R: AATCGTTCCGTCCAACCGAA;

[0112] DX1.SSR-3-F: CCCGATCGAACCATCCGATT;

[0113] DX1.SSR-3-R: GTCACGACCGGAGTAGCAAT.

[0114] (2)HSTaq DNA polymerase, dNTPs, 10× Buffer, positive control reference, negative control reference, ultrapure water.

[0115] II. Usage method

[0116] Perform detection and result interpretation according to the method of Example 3.

[0117] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. An SSR core primer combination for identifying the tea variety "Danxia No. 1", characterized in that: The SSR core primer combination comprises SSR core primers represented by nucleotide sequences of DX1.SSR-1-F, DX1.SSR-1-R, DX1.SSR-2-F, DX1.SSR-2-R, DX1.SSR-3-F and DX1.SSR-3-R; wherein: the primer sequence of DX1.SSR-1-F is CCAAACACACCTGTCCCTGT; the primer sequence of DX1.SSR-1-R is TTGAAACGCCACCAGCAATG; the primer sequence of DX1.SSR-2-F is CTATGCACCACCACCGTCTT; the primer sequence of DX1.SSR-2-R is AATCGTTCCGTCCAACCGAA; the primer sequence of DX1.SSR-3-F is CCCGATCGAACCATCCGATT; the primer sequence of DX1.SSR-3-R is GTCACGACCGGAGTAGCAAT.

2. The SSR core primer combination according to claim 1, characterized in that The 5' end of the SSR core primer shown in the nucleotide sequence DX1.SSR-1-F, the 5' end of the SSR core primer shown in the nucleotide sequence DX1.SSR-2-F and / or the 5' end of the SSR core primer shown in the nucleotide sequence DX1.SSR-3-F is labeled with a fluorescent reporter group.

3. The SSR core primer combination according to claim 2, characterized in that The fluorescent reporter group is FAM, HEX, TAMRA or ROX.

4. Use of the SSR core primer combination according to any one of claims 1 to 3 in preparing an identification product of the tea variety "Danxia No. 1", characterized in that: The SSR core primers represented by the nucleotide sequences of DX1.SSR-1-F and DX1.SSR-1-R amplify two characteristic bands of 180bp and 182bp, the SSR core primers represented by the nucleotide sequences of DX1.SSR-2-F and DX1.SSR-2-R amplify a characteristic band of 170bp, and the SSR core primers represented by the nucleotide sequences of DX1.SSR-3-F and DX1.SSR-3-R only amplify a characteristic band of 170bp, indicating that the tea tree sample to be tested is "Danxia No. 1"; the appearance of other bands indicates that the tea tree sample to be tested is not "Danxia No. 1".

5. Use of a product comprising the SSR core primer combination according to any one of claims 1 to 3 in identifying the tea variety "Danxia No. 1", characterized in that: The SSR core primers represented by the nucleotide sequences of DX1.SSR-1-F and DX1.SSR-1-R amplify two characteristic bands of 180bp and 182bp, the SSR core primers represented by the nucleotide sequences of DX1.SSR-2-F and DX1.SSR-2-R amplify a characteristic band of 170bp, and the SSR core primers represented by the nucleotide sequences of DX1.SSR-3-F and DX1.SSR-3-R only amplify a characteristic band of 170bp, indicating that the tea tree sample to be tested is "Danxia No. 1"; the appearance of other bands indicates that the tea tree sample to be tested is not "Danxia No. 1".

6. A kit for identifying the tea variety "Danxia No. 1", characterized in that: Comprising the SSR core primer combination described in any one of claims 1 to 3.

7. The kit according to claim 6, characterized in that The kit also includes HSTaq DNA polymerase, dNTPs, 10×Buffer, a positive control reference substance, a negative control reference substance, and ultrapure water.

8. A method for identifying the tea variety "Danxia No. 1", characterized in that: Identification is performed using the SSR core primer combination described in any one of claims 1 to 3 or the kit described in any one of claims 6 to 7. If the SSR core primers represented by the nucleotide sequences DX1.SSR-1-F and DX1.SSR-1-R amplify two characteristic bands of 180 bp and 182 bp, the SSR core primers represented by the nucleotide sequences DX1.SSR-2-F and DX1.SSR-2-R amplify a characteristic band of 170 bp, and the SSR core primers represented by the nucleotide sequences DX1.SSR-3-F and DX1.SSR-3-R amplify only one characteristic band of 170 bp, then it indicates that the tea tree sample to be tested is "Danxia No. 1"; if other bands appear, it indicates that the tea tree sample to be tested is not "Danxia No. 1".

9. A method for identifying the tea variety "Danxia No. 1", characterized in that: The following steps are involved: S1. Extracting genomic DNA from the tea tree sample to be tested; S2. Using the genomic DNA extracted in step S1 as a template, PCR amplification is performed using the SSR core primer combination described in any one of claims 1 to 3; S3. Typing the PCR amplification product obtained in step S2, and performing band discrimination on the typing result: The SSR core primers represented by the nucleotide sequences of DX1.SSR-1-F and DX1.SSR-1-R amplify two characteristic bands of 180bp and 182bp, the SSR core primers represented by the nucleotide sequences of DX1.SSR-2-F and DX1.SSR-2-R amplify a characteristic band of 170bp, and the SSR core primers represented by the nucleotide sequences of DX1.SSR-3-F and DX1.SSR-3-R only amplify a characteristic band of 170bp, indicating that the tea tree sample to be tested is "Danxia No. 1"; the appearance of other bands indicates that the tea tree sample to be tested is not "Danxia No. 1".

10. The method according to claim 9, characterized in that The typing method in step S3 is to perform capillary electrophoresis on the PCR amplification product; For PCR amplification, the total reaction system was 10 μL, including: 10×Buffer I 1 μL, 2.5 mM dNTPs 0.8 μL, 2.5 μM upstream primer 0.6 μL, 2.5 μM downstream primer 0.6 μL, TAKARA HSTaq 0.1 μL, DNA 1 μL, and ddH2O 10 μL; the PCR amplification reaction conditions were: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s; annealing at 60°C for 30 s for 35 cycles; extension at 72°C for 30 s; and finally extension at 60°C for 30 min.

Images