SSR molecular marker primers associated with the number traits of Corydalis bulbocapnoides and their applications

Abstract

The present invention discloses SSR molecular marker primers associated with the number trait of Corydalis yanhusuo tubers and their applications, belonging to the technical field of molecular genetics. The SSR molecular marker primers associated with the number trait of Corydalis yanhusuo tubers disclosed by the present invention have nucleotide sequences as shown in SEQ ID NO.1 and 2. The SSR molecular markers associated with the number trait of Corydalis yanhusuo tubers and their amplification primers can be applied to the population structure analysis of Corydalis yanhusuo, the analysis of markers associated with the number trait of Corydalis yanhusuo tubers, the selection of excellent germplasms of Corydalis yanhusuo, and the preparation of kits for identifying the number of Corydalis yanhusuo tubers, and can be directly used for screening excellent germplasms, gene mapping and cloning, and molecular marker-assisted breeding. Moreover, they have chromosome mapping information, which is beneficial to further fine mapping and cloning of genes controlling the number trait of tubers, and is of great significance in the breeding of high-yield Corydalis yanhusuo.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular genetics, and particularly relates to SSR molecular marker primers associated with the number trait of Corydalis yanhusuo tubers and their applications. Background Art

[0002] Association analysis is a method for studying the inheritance of quantitative traits and has been widely used in the discovery of beneficial genes in crops. Association analysis can use natural populations as materials, and can simultaneously examine all alleles at the same locus in a large number of germplasm materials to find associated loci. SSR markers have the advantages of wide distribution, many allelic variations, co-dominance, good repeatability, reliable results, etc., and are widely used in association analysis, QTL mapping, marker-assisted breeding, and the construction of genetic linkage maps.

[0003] Corydalis yanhusuo W.T. Wang, also known as Yuanhu, is a plant of the genus Corydalis DC. in the family Papaveraceae Juss., and is widely distributed in Heilongjiang, Zhejiang, Jiangsu, Anhui, Hubei, Henan and other places in China. Corydalis yanhusuo is included in the pharmacopoeia and is used as medicine with dried tubers, having the effects of promoting blood circulation, regulating qi and relieving pain. In production, the multiplication coefficient of Corydalis yanhusuo is only about 5. For 100 - 150 kg of seed tubers, the high-yield situation is about 500 kg of yield. At present, the cultivation and management level of Corydalis yanhusuo is already very mature, and the space for increasing yield through cultivation techniques is very limited. Therefore, it is urgent to carry out the breeding work of high-yield Corydalis yanhusuo varieties.

[0004] The high-yield breeding of Corydalis yanhusuo is currently blank. The yield of Corydalis yanhusuo is mainly determined by two parts, the fresh weight of the mother tuber and the fresh weight of the newly generated daughter tubers. In production, Corydalis yanhusuo is sown with seed tubers, that is, mother tubers. During the subsequent growth and development process, some mother tubers will continue to grow, and some mother tubers will be depleted of nutrients and become empty. The changes in mother tubers are relatively limited. For the newly generated daughter tubers during the subsequent growth, their quantity and fresh weight directly affect the total yield. Through field trait investigation, it is found that when the sizes of the seed tubers are the same, the differences in the number of daughter tubers produced among different materials are significant, and correlation analysis shows that there is a highly significant positive correlation between the number of daughter tubers and the final yield. Therefore, increasing the number of Corydalis yanhusuo daughter tubers is one of the goals of high-yield breeding of Corydalis yanhusuo.

[0005] Traditional high-yield breeding of Corydalis yanhusuo not only has a long cycle, is time-consuming and laborious, but also because the investigation of the yield traits of Corydalis yanhusuo is for the underground part, it makes the trait investigation operation inconvenient and extremely destructive. Therefore, using molecular marker-assisted selection is not only convenient for the selection of excellent lines, but also can shorten the breeding cycle and reduce the breeding cost. Summary of the Invention

[0006] In view of the above problems existing in the prior art, the technical problems to be solved by the present invention are to provide SSR molecular marker primers associated with the number trait of Corydalis yanhusuo tubers. Another problem to be solved by the present invention is to provide the application of SSR molecular marker primers associated with the number trait of Corydalis yanhusuo tubers for screening excellent germplasms of Corydalis yanhusuo with a high number of tubers.

[0007] To solve the above technical problems, the technical solutions adopted by the present invention are as follows:

[0008] SSR molecular markers associated with the number trait of Corydalis yanhusuo tubers, wherein the SSR molecular marker is CYC4-8.

[0009] Amplification primers for SSR molecular markers associated with the number trait of Corydalis yanhusuo tubers, and the sequences of the amplification primers for the SSR molecular markers are shown as follows:

[0010] CYC4-8-F: 5’-CAGTGCATGCTTGATCACCT-3’,

[0011] CYC4-8-R: 5’-TAACTCCTCCAGAACCACGG-3’.

[0012] The application of the SSR molecular marker in the population structure analysis of Corydalis yanhusuo.

[0013] The application of the amplification primers of the SSR molecular marker in the population structure analysis of Corydalis yanhusuo.

[0014] The application of the SSR molecular marker in the analysis of markers associated with the number trait of Corydalis yanhusuo tubers.

[0015] The application of the amplification primers of the SSR molecular marker in the analysis of markers associated with the number trait of Corydalis yanhusuo tubers.

[0016] The application of the SSR molecular marker in the breeding of excellent germplasms of Corydalis yanhusuo.

[0017] The application of the amplification primers of the SSR molecular marker in the breeding of excellent germplasms of Corydalis yanhusuo.

[0018] The application of the SSR molecular marker in the preparation of a kit for screening excellent germplasms of Corydalis yanhusuo with a high number of tubers.

[0019] The application of the amplification primers of the SSR molecular marker in the preparation of a kit for screening excellent germplasms of Corydalis yanhusuo with a high number of tubers.

[0020] Compared with the prior art, the beneficial effects of the present invention are:

[0021] The present invention utilizes the Corydalis yanhusuo genome sequencing information (Dingqiao Xu, Ziqi Ye. et al. Haplotype-resolved genome assembly of Corydalis yanhusuo, a traditional Chinese medicine with unusual telomere motif, Horticulture Research, Volume 11, Issue 2, February 2024, uhad296) to discover and finally screen 24 SSR markers with clear bands and good polymorphism for polymorphism analysis, and synthesizes 24 pairs of amplification primers. Using the 24 pairs of SSR markers and their amplification primers, a regression analysis is performed on the individual genotypes and the number of daughter bulbs of Corydalis yanhusuo. Through the GLM program, associated loci for the number of daughter bulbs of Corydalis yanhusuo are detected. At a significance level of P<0.01, one marker CYC4-8 associated with the number of daughter bulbs trait is detected. The amplification product size of the CYC4-8 associated locus with the number of daughter bulbs trait is 130bp, and the phenotypic variation explanation rate is 23.23%. The SSR molecular markers of the present invention can be directly used for screening excellent germplasms with a high number of daughter bulbs, gene mapping and cloning, and molecular marker-assisted breeding. Moreover, they have chromosome mapping information, which is conducive to further fine mapping and cloning of genes controlling the number of daughter bulbs trait, and is of great significance in the breeding of high-yield Corydalis yanhusuo. Description of the Drawings

[0022] Figure 1 It is a ΔK analysis diagram in the Structure genetic structure analysis;

[0023] Figure 2 It is a genetic structure diagram when K = 4;

[0024] Figure 3 It is an electrophoresis diagram of the SSR marker CYC4-8 (M represents Marker 2000bp, and the red arrow indicates the associated locus). Detailed Embodiments

[0025] To make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described below in conjunction with specific embodiments. In the following embodiments, unless otherwise specified in detail, the technical means used are all conventional means well known to those skilled in the art.

[0026] Example 1

[0027] 1. Investigation and statistical analysis of the phenotypic traits of Corydalis yanhusuo

[0028] Ten days before the harvest of Corydalis yanhusuo, the fresh weight of daughter bulbs and the total fresh weight data of 41 individual plants were collected and investigated, and their maximum value, minimum value, range, standard deviation and coefficient of variation were statistically analyzed. The phenotypic data of 41 complete individual plants are shown in Table 1. The specific collection method of 41 individual plants is as follows: Randomly divide three plots of 10 cm in the middle of the field, and dig out all the Corydalis yanhusuo seedlings growing in the plots, and a total of 41 complete individual plants are obtained. 2 The results are shown in Table 2. There are great variations in the number of daughter bulbs among Corydalis yanhusuo individuals, and the coefficient of variation is 60%.

[0029] Table 1 Phenotypic data of 41 complete individual plants

[0030] Table 2 Variation of the number of daughter bulbs of Corydalis yanhusuo

[0031]

[0032] Table 3 Pearson coefficient between the number of daughter bulbs and the total fresh weight

[0033]

[0034] Use Graphpad to analyze the Pearson correlation between the number of daughter bulbs and the total yield.

[0035] The results are shown in Table 3. There is a very significant positive correlation between the number of daughter bulbs and the total fresh weight, and the correlation coefficient is 0.673.

[0036] Table 3 Pearson coefficient between the number of daughter bulbs and the total fresh weight

[0037]

[0038] Example 2

[0039] 1. Extract the genomic DNA of Corydalis yanhusuo

[0040] Use a new plant genomic DNA extraction kit (Shanghai Pudi Biology) to extract the DNA of fresh leaves of Corydalis yanhusuo individual plants X1-X24 in sequence. The extracted DNA products are detected by 1% agarose gel electrophoresis, and the DNA bands are clear and without degradation.

[0041] 2. Polymorphism analysis of SSR markers

[0042] Use the genomic sequencing information of Corydalis yanhusuo to discover SSR loci, select and synthesize 80 pairs of primers, and the primers are synthesized by Shanghai Sangon; use the extracted DNA as a template, and verify by PCR amplification with 80 pairs of primers, and detect the PCR amplification products by polyacrylamide gel electrophoresis.

[0043] The PCR amplification system is: 0.2 μL of 2.5 U / μL Taq DNA polymerase, containing 10 mM Mg 2+1.0 μL of 10× PCR reaction buffer, 0.2 μL each of 2.5 mM dNTPs, 0.5 μL each of 10 μM upstream and downstream primers, 0.5 μL of 40 ng / μL DNA template, and made up to 10 μL with ddH2O. The PCR reaction program was: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, for a total of 32 cycles; extension at 72°C for 10 min, and incubation at 4°C.

[0044] As shown in Table 4, a total of 24 SSR markers with clear bands and good polymorphism were finally screened for polymorphism analysis. The sequence information of 24 pairs of amplification primers is shown in Table 5.

[0045] Table 4 Polymorphism of 24 SSR markers

[0046]

[0047] Table 5 Sequences of 24 pairs of primers

[0048]

[0049] 3. Genetic structure analysis of SSR markers

[0050] The DNA of 24 individual Corydalis yanhusuo plants was subjected to PCR amplification using the 24 pairs of SSR primers screened out.

[0051] The 10 μL PCR amplification system was: 20 ng of genomic DNA, 2.5 mM MgCl2, 0.5 mM dNTPs, 20 ng of primers, and 0.5 U of Taq DNA polymerase.

[0052] The PCR reaction program was: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 58°C for 20 s, extension at 72°C for 30 s, for 32 cycles; and finally extension at 72°C for 5 min.

[0053] PCR products were detected using 10% polyacrylamide gel electrophoresis. The loading volume was 1.5 μL, the electrophoresis buffer was 1× TBE, the voltage was set at 220 V, and electrophoresis was carried out until the bromophenol blue band ran out of the bottom of the gel.

[0054] Silver staining of polyacrylamide gel: First, fix with a fixing solution (deionized water, 10% ethanol, 1% acetic acid) for 10 min, then soak in 1.5% silver nitrate solution for 10 min. After quickly washing twice with deionized water, develop with a developing solution (deionized water, 1.5% sodium hydroxide, 1% formaldehyde) for 10 min.

[0055] Electrophoresis data analysis: The amplification results of SSR primers were recorded in binary. Bands with the same mobility at the same locus were recorded as 1, and bands without were recorded as 0, obtaining the genotype data of 24 Corydalis yanhusuo materials; the population structure of Corydalis yanhusuo was analyzed using Structure 2.3.4 software in combination with the genotype data.

[0056] The results are as Figure 1 and Figure 2 shown. When K = 4, the △K value is the largest, indicating that it is most reasonable to divide the 24 Corydalis yanhusuo materials into 4 groups ( Figure 1 ); when K = 4, the genetic structure of the 24 Corydalis yanhusuo populations is as Figure 2 shown.

[0057] 4. Analysis of association markers for the number of daughter bulbs

[0058] Using the corresponding Q values of the 24 individual plants obtained from the Structure analysis (Table 6), the GLM program in Tassel5 software was used with the Q value as a covariate to perform a regression analysis on the original phenotypic values (Table 7) and marker variations of the number of daughter bulbs of individual Corydalis yanhusuo plants.

[0059] Table 6 Q value matrix of 24 individual plants

[0060]

[0061] Table 7 Original phenotypic values of the number of daughter bulbs of 24 Corydalis yanhusuo individual plants

[0062]

[0063] The results are shown in Table 8. At a significance level of P < 0.01, 1 marker CYC4 - 8 associated with the number of daughter bulbs was detected. The amplification product size of the CYC4 - 8 associated locus with the number of daughter bulbs trait was 130 bp ( Figure 3 ), and the phenotypic variation interpretation rate was 23.23%. The sequences of the amplification primers for CYC4 - 8 are as follows:

[0064] CYC4 - 8 - F: 5’ - CAGTGCATGCTTGATCACCT - 3’,

[0065] CYC4 - 8 - R: 5’ - TAACTCCTCCAGAACCACGG - 3’.

[0066] Table 8 Analysis of association markers for the number of daughter bulbs

[0067]

[0068] Example 3

[0069] A kit for screening excellent germplasms of Corydalis yanhusuo with a high number of daughter bulbs, the kit comprising the molecular marker combinations shown below:

[0070] The marker CYC4-8 associated with the trait of the number of daughter bulbs and its amplification primers, the sequences of the amplification primers being shown below:

[0071] CYC4-8-F: 5’-CAGTGCATGCTTGATCACCT-3’,

[0072] CYC4-8-R: 5’-TAACTCCTCCAGAACCACGG-3’.

[0073] Thus, it is possible to simply and accurately identify the number of daughter bulbs of Corydalis yanhusuo under different environments, different periods and different growth season conditions.

[0074] In summary, the SSR molecular markers and their primers developed in the present invention can be directly used for screening excellent germplasms with a high number of daughter bulbs, gene mapping and cloning, and molecular marker-assisted breeding, and have chromosome mapping information, which is beneficial to further fine mapping and cloning of the genes controlling the trait of the number of daughter bulbs, and is of great significance in the breeding of high-yield Corydalis yanhusuo.

Claims

1. Amplification primers of SSR molecular markers associated with the number trait of Corydalis turtschaninovii Bess. var. yanhusuo W. T. Wang & Hsiao tubers, characterized in that, The amplification primer sequences of the SSR molecular markers are as follows: CYC4-8-F: 5’-CAGTGCATGCTTGATCACCT-3’, CYC4-8-R: 5’-TAACTCCTCCAGAACCACGG-3’.

2. Use of the amplification primer of the SSR molecular marker associated with the number trait of Corydalis bulbocapnioides var. chekiangensis bulbils in the analysis of markers associated with the number trait of Corydalis bulbocapnioides var. chekiangensis bulbils as claimed in claim 1.

Images