Molecular marker of rice disease-resistant gene Xa50 and application

Abstract

The invention discloses a molecular marker of a rice bacterial leaf blight resistant gene Xa50, the molecular marker is not only closely linked with the rice bacterial leaf blight resistant gene Xa50, but also co-separated from the resistant gene in plant offspring, so that a good way is provided for screening resistant rice varieties and molecular marker assisted breeding.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering and relates to a rice disease resistance gene Xa50 Molecular markers and their applications. Background Art

[0002] Rice ( Oryza sativa Rice (rice) is one of the most important food crops in my country and is also the staple food of more than half of the country's population. It plays a pivotal role in food production. Ensuring food supply is related to national security and development, and is the main task of promoting agricultural modernization. Rice is threatened by a variety of pathogens in production. Rice blast, bacterial leaf blight, and sheath blight are the three traditional diseases of rice. Rice bacterial blight (BB) is caused by the Gram-negative bacteria Xanthomonas Xanthomonas oryzae pv. rice , Xoo ) is a bacterial disease caused by rice, which seriously affects the yield and quality of rice. Chemical control and breeding of disease-resistant varieties are generally used in production to prevent and control rice bacterial blight, but chemical control is not only costly and ineffective, but also brings great harm to environmental development. Practice has proved that the discovery and use of new genes for resistance to rice bacterial blight is the most economical and effective way to prevent and control rice bacterial blight. At present, a total of 48 rice bacterial blight resistance genes (locus) have been discovered, including 31 recessive genes and 17 dominant genes. The isolation and cloning of rice bacterial blight resistance genes lays the foundation for analyzing the disease resistance mechanism and is also a prerequisite for breeding genes for bacterial blight resistance. At present, 16 rice bacterial blight resistance genes have been successfully isolated and cloned, including 4 recessive genes: xa5 , xa13 , xa25 and xa41(t) , 12 dominant genes: Xa1 and alleles Xa2 / Xa31(t) , Xa14 , Xa45(t) , Xa3 / Xa26 , Xa4 , Xa7 , Xa10 , Xa21 , Xa23 , Xa27 and Xa47 .

[0003] In recent years, with the rapid variation of pathogen virulence, the loss of resistance of major cultivated varieties, and the frequent occurrence of disastrous weather, rice blight has re-emerged in production, showing a trend of "old disease emerging again", which seriously threatens the sustainable development of rice production in my country. Therefore, it is of great significance to explore new rice blight resistance resources, improve the basic theory of disease resistance, and cultivate new varieties with excellent comprehensive traits and broad-spectrum and long-lasting disease resistance for the high and stable yield of rice in my country.

[0004] The inventors used molecular markers to Xa50 The markers were located between markers M11-588 and M11-602 at the end of rice chromosome 11, within a range of 147.7 kb. Xa50 We plan to use the genome sequence of rice Shuhui 498, which has been sequenced, to develop molecular markers that are more closely linked to genes. Xa50 Molecular markers that lock genes in intervals are used Xa50 Molecular marker-assisted breeding provides a basis. Summary of the invention

[0005] The present invention is based on the rice bacterial blight resistant material X315, which has obtained stable genetic resistance through inoculation phenotype identification and continuous multi-generation self-fertilization. The susceptible material was hybridized with it, and the results showed that the resistance of the material was controlled by a dominant single gene. Then, the rice genome reference sequence Shuhui 498 (R498) database (https: / / www.mbkbase.org / rice) and the IR24 sequence of the susceptible material were used to find the corresponding Xa50 Tightly linked molecular markers ultimately determine the location of the molecular markers of the present invention.

[0006] The invention provides a rice bacterial blight resistance gene Xa50 The linked molecular marker is located on chromosome 11 of rice, with a physical position of 30735670-30740239, wherein the amplified fragment of the susceptible rice variety is missing compared with that of the resistant variety.

[0007] The nucleotide sequence of the susceptible rice was 137 bp: GACGAAGAGACCCAGGAGCTGTCCCACATGTCAGTCACTTTAGCCTTGCTTGAGAAATAGAAGGATAGCCCGCTCCAGGCCAGGCCAAGCACGCTTAACCTTGGAGTTCTTTGGAGACTGGCTTCCGGAAAAGAAGT (SEQ ID No. 1), while the nucleotide sequence of the resistant rice was 265 bp: GACGAAGAGACCCAGGAGCTGTCCCACATGTCAGTCACTTTAGCCTTGCTTGAGAAATAGAAGGATAGCCCACTTATATCTGATAGCTTTTATAGGTCATAGACTGCCCTCACAGACCAACACATGTCTTTTCTGCACACTTTGTCCTCACTCATGTGCACCCGGAAAGAATTTTCCGGTTGGTCACCCATCCCAAATTGCTCCAGGCCAGGCCAAGCACGCTTAACCTTGGAGTTCTTTGGAGACTGGCTTCCGGAAAAGAAGT (SEQ ID No.2).

[0008] The present invention further provides a primer pair for identifying or assisting in identifying resistance to rice bacterial blight, which is based on the rice bacterial blight resistance gene Xa50 Designed with linked molecular markers.

[0009] Specifically, it consists of primer A and primer B; The primer A is as follows: a single-stranded DNA molecule represented by GACGAAGAGACCCAGGAGCTG (SEQ ID No. 3); The primer B is a single-stranded DNA molecule represented by ACTTCTTTTCCGGAAGCCAGTC (SEQ ID No. 4).

[0010] The present invention also provides an identification Xa50 A method for genetically conferring bacterial leaf streak resistance on rice plants or varieties, comprising the following steps: using the genomic DNA of the rice to be tested as a template, using the primer pair to perform PCR amplification to obtain a PCR product; and identifying the bacterial leaf streak resistance characteristics of the rice to be tested based on the PCR product: Specifically, when the above-mentioned specific primer pair is used for PCR amplification, the judgment criteria are as follows: If the size of the PCR product is 137 bp, the rice to be tested is a candidate susceptible rice variety; If the size of the PCR product is 265 bp, the rice to be tested is a candidate disease-resistant rice variety.

[0011] The present invention also provides the rice bacterial blight resistance gene Xa50 The invention relates to the application of linked molecular markers, the primer pairs and the method in identifying or assisting in identifying resistance to rice bacterial blight, or in screening and breeding of rice varieties related thereto.

[0012] The invention further provides application of the method in auxiliary breeding for cultivating rice varieties resistant to bacterial leaf streak disease.

[0013] Specifically, the rice material to be tested without a deletion fragment at the molecular marker is further selected for subsequent breeding to obtain rice varieties resistant to bacterial leaf streak disease.

[0014] More specifically, when the above-mentioned specific primer pair is used for PCR amplification, the rice material to be tested with a PCR product size of 265 bp is selected for subsequent breeding to obtain rice varieties resistant to bacterial leaf streak disease.

[0015] Molecular markers of the present invention and rice bacterial blight resistance genes Xa50 Not only is it tightly linked but it also co-segregates with the resistance gene in subsequent generations of plants, thus providing a good approach for screening resistant rice varieties and molecular marker-assisted breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Map of the rice bacterial blight gene Xa50.

[0017] Figure 2 Electrophoresis diagram of disease-resistant individual plants of F2 generation amplified by M11-533.

[0018] Figure 3 Electrophoresis diagram of susceptible plants in the F2 generation of M11-533 amplification.

[0019] Figure 4 Electrophoresis diagram of M11-533 amplified with different materials. DETAILED DESCRIPTION

[0020] The present invention is described below through specific implementation modes in order to better understand the present invention, but it does not constitute a limitation of the present invention.

[0021] Example 1

[0022] 1. Plant Materials The rice bacterial blight resistance material X315 has obtained stable genetic resistance through inoculation phenotype identification and continuous multi-generation self-pollination. The susceptible material IR24 is the female parent and X315 is the male parent for hybridization. The F1 is harvested individually and the F1 generation is propagated into the F2 generation segregation population, obtaining a total of 2342 individual plants.

[0023] The rice materials were cultivated at the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences and Shunyi Experimental Station in summer and at the Hainan Experimental Station of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences in winter, with conventional water and fertilizer management throughout the entire growth period.

[0024] 2. Cultivation and inoculation of Xanthomonas The Xanthomonas T174 used in this study originated from Japan and was stored at -80°C using the glycerol method. Thaw the Xanthomonas stored at -80°C on ice, spread evenly on NA solid medium, and invert at 28°C for about 3 days. Pick fresh colonies and spread them on new NA medium, invert at 28°C for about 2 days to allow the strain to reach a high activity. Elute the Xanthomonas with sterilized ddH2O, shake well, and adjust the OD using a spectrophotometer 600 The value is 1.0. The rice material was inoculated by the leaf cutting method. After the scissors were dipped in the bacterial solution, the fully expanded rice leaf tips were cut off by about 2 cm. Five leaves were cut for each plant, and at least 3 plants were inoculated with each strain. The length of the lesions was measured two weeks later, and the phenotype was determined. The resistance and sensitivity standards were: 20% was the resistance and sensitivity limit, >20% was susceptible, 16%-20% was moderately susceptible, 10%-15% was moderately resistant, and <10% was resistant.

[0025] 3. Genetic analysis of resistance X315 was crossed with wild type IR24 to obtain the F1 generation, which was inoculated with T7174 at the tillering stage. All F1 showed resistance to the disease. The F1 was self-pollinated to obtain the F2 segregation population, with a total of 2342 plants. T7174 was inoculated at the tillering stage, 1767 plants showed resistance to the disease, and 575 plants showed susceptible to the disease. The resistance-susceptibility segregation ratio was calculated and a chi-square test was performed, which proved that the resistance-susceptibility segregation ratio was in line with Mendel's classical genetic ratio of 3:1, indicating that the resistance of this material is controlled by a dominant single gene, and the F2 generation segregation population can be used for development Xa50 Positioning of molecular markers.

[0026] 4. Molecular marker primer design The rice genome reference sequence Shuhui 498 (R498) database (https: / / www.mbkbase.org / rice) and the IR24 sequence of this experiment were used to search for the Xa50Tightly linked molecular markers. According to the previous positioning results, the candidate gene was located at the end of rice chromosome 11. The R498 and IR24 sequences were compared within this interval to find the sequences with differences. The primers were designed using the Primer designing tool of the NCBI database (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / index.cgi?LINK_LOC=BlastHome). The product fragment range was about 100-500bp, and a total of 80 pairs of primers were designed.

[0027] 21 plants were selected from the F2 population, and linkage analysis was performed on the target gene using the polymorphic molecular markers screened. Based on the initial positioning results, new InDel molecular markers were designed within the interval, and the number of F2 disease-resistant plants was expanded to finely locate the gene, and finally determine the candidate interval.

[0028] 5. Genomic DNA Extraction The CTAB method was used to extract rice genomic DNA. The specific steps are as follows: (1) Weigh about 0.1 g of fresh leaves and place them at the bottom of a 2 mL centrifuge tube. Add two 3 mm diameter steel balls and place in a -80 °C refrigerator to cool for 30 min. Place in a plant cell disruptor and shake at 1000 rpm for 30 s to grind the rice leaves into powder. (2) Add 600 μL of CTAB extract to the centrifuge tube, mix the sample powder and extract thoroughly, and place in a 65°C water bath for 30 min. During this period, shake the centrifuge tube every 10 min to mix well. (3) Add 600 μL of chloroform solution to the centrifuge tube, shake the centrifuge tube vigorously to mix the sample and the liquid thoroughly, place it on a shaker for 10 min, let it stand for 2 min, and then centrifuge it at 12000 rpm for 10 min; (4) Pipette 400 μL of supernatant into a 1.5 mL centrifuge tube, add 400 μL of pre-cooled isopropanol solution, gently shake the centrifuge tube until flocculent precipitation appears, place in a -20°C refrigerator for 30 min, and then centrifuge at 12,000 rpm for 10 min; (5) Discard the supernatant, add 700 μL of 75% ethanol solution to the centrifuge tube, and centrifuge at 12000 rpm for 8 min; (6) Discard the supernatant and centrifuge the tube at 12,000 rpm for 30 seconds. Use a pipette to remove the remaining supernatant. After the tube is dry, add 200-400 μL ddH2O. After the DNA is completely dissolved, it can be used for subsequent experiments or stored at -20°C.

[0029] 6. PCR amplification and electrophoresis The PCR reaction system was a 20 μL system: 5 μL of 2×PCR reaction solution, 0.5 μL of each forward and reverse primer (10 μmol / L), and ddH2O was added to 20 μL. The PCR amplification program was: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, annealing at 55°C-60°C for 15 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 5 min. The PCR product was electrophoresed with 5% agarose gel (120 V constant voltage, about 15 min), and the gel was photographed and read on a gel imager after the electrophoresis.

[0030] 7.Xa50 Fine positioning 80 pairs of primers were used to amplify the DNA of X315 and IR24, and agarose gel electrophoresis detected 18 pairs of markers that were polymorphic between the parents. 80 pairs of primers were used as polymorphic markers to finely locate 575 F2 susceptible plants. M11-588 detected that two susceptible plants had parental bands, i.e., heterozygous bands, indicating that two plants had exchanged; M11-602 primers detected that one plant had parental bands, indicating that one plant had exchanged. Some polymorphic marker sequences are shown in Table 1. Since the exchanged plants detected by M11-588 and M11-602 were different, it was judged that Xa50 was between markers M11-588 and M11-602, with a physical distance of 147.7 kb ( Figure 1 ).

[0031] Table 1

[0032] Example 2 Molecular Detection of Individual Plants in F2 Population The polymorphic marker M11-533 was used to perform molecular detection on the F2 generation plants: M11-533 was used to amplify the disease-resistant plants, and two band types were amplified: a band type consistent with X315 and a heterozygous band type ( Figure 2 ); Using M11-533 marker to amplify susceptible plants, the DNA band patterns of all plants were consistent with the susceptible parent IR24, and there was no X315 band pattern, indicating that no chromosome exchange event occurred in the F2 susceptible plants ( Figure 3 ), the above results show that the marker M11-533 Xa50 Gene co-segregation.

[0033] Example 3 The marker M11-533 was used to perform molecular detection on different varieties. Since the marker M11-533 was co-separated with Xa50, the varieties containing the Xa50 gene could amplify a DNA fragment consistent with the X315 band pattern, and the PCR product was 265 bp. The DNA band pattern amplified by the varieties not containing Xa50 was inconsistent with the X315 band pattern, and the PCR product size was 137 bp. Figure 4 As shown. The amplification bands of materials NH001, NH036, NH042, NH057, NH079 and X315 were consistent, and the PCR product size was 265bp; no bands could be amplified from materials NH018, NH153N, H197, and NH196, and the PCR product size of NH212 and NH235 was 137bp. According to the artificial inoculation method in Example 1, the disease resistance of the test materials was identified. NH001, NH036, NH042, NH057, and NH079 were varieties resistant to bacterial blight; materials NH018, NH153N, H197, NH196, NH212, and NH235 were materials susceptible to bacterial blight (Table 2).

[0034] Table 2 Genotypes of tested rice varieties and identification results of bacterial leaf streak resistance .

Claims

1. A rice bacterial blight resistance gene XA50 The linked molecular markers are characterized by: It is located on chromosome 11 of rice, with a physical position of 30735670-30740239, and the amplified fragment in susceptible rice varieties is missing compared with that in resistant varieties.

2. The molecular marker according to claim 1, characterized in that The nucleotide sequence of the susceptible rice is shown in SEQ ID No. 1, which is 137 bp; while the nucleotide sequence of the resistant rice is shown in SEQ ID No. 1, which is 265 bp.

3. A primer pair for identifying or assisting in identifying resistance to rice bacterial blight, characterized in that: It is based on the rice bacterial blight resistance gene as claimed in claim 1 or 2 XA50 Designed with linked molecular markers.

4. The primer pair according to claim 3, characterized in that It consists of primer A and primer B; The primer A is a single-stranded DNA molecule as shown in SEQ ID No.3; The primer B is a single-stranded DNA molecule as shown in SEQ ID No.

4.

5. Identification XA50 A method for producing a rice plant or variety with genetically conferred resistance to bacterial leaf streak disease, characterized in that: The genomic DNA of the rice to be tested is used as a template and the primer pair described in claim 3 or 4 is used to perform PCR amplification to obtain a PCR product; and the bacterial leaf streak disease resistance characteristics of the rice to be tested are identified based on the PCR product.

6. The method according to claim 5, characterized in that: When the primer pair described in claim 4 is used for PCR amplification, the judgment criteria are as follows: If the PCR product size is 137 bp or there is no amplified band, the rice to be tested is a candidate susceptible rice variety; If the size of the PCR product is 265 bp, the rice to be tested is a candidate disease-resistant rice variety.

7. The rice bacterial blight resistance gene according to claim 1 or 2 XA50 Use of linked molecular markers, the primer pair as claimed in claim 3 or 4, and the method as claimed in claim 5 or 6 in identifying or assisting in identifying resistance to rice bacterial blight, or in screening and breeding of rice varieties related thereto.

8. Use of the method according to claim 5 or 6 in auxiliary breeding for cultivating rice varieties resistant to bacterial leaf streak disease.

9. The use according to claim 8, characterized in that The method further comprises selecting the rice material to be tested without a deletion fragment at the molecular marker for subsequent breeding to obtain a rice variety resistant to bacterial leaf streak disease.

10. The use according to claim 9, characterized in that When the primer pair described in claim 4 is used for PCR amplification, a rice material to be tested with a PCR product size of 265 bp is selected for subsequent breeding to obtain a rice variety resistant to bacterial leaf streak disease.

Images