Efficient RNA targeting of angiotensinogen (ARNATAR)

Abstract

Disclosed herein are high efficiency RNA targeting (ARNATAR) dsRNA compounds that target angiotensinogen (AGT). Such compounds are useful in methods of reducing AGT expression and therapeutically treating RAAS-related diseases, disorders and / or conditions or symptoms thereof in a subject.

Description

Technical Field

[0001] Certain embodiments relate to methods and compounds for regulating angiotensinogen (AGT) gene expression by highly efficient RNA targeting (ARNATAR). Such methods and compounds can be used to reduce the expression of AGT, thereby treating diseases, disorders and / or conditions associated with AGT in a subject. Background Art

[0002] Angiotensinogen (also known as AGT, SERPINA8 or ANHU) is a member of the serine protease inhibitor family and a component of the renin-angiotensin system (RAS) pathway, also known as the renin-angiotensin-aldosterone system (RAAS). It is primarily produced in the liver and released into the circulation, where renin converts it to angiotensin I. Angiotensin-converting enzyme (ACE) then converts angiotensin I to angiotensin II.

[0003] Angiotensin II is a peptide hormone that has multiple effects on the circulatory system that controls blood pressure and may contribute to hypertension. Angiotensin II causes vasoconstriction, which in turn increases blood pressure. Angiotensin II stimulates the adrenal cortex to secrete the hormone aldosterone. Aldosterone causes the kidneys to increase sodium reabsorption and regulation of glomerular filtration rate, which may increase body fluid volume and, in turn, increase blood pressure. Excessive amounts of angiotensin II can lead to dysregulation of the RAAS pathway and high blood pressure.

[0004] Chronic high blood pressure is known as hypertension. Hypertension in patients with high blood pressure requires the heart to work harder to circulate blood through the blood vessels. High blood pressure can lead to many harmful conditions in the body, such as increased oxidative stress, increased inflammation, hypertrophy, cardiac fibrosis, renal fibrosis, and arterial fibrosis, leading to left ventricular fibrosis, arterial remodeling, and glomerular sclerosis.

[0005] It is well known that hypertension is a major risk factor for various diseases, disorders and conditions, such as shortened life expectancy due to cardiovascular disease, chronic kidney disease, stroke, myocardial infarction, heart failure, vascular aneurysms (e.g., aortic aneurysms), peripheral arterial disease, heart damage (e.g., heart enlargement or hypertrophy), and other cardiovascular-related diseases, disorders and / or conditions.

[0006] Despite the availability of many antihypertensive drugs, the prevalence of refractory hypertension (RHTN), i.e., hypertension that is resistant to drug therapy, has been steadily increasing, likely due to an aging population and rising rates of obesity. Furthermore, commercially available antihypertensive therapies directed at various RAAS pathway components have been ineffective in completely inhibiting or blocking the RAAS pathway. The mechanism of this ineffective inhibition has not been fully elucidated, but may occur through ACE escape and / or aldosterone escape pathways. Therefore, new therapies are needed.

[0007] The use of therapeutic oligomeric compounds (eg, oligonucleotides) was first proposed by Stephenson and Zamecnik (Inhibition of Rous Sarcoma Viral RNA Translation by a Specific Oligodeoxyribonucleotide, PNAS, 1978, 75: 285-288) more than 40 years ago.

[0008] Fire et al. (Potent and Specific Genetic Interference by Double-Stranded RNA in Caenorhabditis elegans, Nature, 1998, 391: 806-811) discovered sequence-specific silencing of gene expression, namely RNA interference (RNAi) in 1998. RNAi uses double-stranded RNA (dsRNA) to inhibit gene expression through the RNA-induced silencing complex (RISC).

[0009] RISC comprises a complex of multiple proteins that interact with oligomeric compounds to inhibit gene expression. The oligomeric compound serves as a template for RISC to recognize complementary messenger RNA (mRNA) transcripts and to target specific mRNA transcripts for cutting. The cutting of target mRNA blocks the translation of the target mRNA, thereby silencing the target gene. The oligomeric compounds used by RISC include, but are not limited to, single-stranded oligomeric compounds (e.g., microRNA (miRNA)), certain oligonucleotides and single-stranded siRNA (Lima et al., Single-stranded siRNAs activate RNAi in animals. Cell. 2012, 150 (5): 883-94), and double-stranded RNA (dsRNA) compounds (e.g., short hairpin RNA (shRNA) and small interfering RNA (siRNA)).

[0010] In 2001, Elbashir et al. showed that 21-nucleotide-long siRNA duplexes specifically inhibited the expression of endogenous and exogenous genes in mammalian cell lines, and proposed the theory that siRNA could eventually be used as gene-specific therapy (Duplexes of 21-Nucleotide RNAs Mediate RNA Interference in Cultured Mammalian Cells, Nature, 2001, 411: 494-498).

[0011] The field of oligomeric therapeutic compounds continues to mature, and improvements in delivery, stability, specificity, safety, and potency are still sought to enhance the therapeutic efficacy of such oligomeric compounds.

[0012] Currently, several clinical trials are underway to evaluate nucleic acid-based therapeutics targeting AGT to treat hypertension. In clinical trials, siRNA therapeutics and antisense oligonucleotide (ASO) therapeutics are being evaluated (Ranasinghe et al., J Am Heart Assoc, 2022, 11 (20); Cruz-López et al., Hypertension, 2022, 79: 2115-2126; Morgan et al., Clinical Res, 2021, 6 (6): 4865-96), however, neither of these two nucleic acid therapeutics has received regulatory approval for patient treatment. Therefore, the demand for nucleic acid-based therapeutics targeting AGT remains unmet. Disclosed herein is a dsRNA compound targeting AGT, having an efficient RNA targeting (ARNATAR) capability that enhances its gene silencing activity. Summary of the invention

[0013] Several embodiments provided herein relate to the ARNATAR design dsRNA compounds that discover certain targeting AGT transcripts, which can enhance the effectiveness of regulating AGT gene expression. In several aspects, the dsRNA compound is a modified shRNA or siRNA compound. The double-stranded RNA compound comprises a sense strand and an antisense strand. The antisense strand can be completely or substantially complementary to the target nucleic acid.

[0014] In some embodiments, the double-stranded ribonucleic acid (dsRNA) compound for inhibiting the expression of angiotensinogen (AGT) in a cell comprises a sense strand and an antisense strand forming a double-stranded portion, wherein the antisense strand comprises any one of the antisense strand sequences in any of Tables 2, 5, 7, 9, 10, or 13.

[0015] In some embodiments, the double-stranded ribonucleic acid (dsRNA) compound for inhibiting the expression of angiotensinogen (AGT) in a cell comprises a sense strand and an antisense strand forming a double-stranded portion, wherein the sense strand comprises any one of the sense strand sequences in any of Tables 2, 5, 7, 9, 10, or 13.

[0016] In some embodiments, the double-stranded ribonucleic acid (dsRNA) compound for inhibiting the expression of angiotensinogen (AGT) in a cell comprises a sense strand and an antisense strand forming a double-stranded portion, wherein the sense strand comprises any one of the sense strand sequences in any of Tables 2, 5, 7, 9, 10, or 13, and wherein the antisense strand comprises the corresponding antisense strand sequence in any of Tables 2, 5, 7, 9, 10, or 13.

[0017] In one embodiment, the double-stranded ribonucleic acid (dsRNA) compound for inhibiting the expression of angiotensinogen (AGT) in a cell comprises a sense strand and an antisense strand forming a double-stranded portion, wherein the antisense strand comprises any one of the antisense strand sequences of Table 13, and wherein the sense strand comprises the corresponding sense strand sequence of Table 13.

[0018] In one embodiment, the double-stranded ribonucleic acid (dsRNA) compound for inhibiting the expression of angiotensinogen (AGT) in a cell comprises a sense strand and an antisense strand forming a double-stranded (duplex) portion, wherein the sense strand comprises the nucleotide sequence of SEQ ID NO: 61, and wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO: 62. In certain embodiments, the dsRNA compound comprises a conjugate. In certain embodiments, the conjugate is N-acetylgalactosamine (GalNAc). In certain embodiments, the conjugate is attached to the 3' end of the sense strand of the dsRNA compound targeting AGT. In certain embodiments, the conjugate is attached to the 3' end of the sense strand of the siRNA compound targeting AGT.

[0019] Certain embodiments provide a method of inhibiting the expression of angiotensinogen (AGT) in a subject, comprising the following steps: administering to the subject a dsRNA compound as described herein in an amount sufficient to inhibit the expression of AGT. In certain embodiments, the dsRNA compound inhibits the expression of AGT by at least about 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%. In certain embodiments, the dsRNA compound comprises siRNA.

[0020] In certain embodiments, a pharmaceutical composition for inhibiting the expression of angiotensinogen (AGT) in a cell is provided, the pharmaceutical composition comprising a double-stranded ribonucleic acid (dsRNA) compound described herein, or the pharmaceutical composition comprising a double-stranded ribonucleic acid (dsRNA) compound described herein in combination with a pharmaceutically acceptable carrier or excipient.

[0021] Certain embodiments provide a method of inhibiting the expression of angiotensinogen (AGT) in a cell, comprising contacting the cell with an amount of a dsRNA compound or pharmaceutical composition described herein sufficient to inhibit the expression of AGT, thereby inhibiting the expression of AGT in the cell.

[0022] Certain embodiments provide a method of treating a RAAS-associated disease, disorder and / or condition in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of a dsRNA compound or pharmaceutical composition described herein, thereby treating the RAAS-associated disease, disorder and / or condition in the subject.

[0023] Certain embodiments provide a method of treating a subject suffering from a disease, disorder, and / or condition that would benefit from reduced expression of angiotensinogen (AGT), comprising administering to the subject in need thereof a therapeutically effective amount of a dsRNA compound or pharmaceutical composition described herein, thereby treating the subject suffering from a disorder that would benefit from reduced expression of AGT.

[0024] Certain embodiments provide a method of preventing at least one symptom in a subject suffering from a disorder that would benefit from reduced expression of angiotensinogen (AGT), comprising administering to the subject in need thereof a prophylactically effective amount of a dsRNA compound or pharmaceutical composition described herein, thereby preventing at least one symptom in the subject suffering from a disorder that would benefit from reduced expression of AGT.

[0025] In certain embodiments, a kit is provided, comprising a dsRNA compound or pharmaceutical composition described herein, and optionally a label.

[0026] In one embodiment, a method for preparing the sense strand and / or antisense strand of a double-stranded ribonucleic acid (dsRNA) compound is provided, wherein the method comprises the following steps: a) preparing the sense strand and / or antisense strand by sequentially coupling modified and / or unmodified nucleotides via phosphoramidite oligonucleotide synthesis on a solid support; b) optionally, coupling a GalNAc-containing moiety to the sense strand and / or antisense strand on the solid support via phosphoramidite oligonucleotide synthesis; c) separating the sense strand and / or antisense strand from the solid support and removing the solid support; and d) optionally, further purifying the sense strand and / or antisense strand, optionally using chromatography.

[0027] In one embodiment, a method for preparing the sense strand and / or antisense strand of a double-stranded ribonucleic acid (dsRNA) compound is provided, wherein the method comprises the following steps: a) coupling a portion comprising GalNAc to the solid support by phosphoramidite oligonucleotide synthesis, b) coupling modified and / or unmodified nucleotides to the portion comprising GalNAc on the solid support by phosphoramidite oligonucleotide synthesis; c) sequentially coupling additional modified and / or unmodified nucleotides by phosphoramidite oligonucleotide synthesis to prepare the sense strand and / or antisense strand; d) separating the sense strand and / or antisense strand from the solid support and removing the solid support; and e) optionally, further purifying the sense strand and / or antisense strand, optionally using chromatography.

[0028] In one embodiment, a method for preparing a double-stranded ribonucleic acid (dsRNA) compound is provided, comprising: a) contacting the sense strand prepared according to any of the methods described herein with the antisense strand prepared according to any of the methods described herein in a solution at equimolar concentrations; b) optionally heating the solution to a temperature of about 94°C; c) optionally reducing the temperature of the solution to about 25°C.

[0029] Certain embodiments provide a double-stranded ribonucleic acid (dsRNA) compound for use in medicine.

[0030] Certain embodiments provide a double-stranded ribonucleic acid (dsRNA) compound for use in treating or preventing a RAAS-related disease, disorder, and / or condition in a subject. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 : Shows AGT siRNA inhibition screen in human primary hepatocytes after 48 hours of free uptake.

[0032] Figure 2 : Shown is a dose response curve of AGT siRNA on AGT expression (percent) 24 hours after transfection of AGT siRNA into Hep3B, comparing ARNATAR modification with third-party modification of the same sequence without GalNAc.

[0033] Figure 3 : Shows that the inhibitory activity of ARNATAR AGT siRNA ATsi483 in human primary hepatocytes after 42 hours of free uptake is comparable to that of the reference AGT siRNA ATXL-G.

[0034] Figure 4: Shown are in vivo AGT protein levels measured by ELISA in plasma following siRNA administration, demonstrating that ARNATAR AGT siRNA has comparable activity and durability to the reference AGT siRNA ATXL-G over a period of >4 weeks.

[0035] Figure 5 : Shown are in vivo plasma AGT protein levels following dosing with further modifications of the ARNATAR AGT siRNA, demonstrating that its activity and durability are comparable to the reference AGT siRNA ATXL-G over a 4 week time course.

[0036] Figure 6 : Shown are the in vitro inhibitory activities of ARNATAR-modified AGT siRNA and reference ATXL-G following 42 h of free uptake by human primary hepatocytes.

[0037] Figure 7 : Shown are in vivo plasma AGT protein levels for some ARNATAR AGT siRNAs that have lower in vitro activity but comparable or better in vivo activity than the reference ATXL-G.

[0038] Figure 8 : Shown is a dose response curve of AGT siRNA on AGT expression (percent) 8 or 12 hours after transfection of ARNATAR AGT siRNA into Hep3B, indicating that some ARNATAR siRNAs are more active than the reference ATXL-G.

[0039] Fig. 9 : Shows the percentage level of AGT protein in mouse plasma at different times after administration of 3 mg / kg siRNA, showing similar or better activity than the reference ATXL-G at several time points.

[0040] Fig.10 : Shows the percentage level of AGT protein in the plasma of AGT-AAV transgenic mice at different times after administration of 3 mg / kg siRNA, where the compound ATsi786 exhibits a stronger knockdown effect than the reference ATXL-G. DETAILED DESCRIPTION

[0041] It should be understood that the above general description and the following detailed description are exemplary and explanatory only and do not limit the claimed invention. Here, unless otherwise specifically stated, the use of the singular includes the plural. As used herein, unless otherwise specified, the use of "or" refers to "and / or". In addition, the use of the term "including" and other forms such as "includes" and "included" is not restrictive. In addition, unless otherwise specifically stated, terms such as "element" or "component" cover both elements and components comprising one unit and elements or components comprising more than one subunit.

[0042] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents or portions of documents cited in this application, including but not limited to patents, patent applications, articles, books, and papers, are hereby expressly incorporated by reference into the document portions discussed herein and their entire contents.

[0043] definition

[0044] Unless specific definitions are provided, the nomenclature and procedures and techniques used in connection with analytical chemistry, synthetic organic chemistry, medicinal chemistry, and pharmaceutical chemistry as described herein are well known and commonly used nomenclature and procedures and techniques in the art. Standard techniques can be used for chemical synthesis and chemical analysis. Where permitted, all patents, applications, published applications and other publications, GENBANK accession numbers and related sequence information obtained through databases such as the National Center for Biotechnology Information (NCBI), and other data mentioned in the disclosure of this text are incorporated by reference into the document sections and their entirety discussed herein.

[0045] Unless otherwise stated, the following terms have the following meanings:

[0046] "2'-O-methoxyethyl" (also known as 2'-MOE and 2'-O(CH2)2-OCH3) refers to an O-methoxy-ethyl modification of the 2' position of the furanose ring. A 2'-O-methoxyethyl modified sugar is a modified sugar.

[0047] "2'-MOE nucleosides" (also known as 2'-O-methoxyethyl nucleosides) refer to nucleosides comprising a 2'-MOE modified sugar moiety. "2'-MOE nucleotides" (also known as 2'-O-methoxyethyl nucleotides) refer to nucleotides comprising a 2'-MOE modified sugar moiety.

[0048] "2'-O-methyl" (also known as 2'-OCH3 and 2'-OMe) refers to an O-methyl modification of the 2' position of the furanose ring. A 2'-O-methyl modified sugar is a modified sugar.

[0049] "2'-OMe nucleosides" (also known as 2'-O-methyl nucleosides) refer to nucleosides comprising a 2'-OMe modified sugar moiety. "2'-OMe nucleotides" (also known as 2'-O-methyl nucleotides) refer to nucleotides comprising a 2'-OMe modified sugar moiety.

[0050] "2'-substituted nucleosides" refer to nucleosides that contain a substituent other than H or OH at the 2'-position of the furanose ring. In certain embodiments, 2'-substituted nucleosides include nucleosides with fluorine (2'-F), O-methyl (2'-OMe), O-methoxyethyl (2'-MOE) or bicyclic sugar modifications.

[0051] "5-methylcytosine" refers to cytosine modified with a methyl group attached to the 5 position. 5-Methylcytosine is a modified nucleobase.

[0052] "About" refers to within ±7% of a value. For example, if it is stated that "the compound affects at least about 70% inhibition of mRNA", it means that the inhibition rate of mRNA levels ranges from 63% to 77%.

[0053] "Animal" means human or non-human animals, including, but not limited to, mice, rats, rabbits, dogs, cats, domestic pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.

[0054] "Antibody" refers to a complete antibody molecule or any fragment or portion thereof, such as a heavy chain, light chain, F ab Part and F c part.

[0055] "Antisense oligonucleotide" or "ASO" refers to a single-stranded oligonucleotide having a nucleobase sequence that can hybridize to a corresponding region or fragment of a target nucleic acid. In certain embodiments, the antisense oligonucleotide comprises one or more ribonucleoside (RNA) residues and / or deoxyribonucleoside (DNA) residues.

[0056] "Base complementarity" refers to the ability of a nucleobase of an oligonucleotide to base pair (i.e., hybridize) with a corresponding nucleobase in a target nucleic acid, and is mediated by Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonds between the corresponding nucleobases. Base complementarity also refers to canonical (e.g., A:U, A:T, C:G) or non-canonical base pairing (e.g., A:G, A:U, G:U, I:U, I:A, I:C).

[0057] "Bicyclic sugar" refers to a furanose ring modified by bridging two non-geminal carbon atoms. Bicyclic sugars are modified sugars.

[0058] "Cap structure" or "terminal cap moiety" refers to a chemical modification that has been introduced at either terminus of an oligomeric compound.

[0059] "Chemical modification" refers to the modification of a molecular structure or element in a naturally occurring molecule. For example, a siRNA compound is composed of linked ribonucleosides (sometimes referred to herein as RNA), and therefore, replacing ribonucleosides with deoxyribonucleosides (sometimes referred to herein as DNA) is considered a chemical modification of the siRNA compound.

[0060] A "chemically distinct moiety" refers to a portion of an oligomeric compound that is chemically distinct in some way from another portion of the same oligomeric compound. For example, a moiety having 2'-OMe nucleotides is chemically distinct from a moiety having nucleotides without 2'-OMe modification.

[0061] "Chimeric oligomeric compound" refers to an oligomeric compound having at least two chemically distinct parts, each having multiple subunits. For example, as disclosed herein, an siRNA may comprise a peripheral part and a central part. The peripheral part comprises a motif having various modified or unmodified nucleobases to improve stability, specificity, safety and efficacy, while the central part comprises various modified or unmodified nucleobases as a substrate for RISC-mediated degradation.

[0062] "Complementarity" refers to the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.

[0063] "Adherence" in the context of therapy refers to a subject's compliance with the recommended therapy.

[0064] "Comprise", "comprises" and "comprising" will be understood to mean including the members specified but not excluding other (e.g., non-specified) members. For example, the specified steps or elements or groups of steps or groups of elements are included, respectively, but any other steps or elements or groups of steps or groups of elements are not excluded.

[0065] "Consecutive nucleobases" refers to nucleobases that are adjacent to each other.

[0066] "Deoxyribonucleotide" refers to a nucleotide with a hydrogen at the 2' position of the sugar portion of the nucleotide. Deoxyribonucleotide sequences are sometimes referred to herein as "DNA". Deoxyribonucleotides are sometimes referred to herein as "DNA nucleotides", "d nucleotides" or "D". Deoxyribonucleotides can be modified with any of a variety of substituents.

[0067] "Designing" or "designed" in the context of oligomeric compounds refers to the process of preparing / engineering an oligomeric compound that specifically hybridizes to a target nucleic acid molecule. Design generally encompasses mutations and / or modifications to, for example, a native sequence.

[0068] "Efficacy" refers to the ability to produce a desired effect.

[0069] "Expression" generally includes all functions that convert genetically encoded information into structures that exist and operate in cells. Such structures include, but are not limited to, transcription and / or translation products. In the present disclosure, expression refers to proteins that are expression products.

[0070] "Fully complementary" or "100% complementary" means that for every nucleobase of a first nucleic acid molecule there is a complementary nucleobase in a second nucleic acid molecule. In certain embodiments, the first nucleic acid molecule is an oligomeric compound and the target nucleic acid molecule is a second nucleic acid molecule.

[0071] A "fully modified motif" refers to an oligomeric compound comprising a sequence of consecutive nucleosides, wherein each nucleoside has a chemical modification.

[0072] "GalNAc" refers to the compound N-acetylgalactosamine or a compound comprising an N-acetylgalactosamine compound. A GalNAc-containing moiety (or sometimes just "GalNAc" or "GalNAc moiety" is used herein) describes a compound comprising at least one N-acetylgalactosamine compound, which is typically attached to one or more spacers and / or linkers to attach an oligonucleotide compound.

[0073] "Hybridization" refers to the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, a combination of an oligomeric compound and a nucleic acid molecule target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, a combination of siRNA and a nucleic acid molecule target (particularly an mRNA target molecule).

[0074] "Induce," "inhibit," "enhance," "elevate," "increase," "decrease," etc., generally denote an action that achieves a quantitative difference between two states.

[0075] "Inhibiting expression or activity" refers to a reduction or blockade of expression or activity, and does not necessarily mean that the expression or activity is completely eliminated.

[0076] "Internucleoside bond" refers to a chemical bond between two adjacent nucleosides. The bond may be a naturally occurring bond, i.e., a phosphate bond, or may be an artificial bond, such as a phosphorothioate (also known as thiophosphate or PS) bond.

[0077] "Linked nucleosides" refers to adjacent nucleosides (e.g., A, G, C, T, U, and I) linked together by an internucleoside bond. Examples of linked nucleosides include deoxyribonucleoside (sometimes referred to herein as DNA) sequences or ribonucleoside (sometimes referred to herein as RNA) sequences.

[0078] "Mismatch" or "non-complementary nucleobase" refers to a situation where a nucleobase of a first nucleic acid cannot pair with the corresponding nucleobase of a second or target nucleic acid via Watson-Crick base pairing (eg, A:T, A:U, C:G).

[0079] "Modified internucleoside linkage" refers to a substitution or any change in a naturally occurring internucleoside linkage (ie, a phosphodiester internucleoside linkage).

[0080] "Modified nucleobase" refers to any nucleobase other than adenine, cytosine, guanine, thymidine or uracil. "Unmodified nucleobase" refers to the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).

[0081] "Modified nucleosides" refer to nucleosides with modified sugar moieties and / or modified nucleobases. As used herein, when the oligomeric compound is based on RNA, the substitution of deoxyribonucleosides (sometimes referred to herein as DNA nucleosides) for ribonucleosides is considered to be a modification of the oligomeric compound. In addition, when the oligomeric compound is based on DNA, the substitution of ribonucleosides (sometimes referred to herein as RNA nucleosides) for deoxyribonucleosides is considered to be a modification of the oligomeric compound.

[0082] "Modified nucleotides" refer to nucleotides having at least one of a modified sugar moiety, a modified internucleoside linkage, a substitution of a deoxyribonucleoside (sometimes referred to herein as a DNA nucleotide) for a ribonucleoside (sometimes referred to herein as an RNA nucleotide), a substitution of a ribonucleoside (sometimes referred to herein as an RNA nucleoside) for a deoxyribonucleoside (sometimes referred to herein as a DNA nucleoside), and a modified nucleobase.

[0083] A "modified oligonucleotide" refers to an oligonucleotide comprising at least one of a modified internucleoside linkage, a modified sugar, a substitution of a deoxyribonucleoside (sometimes referred to herein as a DNA nucleoside) for a ribonucleoside (sometimes referred to herein as an RNA nucleoside), a substitution of a ribonucleoside (sometimes referred to herein as an RNA nucleoside) for a deoxyribonucleoside (sometimes referred to herein as a DNA nucleoside), and / or a modified nucleobase.

[0084] "Modified sugar" refers to a substitution and / or any change in the natural sugar moiety of a nucleotide in DNA or RNA.

[0085] "Moiety" refers to one of the parts into which something is divided, i.e., a part or component of something. For example, the sugar moiety of a nucleotide is the sugar component of the nucleotide.

[0086] "Monomer" refers to a single unit of an oligomer or a single unit that forms an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occurring or modified.

[0087] "Motif" refers to the pattern of modifications in an oligomeric compound. For example, as disclosed herein, ARNATAR designed oligomeric compounds comprising motifs with various modified nucleobases and internucleoside bonds to improve the delivery, stability, specificity, safety and efficacy of the compounds.

[0088] "Natural sugar (moiety)" or generally "sugar (moiety)" refers to the sugar (moiety) in DNA (2'-H) or RNA (2'-OH), 2-deoxy-β-D-ribofuranose or β-D-ribofuranose, respectively.

[0089] A "naturally occurring internucleoside linkage" refers to a 3' to 5' phosphodiester bond.

[0090] "Non-complementary nucleobases" refers to a pair of nucleobases that do not hydrogen bond with each other or otherwise support hybridization.

[0091] "Nucleic acid (molecule)" refers to a monomeric nucleotide sequence. Nucleic acid molecules include, but are not limited to, ribonucleic acid (RNA), messenger RNA (mRNA), deoxyribonucleic acid (DNA), single-stranded nucleic acid, double-stranded nucleic acid, small interfering ribonucleic acid (siRNA), hairpin ribonucleic acid (shRNA) and microRNA (miRNA).

[0092] "Nucleobase" refers to any unmodified nucleobase, any modified nucleobase and / or any artificial nucleobase as defined above, and generally may be any heterocyclic moiety capable of base pairing with a nucleic acid molecule.

[0093] "Nucleobase complementarity" refers to the ability of a nucleobase to base pair with another nucleobase (also called complementarity). If a nucleobase at a certain position of an oligomeric compound is able to form a hydrogen bond with a nucleobase at a certain position of a target nucleic acid molecule, the hydrogen bonding position between the oligomeric compound and the target nucleic acid molecule is considered to be complementary at that nucleobase pair. For example, in DNA, adenine (A) is complementary to thymine (T); in RNA, adenine (A) is complementary to uracil (U); and, in both DNA and RNA, guanine (G) is complementary to cytosine (C). Base pairs or complementary nucleobases are typically canonical Watson-Crick base pairs (C:G, A:U, A:T), but also include non-canonical base pairs, such as Hoogsteen base pairs (e.g., A:G, A:U), Wobble base pairs (e.g., G:U, I:U, I:A, I:C, where I is hypoxanthine), etc. Nucleobase complementarity facilitates hybridization of an oligomeric compound described herein to its target nucleic acid.

[0094] "Nucleobase sequence" refers to the contiguous order of nucleobases independent of any sugar, linkage and / or nucleobase modifications.

[0095] "Nucleoside" refers to a nucleobase linked to a natural or modified sugar as defined above.

[0096] "Nucleoside mimetics" include sugars or sugars and bases for replacing one or more positions of an oligomeric compound, but not necessarily those structures of a bond, such as nucleoside mimetics with morpholinyl, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclic or tricyclic sugar mimetics (e.g., non-furanose units). Nucleotide mimetics include those structures of nucleosides and bonds for replacing one or more positions of an oligomeric compound, such as peptide nucleic acids or morpholinyl (morpholinyl through -N(H)-C(=O)-O- or other non-phosphodiester bonds). Sugar substitutes overlap with slightly broader terms nucleoside mimetics, but are only used to represent the replacement of sugar units (furanose rings). The tetrahydropyranyl ring provided herein illustrates examples of sugar substitutes, in which the furanose group has been replaced by a tetrahydropyranyl ring system. "Mimetic" refers to a group that replaces a sugar, a nucleobase and / or a nucleoside bond. Typically, a mimetic is used to replace a sugar or a sugar nucleoside bond combination, and a nucleobase is retained to hybridize with a selected target.

[0097] "Nucleotide" refers to a nucleoside having a linking group (e.g., a phosphate (P) or phosphorothioate (PS) group) covalently attached to the sugar portion of the nucleoside. Nucleotides include ribonucleotides and deoxyribonucleotides having phosphate bonds and / or phosphorothioate bonds. A sequence of linked nucleotides (e.g., ribonucleotides, deoxyribonucleotides, and / or mixtures thereof) forms an oligonucleotide.

[0098] "Off-target effect" refers to an undesirable or deleterious biological effect associated with the regulation of RNA or protein expression of a gene other than the intended target nucleic acid.

[0099] "Oligomerization activity" refers to any detectable or measurable activity attributable to the hybridization of an oligomeric compound with its target nucleic acid. In certain embodiments, oligomerization activity is measured by a reduction in the amount or expression of the target nucleic acid. Oligomerization activity can be regulated by oligomeric compounds (e.g., dsRNA). Oligomerization activity can be regulated by oligomeric compounds (e.g., siRNA).

[0100] "Oligomeric compound" refers to a compound of connected monomer subunits (also referred to herein as "subunits") that can be hybridized to at least one region of a target nucleic acid through hydrogen bonds. The monomer subunits are specifically modified or unmodified nucleotides or nucleosides, and the oligomeric compound is specifically an oligonucleotide. The oligomeric compound serves as a template for RISC to recognize complementary messenger RNA (mRNA) transcripts to target specific mRNA transcripts for cutting. Cutting of target mRNA blocks the translation of the target mRNA and silences the target gene. Examples of oligomeric compounds include single-stranded compounds and double-stranded compounds, such as antisense oligonucleotides, ssRNA, siRNA, shRNA, and miRNA. Typically, the difference between oligomeric compounds and polymers is based on their number of monomers, wherein oligomers typically have about 5 to about 100 monomer units.

[0101] "Oligomerization inhibition" refers to a decrease in the level of a target nucleic acid (eg, mRNA) in the presence of an oligomeric compound that is complementary to the target nucleic acid, compared to the level of the target nucleic acid in the absence of the oligomeric compound.

[0102] "Oligomerization mechanism" includes RISC or RNase H related mechanisms involving hybridization of an oligomeric compound to a target nucleic acid (eg, mRNA), wherein the result or effect of the hybridization is target degradation and inhibition of gene expression.

[0103] As used herein, "oligonucleotide" refers to nucleosides and / or nucleotide sequences connected, wherein each can be modified or unmodified independently of each other. Oligonucleotide can have a linking group (e.g., phosphorothioate group) except the phosphate group, used as a linking portion between nucleosides. In certain embodiments, oligonucleotide comprises one or more ribonucleoside (RNA) residues and / or deoxyribonucleoside (DNA) residues.

[0104] "Phosphorothioate bond" or "PS" refers to a bond between nucleosides in which the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate bond is a modified internucleoside bond.

[0105] "Portion" refers to a defined number of continuous (i.e., connected) nucleobases in a nucleic acid. In certain embodiments, a portion is a defined number of continuous nucleobases in a target nucleic acid. In certain embodiments, a portion is a defined number of continuous nucleobases in an oligomeric compound.

[0106] A "region" is defined as a portion of a target nucleic acid having at least one identifiable structure, function, or characteristic.

[0107] "RNA" or "ribonucleic acid" consists of ribose nucleotides or ribonucleotides (nitrogenous bases attached to ribose sugars) linked by phosphodiester bonds to form sequences of varying lengths. The nitrogenous bases in RNA are adenine, guanine, cytosine, and uracil.

[0108] "Ribonucleotide" refers to a nucleotide having a hydroxyl group at the 2' position of the nucleotide sugar portion. Ribonucleotides may be modified with any of a variety of substituents and may be linked by covalent bonds rather than naturally occurring phosphodiesters (e.g., phosphorothioates). Ribonucleotides are sometimes referred to herein as RNA, "R" or "r".

[0109] A "fragment" is defined as a smaller portion or subportion of a region within a nucleic acid molecule, particularly a target nucleic acid.

[0110] As used herein, a "site" is defined as a unique nucleobase position within a nucleic acid, particularly a target nucleic acid.

[0111] "Specifically hybridizable" refers to an oligomeric compound in which the degree of complementarity between the oligomeric compound (e.g., siRNA) and the target nucleic acid (e.g., mRNA) is sufficient to induce the desired effect, while exhibiting minimal or no effect on non-target nucleic acids under conditions requiring specific binding, i.e., physiological conditions for in vivo assays and therapeutically effective treatments.

[0112] "Stringent hybridization conditions" or "stringent conditions" refer to conditions under which an oligomeric compound hybridizes to its target nucleic acid, while minimizing hybridization to other nucleic acid molecules.

[0113] "Subject" refers to a human or non-human animal, particularly a human or non-human animal selected for treatment or therapy.

[0114] "Target" generally refers to a protein molecule or a nucleic acid molecule that needs to be regulated. As used herein, "target" specifically refers to a nucleic acid molecule (eg, mRNA) that needs to be regulated.

[0115] "Target gene" refers to a gene encoding a target.

[0116] "Targeting" refers to the process of designing and selecting oligomeric compounds that specifically hybridize to a target nucleic acid and induce a desired effect.

[0117] "Target nucleic acid," "target RNA," "target RNA transcript," and "nucleic acid target" all refer to a nucleic acid that can be targeted by an oligomeric compound.

[0118] "Target region" refers to a portion of a target nucleic acid to which one or more oligomeric compounds are targeted.

[0119] "Target fragment" refers to the nucleotide sequence of the target nucleic acid targeted by the oligomeric compound. "5' target site" refers to the 5'-most nucleotide in the target fragment. "3' target site" refers to the 3'-most nucleotide in the target fragment. In embodiments, the target fragment is at least a 13-nucleobase portion (i.e., at least 13 consecutive nucleobases) of the target region targeted by the oligomeric compound.

[0120] "Therapeutic efficacy" or "therapeutically effective" refers to the effectiveness of a compound or composition (e.g., an oligomeric compound described herein) in a therapeutic application. Therapeutic efficacy can be improved by improving the delivery, stability, specificity, safety, and / or efficacy of a therapeutic compound.

[0121] "Unmodified" RNA nucleobases refer to the purine bases adenine (A) and guanine (G), and the pyrimidine bases cytosine (C) and uracil (U). "Unmodified" DNA nucleobases refer to the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T) and cytosine (C). In certain embodiments, when a DNA nucleobase replaces an RNA nucleobase in an oligomeric compound (e.g., siRNA compound), the unmodified RNA nucleobase is considered to be modified. In certain embodiments, when an RNA nucleobase replaces a DNA nucleobase in a DNA sequence, the unmodified DNA nucleobase is considered to be modified.

[0122] "Unmodified nucleoside" refers herein to a nucleoside composed of a naturally occurring nucleobase and a naturally occurring sugar moiety. In certain embodiments, the unmodified nucleoside is an RNA nucleoside in an oligomeric compound (eg, a siRNA compound).

[0123] "Unmodified nucleotides" herein refer to nucleotides consisting of naturally occurring nucleobases, naturally occurring sugar moieties, and internucleoside bonds, wherein the internucleotide bonds may be naturally occurring bonds (i.e., phosphate bonds) or artificial bonds (e.g., phosphorothioate bonds). In certain embodiments, unmodified nucleotides are RNA nucleotides in oligomeric compounds (e.g., siRNA compounds).

[0124] Disclosed herein are improved compounds targeting nucleic acids encoding angiotensinogen (AGT) with a highly efficient RNA targeting (ARNATAR) design that enhances its gene silencing activity. In certain embodiments, the compound is a double-stranded ribonucleic acid (dsRNA) compound. In embodiments, the dsRNA compound is a shRNA or siRNA compound.

[0125] In some embodiments, a double-stranded ribonucleic acid (dsRNA) compound for inhibiting the expression of angiotensinogen (AGT) in a cell comprises a sense strand and an antisense strand forming a double-stranded portion, wherein the antisense strand comprises any one of the antisense nucleotide sequences in any one of Tables 2, 5, 7, 9, 10, or 13. In certain embodiments, the dsRNA compound is a siRNA compound, wherein the antisense strand comprises any one of the antisense nucleotide sequences in any one of Tables 2, 5, 7, 9, 10, or 13. In certain embodiments, the siRNA compound comprises an oligomeric sequence as shown in Table 2, 5, 7, 9, 10, or 13. In certain embodiments, the oligomeric sequence comprises a 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotide long portion of any sequence shown in Table 2, 5, 7, 9, 10, or 13. In some embodiments, the dsRNA (e.g., siRNA) compound comprises the antisense strand of any one of the antisense nucleotide sequences in Table 13. In some embodiments, the dsRNA (e.g., siRNA) compound comprises the antisense strand of any one of the antisense nucleotide sequences of SEQ ID NO: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 28, 30, 32, 35, 37, 39, 42, 44, 46, 47, 50, 52, and 54. In a specific embodiment, the dsRNA (e.g., siRNA) compound comprises the antisense strand of the nucleotide sequence of SEQ ID NO: 62. In one embodiment, the dsRNA (e.g., siRNA) compound comprises a portion of 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides long of the sequence of SEQ ID NO: 62. In preferred embodiments, the dsRNA (eg, siRNA) compound comprises the antisense strand of SEQ ID NO: 9 or 19, or a 13, 14, 15, 16, 17, 18, 19 or 20 nucleotide long portion thereof.

[0126] In one embodiment, a double-stranded ribonucleic acid (dsRNA) compound for inhibiting the expression of angiotensinogen (AGT) in a cell comprises a sense strand and an antisense strand forming a double-stranded portion, wherein the sense strand comprises any one of the sense nucleotide sequences in any one of Tables 2, 5, 7, 9, 10, or 13. In certain embodiments, the dsRNA compound is an siRNA compound, wherein the sense strand comprises any one of the sense nucleotide sequences in any one of Tables 2, 5, 7, 9, 10, or 13. In certain embodiments, the siRNA compound comprises an oligomeric sequence as shown in Table 2, 5, 7, 9, 10, or 13. In certain embodiments, the oligomeric sequence comprises a portion of 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotides long of any sequence shown in Tables 2, 5, 7, 9, 10, or 13. In some embodiments, the dsRNA (e.g., siRNA) compound comprises a sense strand nucleotide sequence in Table 13. In some embodiments, the dsRNA (e.g., siRNA) compound comprises a sense strand of any one of the sense nucleotides of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 27, 29, 31, 33, 34, 36, 38, 40, 41, 43, 45, 48, 49, 51, 53, and 55. In a specific embodiment, the dsRNA (e.g., siRNA) compound comprises a sense strand nucleotide sequence of SEQ ID NO: 61. In one embodiment, the dsRNA (e.g., siRNA) compound comprises a 13, 14, 15, 16, 17, 18, 19, or 20 nucleoside long portion of the sequence of SEQ ID NO: 61. In a preferred embodiment, the siRNA compound comprises the sense strand of the sequence of SEQ ID NO: 8, 33 or 55, preferably 55, or a portion thereof that is 13, 14, 15, 16, 17, 18, 19 or 20 nucleosides long.

[0127] In one embodiment, a double-stranded ribonucleic acid (dsRNA) compound for inhibiting the expression of angiotensinogen (AGT) in a cell comprises a sense strand and an antisense strand forming a double-stranded portion, wherein the sense strand comprises any one of the sense nucleotide sequences in any of Table 2, Table 5, Table 7, Table 9, Table 10, or Table 13, and wherein the antisense strand comprises any one of the antisense nucleotide sequences in any of Table 2, Table 5, Table 7, Table 9, Table 10, or Table 13. In certain embodiments, the dsRNA compound is a siRNA compound, wherein the sense strand comprises any one of the sense nucleotide sequences in any of Table 2, Table 5, Table 7, Table 9, Table 10, or Table 13, and wherein the antisense strand comprises any one of the antisense nucleotide sequences in any of Table 2, Table 5, Table 7, Table 9, Table 10, or Table 13. In certain embodiments, the sense strand or antisense strand comprises a 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleotide long portion of any sequence shown in Table 2, Table 5, Table 7, Table 9, Table 10, or Table 13. In a specific embodiment, the dsRNA (e.g., siRNA) compound comprises a sense strand of a nucleotide sequence of SEQ ID NO: 61 and an antisense strand of a nucleotide sequence of SEQ ID NO: 62. In one embodiment, the dsRNA (e.g., siRNA) compound comprises a 13, 14, 15, 16, 17, 18, 19, or 20 nucleotide long portion of SEQ ID NO: 61 and / or 62 sequences. In preferred embodiments, the dsRNA (e.g., siRNA) compound comprises an antisense sequence of SEQ ID NO: 9 or 19 and a sense sequence of SEQ ID NO: 8, 33 or 55, or a portion thereof that is 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides long. In preferred embodiments, the sense strand comprises a sequence of SEQ ID NO: 55, or a portion thereof that is 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides long, and the antisense strand comprises a sequence of SEQ ID NO: 9 or 19, or a portion thereof that is 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides long.

[0128] In certain embodiments, the dsRNA comprises at least one modified nucleotide. In another embodiment, substantially all nucleotides of the sense strand are modified nucleotides; substantially all nucleotides of the antisense strand are modified nucleotides; or substantially all nucleotides of the sense strand and substantially all nucleotides of the antisense strand are modified nucleotides. Substantially all means that at least about 70%, 75%, 80%, 85%, 90% or 95% of the nucleosides are modified. In another embodiment, all nucleotides of the sense strand are modified nucleotides; all nucleotides of the antisense strand are modified nucleotides; or all nucleotides of the sense strand and all nucleotides of the antisense strand are modified nucleotides. The modification is preferably selected from the group consisting of: phosphorothioate internucleotide (PS) bonds, furanose ring modifications (e.g., 2'-substituted nucleosides, including nucleosides modified with fluorine (2'-F), O-methyl (2'-OMe), O-methoxyethyl (2'-MOE), H (deoxyribonucleotides) or bicyclic sugars) and combinations thereof.

[0129] In certain embodiments, the dsRNA comprises a chain comprising at least one phosphorothioate internucleotide (PS) bond. In certain embodiments, the dsRNA comprises a chain comprising a phosphorothioate internucleotide (PS) bond adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R). In certain embodiments, the dsRNA comprises a phosphorothioate internucleotide (PS) bond adjacent to a deoxyribonucleoside (D) or a ribonucleoside (R) on the 5' side, the 3' side or both sides. In certain embodiments, the dsRNA comprises a chain comprising a phosphorothioate internucleotide (PS) bond adjacent to 2 nucleosides at the 5' end of the chain and / or 2 nucleosides at the 3' end of the chain.

[0130] In certain embodiments, the dsRNA comprises an siRNA. In a preferred embodiment, the siRNA comprises any one of the siRNAs designed by ARNATAR listed in any of Tables 2, 5, 7, 9, 10, or 13. In a preferred embodiment, the dsRNA comprises the nucleotide sequence and chemical modifications of ATsi786 (SEQ ID NOs: 9 and 55) or ATsi787 (SEQ ID NOs: 19 and 55). In a preferred embodiment, the siRNA comprises the nucleotide sequence and chemical modifications of ATsi786 (SEQ ID NOs: 9 and 55) or ATsi787 (SEQ ID NOs: 19 and 55).

[0131] dsRNA can be delivered to target cells in a variety of ways. In certain embodiments, dsRNA compounds enter cells via viral delivery vectors, lipid-based delivery, polymer-based delivery, and / or conjugate-based delivery.

[0132] In certain embodiments, the dsRNA compound described herein also includes a conjugate portion. In certain embodiments, the siRNA listed in any table in Table 2, Table 5, Table 7, Table 9, Table 10 or Table 13 includes a conjugate portion. The conjugate can be selected from cholesterol, lipids, carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluorescein, rhodamine, coumarin and dye. In a preferred embodiment, the conjugate portion is a portion comprising N-acetylgalactosamine (GalNAc). It should be understood that the portion comprising GalNAc generally contains at least one GalNAc compound and a joint for attaching to the dsRNA. In an embodiment, the conjugate can be attached to the 3' end of the sense strand. In a preferred embodiment, the dsRNA compound is a siRNA conjugated with a portion comprising GalNAc.

[0133] Certain embodiments disclosed herein provide a compound comprising siRNA for inhibiting the expression of AGT in a cell, wherein the siRNA comprises a sense strand and an antisense strand forming a duplex, wherein the sense strand (such as ATs786 or ATs787 shown in Table 13, SEQ ID NO: 55) comprises the following formula:

[0134]

[0135] Certain embodiments disclosed herein provide a compound comprising siRNA for inhibiting the expression of AGT in a cell, wherein the siRNA comprises a sense strand and an antisense strand forming a duplex, wherein the antisense strand (such as ATa786 shown in Table 13, SEQ ID NO: 9) comprises the following formula:

[0136]

[0137] Certain embodiments disclosed herein provide a compound comprising siRNA for inhibiting the expression of AGT in a cell, wherein the siRNA comprises a sense strand and an antisense strand forming a duplex, wherein the antisense strand (such as ATa787 shown in Table 13, SEQ ID NO: 19) comprises the following formula:

[0138]

[0139] Certain embodiments disclosed herein provide a compound comprising siRNA for inhibiting the expression of AGT in a cell, wherein the siRNA comprises a sense strand and an antisense strand forming a duplex, wherein the sense strand (ATs786 as shown in Table 13, SEQ ID NO: 55) comprises the following formula:

[0140]

[0141] And the antisense strand (ATa786 as shown in Table 13, SEQ ID NO: 9) comprises the following formula:

[0142]

[0143] Certain embodiments disclosed herein provide a compound comprising siRNA for inhibiting the expression of AGT in a cell, wherein the siRNA comprises a sense strand and an antisense strand forming a duplex, wherein the sense strand (such as ATs787 shown in Table 13, SEQ ID NO: 55) comprises the following formula:

[0144]

[0145] And the antisense strand (ATa787 as shown in Table 13, SEQ ID NO: 19) comprises the following formula:

[0146]

[0147] In certain embodiments, the compounds or compositions disclosed herein include salts of the dsRNA.In certain embodiments, the compounds or compositions disclosed herein include salts of the siRNA disclosed in Table 2, Table 5, Table 7, Table 9, Table 10, and Table 13.

[0148] Some embodiments provide a method for suppressing the expression of angiotensinogen (AGT) in a cell, comprising contacting the cell with a dsRNA compound or pharmaceutical composition described herein that is sufficient to suppress the expression of AGT, thereby suppressing the expression of AGT in the cell. In certain embodiments, the compound or composition comprises dsRNA, which suppresses the expression of angiotensinogen (AGT) in the cell by at least about 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%. In certain embodiments, the dsRNA is an siRNA that suppresses the expression of angiotensinogen (AGT) by at least about 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%. In certain embodiments, the compound or composition suppressing the expression of AGT is provided in Table 2, Table 5, Table 7, Table 9, Table 10 or Table 13. In preferred embodiments, the positive strand of the siRNA comprises SEQ ID NO:8, 33 or 55 nucleotide sequences and chemical modifications. In a preferred embodiment, the antisense strand of the siRNA comprises a nucleotide sequence of SEQ ID NO: 9 or 19 and a chemical modification. In another preferred embodiment, the siRNA comprises a nucleotide sequence of ATsi786 (SEQ ID NO: 9 and 55) or ATsi787 (SEQ ID NO: 19 and 55) and a chemical modification. The amount of angiotensinogen (AGT) expression inhibition can generally be measured by assessing the mRNA and / or protein levels in the cell after contacting the cell with a dsRNA compound or pharmaceutical composition, and comparing the mRNA or protein levels with cells that have not been contacted with the dsRNA.

[0149] In certain embodiments, the siRNA compounds that inhibit the expression of angiotensinogen (AGT) are provided in Table 2, Table 5, Table 7, Table 9, Table 10 or Table 13, and inhibit the expression of AGT by at least about 85%. In preferred embodiments, the siRNA comprises the nucleotide sequence and chemical modifications of ATsi786 (SEQ ID NO: 9 and 55) or ATsi787 (SEQ ID NO: 19 and 55). The amount of angiotensinogen (AGT) expression inhibition can generally be measured by assessing the mRNA and / or protein levels in the cells after contacting the cells with the dsRNA compound or pharmaceutical composition, and comparing the mRNA or protein levels with cells that have not been contacted with the dsRNA.

[0150] In certain embodiments, the siRNA compounds that inhibit the expression of angiotensinogen (AGT) are provided in Table 2, Table 5, Table 7, Table 9, Table 10 or Table 13, and inhibit the expression of AGT by at least about 90%. In preferred embodiments, the siRNA comprises the nucleotide sequence and chemical modifications of ATsi786 (SEQ ID NO: 9 and 55) or ATsi787 (SEQ ID NO: 19 and 55). The amount of angiotensinogen (AGT) expression inhibition can generally be measured by assessing the mRNA and / or protein levels in the cells after contacting the cells with the dsRNA compound or pharmaceutical composition, and comparing the mRNA or protein levels with cells that have not been contacted with the dsRNA.

[0151] Certain embodiments of the present invention provide a determination of the level of AGT inhibition in a subject's sample. In certain embodiments, the AGT determination comprises: a) administering a compound or composition disclosed herein to a subject in an amount sufficient to inhibit AGT expression; b) removing a sample from the subject; c) determining the amount of AGT protein present in the sample; thereby determining the amount of AGT inhibition by the compound or composition. In certain embodiments, the sample is from blood, serum, urine, and / or liver. In certain embodiments, the amount of AGT protein present in the sample is determined by isolating the AGT protein from the sample, performing Western blotting on the protein, and probing with an AGT-specific monoclonal antibody to assess the amount of AGT protein present. In certain embodiments, ELISA is used to determine the amount of AGT protein present in the sample.

[0152] In certain embodiments, the pharmaceutical composition for inhibiting the expression of angiotensinogen (AGT) in cells comprises only dsRNA, or comprises it in combination with a pharmaceutically acceptable carrier, diluent and / or excipient. In certain embodiments, the dsRNA is in a buffer solution. The buffer solution may comprise acetate, citrate, prolamin, carbonate or phosphate or any combination thereof. In one embodiment, the buffer solution is phosphate buffered saline (PBS). In certain embodiments, the dsRNA in the pharmaceutical composition is siRNA. In certain embodiments, the siRNA sequence is provided in Table 2, Table 5, Table 7, Table 9, Table 10 or Table 13. In preferred embodiments, the siRNA comprises the nucleotide sequence and chemical modification of ATsi786 (SEQ ID NO: 9 and 55) or ATsi787 (SEQ ID NO: 19 and 55).

[0153] Certain embodiments of the present invention provide a method for treating RAAS-related diseases, disorders and / or conditions in a subject, comprising administering to a subject in need thereof a therapeutically effective amount of a compound or composition disclosed herein, in an amount sufficient to inhibit the expression of AGT, thereby inhibiting the expression of AGT in the subject to treat RAAS-related diseases, disorders and / or conditions in the subject. In certain embodiments, the compound or composition that inhibits the expression of AGT is provided in Table 2, Table 5, Table 7, Table 9, Table 10 or Table 13. In a preferred embodiment, the siRNA comprises the nucleotide sequence of SEQ ID NO: 61 and 62. In another preferred embodiment, the siRNA comprises the nucleotide sequence of ATsi786 (SEQ ID NO: 9 and 55) or ATsi787 (SEQ ID NO: 19 and 55) and chemical modifications.

[0154] Certain embodiments of the present invention provide a method of treating a RAAS-related disease, disorder and / or condition in a subject, comprising administering to a subject in need thereof a therapeutically effective amount of a compound or pharmaceutical composition, the amount of which is sufficient to inhibit the expression of AGT, thereby inhibiting the expression of AGT in the subject to treat the RAAS-related disease, disorder and / or condition in the subject, the compound comprising a dsRNA designed by ARNATAR listed in Table 2, Table 5, Table 7, Table 9, Table 10 or Table 13, the pharmaceutical composition comprising the dsRNA listed in Table 2, Table 5, Table 7, Table 9, Table 10 or Table 13. In certain embodiments, the dsRNA for treating a RAAS-related disease, disorder and / or condition in a subject is an siRNA listed in Table 2, Table 5, Table 7, Table 9, Table 10 or Table 13. In preferred embodiments, the siRNA comprises the nucleotide sequence of SEQ ID NO: 61 and 62. In another preferred embodiment, the siRNA comprises the nucleotide sequence of ATsi786 (SEQ ID NOs: 9 and 55) or ATsi787 (SEQ ID NOs: 19 and 55) and chemical modifications.

[0155] In certain embodiments, treating a symptom of a RAAS-related disease, disorder, and / or condition in a subject comprises administering to the subject in need thereof a therapeutically effective amount of a compound or pharmaceutical composition, an amount sufficient to inhibit the expression of AGT, thereby inhibiting the expression of AGT in the subject to treat the RAAS-related disease, disorder, and / or condition. The compound comprises a dsRNA designed by ARNATAR listed in Table 2, Table 5, Table 7, Table 9, Table 10, or Table 13, and the pharmaceutical composition comprises a dsRNA listed in Table 2, Table 5, Table 7, Table 9, Table 10, or Table 13. In certain embodiments, the dsRNA used to treat the symptoms of the subject is an siRNA listed in Table 2, Table 5, Table 7, Table 9, Table 10, or Table 13. In a preferred embodiment, the siRNA comprises the nucleotide sequence of SEQ ID NOs: 61 and 62. In another preferred embodiment, the siRNA comprises the nucleotide sequence of ATsi786 (SEQ ID NOs: 9 and 55) or ATsi787 (SEQ ID NOs: 19 and 55) and chemical modifications.

[0156] In certain embodiments, the RAAS-associated disease, disorder and / or condition is selected from the group consisting of: hypertension, hypertension, critical hypertension, essential hypertension, secondary hypertension, isolated systolic or diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, refractory hypertension, resistant hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt's hypertension, hypertension associated with low plasma renin activity or plasma renin concentration, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, unstable hypertension; hypertensive heart disease, Hypertensive nephropathy, atherosclerosis, arteriosclerosis, vasculopathy, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, glomerulosclerosis, aortic coarctation, aortic aneurysm, ventricular fibrosis, heart failure, myocardial infarction, angina pectoris, stroke, nephropathy, renal failure, systemic sclerosis, intrauterine growth restriction (IUGR), fetal growth restriction, obesity, hepatic steatosis / fatty liver, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD), glucose intolerance, type 2 diabetes (non-insulin-dependent diabetes) and metabolic syndrome. In preferred embodiments, the RAAS-related disease, disorder and / or condition is hypertension.

[0157] Certain embodiments of the present invention provide a method for treating hypertension in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of a compound or pharmaceutical composition, the amount of which is sufficient to inhibit the expression of AGT, thereby inhibiting the expression of AGT in the subject to treat the subject's hypertension, the compound comprising the dsRNA designed by ARNATAR listed in Table 2, Table 5, Table 7, Table 9, Table 10 or Table 13, and the pharmaceutical composition comprising the dsRNA listed in Table 2, Table 5, Table 7, Table 9, Table 10 or Table 13. In certain embodiments, the dsRNA used to treat hypertension in the subject is an siRNA listed in Table 2, Table 5, Table 7, Table 9, Table 10 or Table 13. In a preferred embodiment, the siRNA comprises the nucleotide sequence of SEQ ID NO: 61 and 62. In another preferred embodiment, the siRNA comprises the nucleotide sequence and chemical modification of ATsi786 (SEQ ID NO: 9 and 55) or ATsi787 (SEQ ID NO: 19 and 55). Types of hypertension include primary, secondary, refractory, malignant and simple hypertension.

[0158] In certain embodiments, the subject in need of therapeutic treatment with a compound or composition disclosed herein is a human subject. In certain embodiments, the subject has a systolic blood pressure of at least 130 mm Hg and a diastolic blood pressure of at least 80 mm Hg; or, a systolic blood pressure of at least 140 mm Hg and a diastolic blood pressure of at least 80 mm Hg. In certain embodiments, the subject has a systolic blood pressure greater than about 120 mm Hg, 125 mm Hg, 130 mm Hg, 135 mm Hg, or 140 mm Hg. In certain embodiments, the subject has a systolic blood pressure between 130-160 mm Hg, 130-165 mm Hg, 130-170 mm Hg, 130-180 mm Hg, 135-160 mm Hg, 135-165 mm Hg, 135-170 mm Hg, 140-170 mm Hg, 145-180 mm Hg, 155-180 mm Hg. In certain embodiments, the subject is part of a population susceptible to salt sensitivity, is overweight, obese and / or pregnant.

[0159] Certain embodiments of the present invention provide a method of treating a subject suffering from a disease, disorder and / or condition that would benefit from reduced expression of angiotensinogen (AGT), comprising administering to the subject in need thereof a therapeutically effective amount of a compound or pharmaceutical composition, in an amount sufficient to inhibit the expression of AGT, thereby inhibiting the expression of AGT in the subject to treat the subject suffering from a disorder that would benefit from reduced expression of AGT, wherein the compound comprises a dsRNA listed in Table 2, Table 5, Table 7, Table 9, Table 10 or Table 13, or the pharmaceutical composition comprises any one of the dsRNA listed in Table 2, Table 5, Table 7, Table 9, Table 10 or Table 13. In certain embodiments, the dsRNA is an siRNA listed in Table 2, Table 5, Table 7, Table 9, Table 10 or Table 13. In preferred embodiments, the siRNA comprises the nucleotide sequence of SEQ ID NOs: 61 and 62. In another preferred embodiment, the siRNA comprises the nucleotide sequence of ATsi786 (SEQ ID NOs: 9 and 55) or ATsi787 (SEQ ID NOs: 19 and 55) and chemical modifications. In certain embodiments, the disease, disorder and / or condition is a RAAS-related disease, disorder and / or condition.

[0160] Certain embodiments of the present invention provide a method for preventing or reducing at least one symptom in a subject suffering from a condition that would benefit from reduced expression of angiotensinogen (AGT), comprising administering to the subject in need thereof a preventively effective amount of a compound or pharmaceutical composition sufficient to inhibit the expression of AGT, thereby inhibiting the expression of AGT in the subject to prevent or reduce at least one symptom in the subject suffering from a condition that would benefit from reduced expression of AGT, wherein the compound comprises the dsRNA listed in Table 2, Table 5, Table 7, Table 9, Table 10, or Table 13, and the pharmaceutical composition comprises any one of the dsRNA listed in Table 2, Table 5, Table 7, Table 9, Table 10, or Table 13. In certain embodiments, the dsRNA is an siRNA listed in Table 2, Table 5, Table 7, Table 9, Table 10, or Table 13. In preferred embodiments, the siRNA comprises the nucleotide sequence of SEQ ID NOs: 61 and 62. In another preferred embodiment, the siRNA comprises the nucleotide sequence of ATsi786 (SEQ ID NOs: 9 and 55) or ATsi787 (SEQ ID NOs: 19 and 55) and chemical modifications. In certain embodiments, the at least one symptom is a RAAS-related symptom.

[0161] Certain embodiments provide a method of inhibiting the expression of AGT in a subject, comprising the following steps: administering to the subject a compound or composition comprising a dsRNA as described herein in an amount sufficient to inhibit the expression of AGT. The dsRNA compound is administered to the subject subcutaneously or intravenously. In certain embodiments, the dsRNA inhibits the expression of angiotensinogen (AGT) by at least about 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%.

[0162] Certain embodiments provide double-stranded ribonucleic acid (dsRNA) compounds as described herein for use in medicine. Certain embodiments provide double-stranded ribonucleic acid (dsRNA) compounds as described herein for use in treating or preventing RAAS-related diseases, disorders and / or conditions in a subject. In certain embodiments, the RAAS-related diseases, disorders and / or conditions are as described above.

[0163] In certain embodiments, the dsRNA is applied to the subject with a dosage of about 0.01mg / kg to about 50mg / kg. In certain embodiments, the dsRNA is siRNA, which inhibits angiotensinogen (AGT) expression by at least about 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%. In certain embodiments, the dsRNA is an siRNA applied to the subject with a dosage of about 0.01mg / kg to about 50mg / kg. In certain embodiments, the preferred dosage is selected from 700mg, 800mg and 900mg. In certain embodiments, the compound or composition comprising dsRNA described herein for therapeutically effective amounts is administered once every 3 months with about 150mg, 300mg or 600mg. In certain embodiments, the compound or composition comprising dsRNA described herein for therapeutically effective amounts is administered once every 6 months with about 150mg, 300mg or 600mg.

[0164] In certain embodiments, after the compound or composition comprising dsRNA is administered to a subject, the AGT level in the subject sample is determined. In certain embodiments, the AGT level in the subject sample is the AGT nucleic acid (e.g., mRNA) level or protein level in blood, blood plasma, urine, or liver tissue samples. In certain embodiments, the dsRNA is siRNA.

[0165] In certain embodiments, after administering the compound or composition comprising dsRNA to a subject, other factors are evaluated. In certain embodiments, the level of bradykinin, prekallikrein or blood pressure in the subject is determined. In certain embodiments, the dsRNA is siRNA.

[0166] In certain embodiments, the compound or composition comprising dsRNA is administered to a subject alone or in combination with an additional therapeutic agent to treat a RAAS-related disease, disorder and / or condition or a symptom thereof. In certain embodiments, the dsRNA is an siRNA listed in Table 2, Table 5, Table 7, Table 9, Table 10 or Table 13. In a preferred embodiment, the siRNA comprises the nucleotide sequence of SEQ ID NO: 61 and 62. In another preferred embodiment, the siRNA comprises the nucleotide sequence of ATsi786 (SEQ ID NO: 9 and 55) or ATsi787 (SEQ ID NO: 19 and 55) and a chemical modification. In certain embodiments, the additional therapeutic agent is selected from the group consisting of: diuretics, angiotensin converting enzyme (ACE) inhibitors, angiotensin II receptor antagonists (also known as angiotensin II receptor blockers (ARBs)), beta blockers, vasodilators, calcium channel blockers, aldosterone antagonists, alpha 2 agonists, renin inhibitors, alpha blockers, peripherally acting adrenergic agents, selective DI receptor partial agonists, non-selective alpha adrenergic antagonists, synthetic agents, steroidal anti-mineralocorticoid agents, angiotensin receptor neprilysin inhibitors (ARNi), Sacubitril / valsartan; or endothelin receptor antagonist (ERA), sitaxentan, ambrisentan, atrasentan, BQ-123, zilbotentan, bosentan, macitentan and tezosentan; any combination of the above; and a hypertension therapeutic agent formulated as a combination of agents. In certain embodiments, the additional therapeutic agent comprises an angiotensin II receptor antagonist. In certain embodiments, the angiotensin II receptor antagonist is selected from the group consisting of losartan, valsartan, olmesartan, eprosartan and azilsartan. In certain embodiments, when used in combination with the compound or composition comprising the dsRNA described herein, the additional therapeutic agent can provide a synergistic effect or an additive effect in reducing the blood pressure of the subject.

[0167] In one embodiment, a method for preparing the sense strand and / or antisense strand of the double-stranded ribonucleic acid (dsRNA) compound is provided, wherein the method comprises the following steps: (a) preparing the sense strand and / or antisense strand by sequentially coupling modified and / or unmodified nucleotides by phosphoramidite oligonucleotide synthesis on a solid support; (b) optionally, coupling the sense strand and / or antisense strand on the solid support by phosphoramidite oligonucleotide synthesis; (c) separating the sense strand and / or antisense strand from the solid support and removing the solid support; and (d) optionally, further purifying the sense strand and / or antisense strand, optionally using chromatography. Phosphoramidite oligonucleotide synthesis is well known in the art. By this method, a sense strand or antisense strand can be prepared, which may contain a portion containing GalNAc as a conjugate at its 5' end. Preferably, the method is used to prepare an antisense strand (e.g., an antisense strand of SEQ ID NO: 9 or 19) that does not contain any conjugate.

[0168] In one embodiment, a method for preparing the sense strand and / or antisense strand of the double-stranded ribonucleic acid (dsRNA) compound is provided, wherein the method comprises the following steps: (a) coupling a portion containing GalNAc to a solid support by phosphoramidite oligonucleotide synthesis; (b) coupling modified and / or unmodified nucleotides to a portion containing GalNAc on the solid support by phosphoramidite oligonucleotide synthesis; (c) sequentially coupling additional modified and / or unmodified nucleotides by phosphoramidite oligonucleotide synthesis to prepare the sense strand and / or antisense strand; (d) separating the sense strand and / or antisense strand from the solid support and removing the solid support; and (e) optionally, further purifying the sense strand and / or antisense strand, optionally using chromatography. By this method, a sense strand or antisense strand is prepared, containing a portion containing GalNAc as a conjugate at its 3' end. Preferably, this method is used to prepare a sense strand (e.g., a sense strand of SEQ ID NO:55) containing a 3' end GalNAc conjugate.

[0169] In one embodiment, a method for preparing the double-stranded ribonucleic acid (dsRNA) compound is provided, comprising: (a) contacting the sense strand prepared according to any one of the above methods with the antisense strand prepared according to any one of the above methods in a solution at equimolar concentrations; (b) optionally heating the solution to a temperature of about 94° C.; and (c) optionally lowering the temperature of the solution to about 25° C. Preferably, the sense strand is a sense strand containing a 3′-end GalNAc conjugate, and the antisense strand is an antisense strand without any conjugate. Certain embodiments provide a method for preparing an oligonucleotide (of the sense strand or antisense strand) for forming a compound or composition described herein, comprising synthesizing the oligonucleotide on a solid support by the following steps: (a) attaching a modified or unmodified nucleotide to the solid support by phosphoramidite chemistry; (b) removing excess phosphoramidite reaction solution; (c) removing acid-labile protecting groups from the nucleotide with an acid solution; (d) removing the acid solution; (e) coupling a modified or unmodified nucleotide, a GalNAc-containing moiety or a lipophilic moiety to an unprotected nucleotide attached to the solid support by phosphoramidite chemistry to form an attached oligonucleotide. (f) removing excess phosphoramidite reaction solution; (g) capping unreacted amines or alcohols on the oligonucleotide attached to the solid support with acetic anhydride solution to reduce branching and truncation; (h) removing the acetic anhydride solution; (i) introducing phosphodiester bonds by an oxidizing agent and / or introducing thiophosphate bonds by a sulfurizing agent; (j) removing the oxidizing agent and / or the sulfurizing agent; (k) repeating steps (c)-(j) until the desired length of the oligonucleotide is reached; (l) removing the oligonucleotide from the solid support with an alkaline solution; (m) removing the solid support from the oligonucleotide solution; and (n) optionally purifying the oligonucleotide using chromatography.

[0170] Certain embodiments provide a method for preparing an oligonucleotide (of the sense strand or antisense strand) for forming a compound or composition described herein, comprising synthesizing an oligonucleotide on a portion of a solid support by the following steps: (a) attaching a modified or unmodified nucleotide to the portion on the solid support by a phosphoramidite chemical reaction; (b) removing excess phosphoramidite reaction solution; (c) removing an acid-labile protecting group from the nucleotide with an acid solution; (d) removing the acid solution; (e) coupling the modified or unmodified nucleotide to the unprotected nucleotide attached to the solid support by a phosphoramidite chemical reaction to form an extended oligonucleotide attached to the solid support; Oligonucleotide; (f) removing excess phosphoramidite reaction solution; (g) capping unreacted amines or alcohols on the oligonucleotide attached to the solid support with acetic anhydride solution to reduce branching and truncation; (h) removing the acetic anhydride solution; (i) introducing phosphodiester bonds by oxidizing agents and / or introducing thiophosphate bonds by sulfurizing agents; (j) removing the oxidizing agents and / or sulfurizing agents; (k) repeating steps (c)-(j) until the desired length of oligonucleotide is reached; (l) removing the oligonucleotide from the solid support with an alkaline solution; (m) removing the solid support from the oligonucleotide solution; and (n) optionally purifying the oligonucleotide using chromatography. In certain embodiments, the part loaded on the solid support is selected from a part comprising GalNAc, cholesterol, lipids, carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluorescein, rhodamine, coumarin, dyes, etc. In a preferred embodiment, the part loaded on the solid support is a part comprising GalNAc.

[0171] The present invention also provides a kit comprising any of the compounds or any of the pharmaceutical compositions disclosed herein, and an optional label (e.g., instructions for use). The present invention provides a vial comprising any of the compounds or any of the pharmaceutical compositions disclosed herein. The present invention provides a syringe comprising any of the compounds or any of the pharmaceutical compositions disclosed herein. In one embodiment, the present invention provides a kit for implementing a method of inhibiting the expression of AGT in the subject by administering to a subject in need thereof an amount that effectively inhibits the expression of AGT in the subject. The kit comprises a dsRNA compound and instructions for use, and optionally a tool for administering the dsRNA to the subject. In certain embodiments, the compound or pharmaceutical composition is a dsRNA listed in Table 2, Table 5, Table 7, Table 9, Table 10, or Table 13. In certain embodiments, the dsRNA is an siRNA listed in Table 2, Table 5, Table 7, Table 9, Table 10, or Table 13. In a preferred embodiment, the siRNA of the kit comprises the nucleotide sequence of ATsi786 (SEQ ID NOs: 9 and 55) or ATsi787 (SEQ ID NOs: 19 and 55) and chemical modifications.

[0172] The following description applies to all of the above embodiments.

[0173] Oligomeric compounds

[0174] The oligomeric compounds of the present invention include, but are not limited to, double-stranded RNA (dsRNA) compounds, such as short hairpin RNA (shRNA) and small interfering RNA (siRNA), which target the AGT gene by targeting AGT mRNA. The oligomeric compounds of the present invention comprise the "antisense strand" of the target nucleic acid, which means that it is capable of hybridizing with the target nucleic acid through hydrogen bonds.

[0175] In certain embodiments, the oligomeric compound has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target nucleic acid target segment to which it is targeted. For example, in certain such embodiments, the siRNA compound comprises an antisense strand that has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target nucleic acid target segment to which it is targeted.

[0176] In certain embodiments, the length of the oligomeric compound is 12-30 subunits. In certain embodiments, the length of the oligomeric compound is 18 to 30 subunits. In certain embodiments, the length of the oligomeric compound is 12 to 22 subunits. In certain embodiments, the length of the oligomeric compound is 14 to 30 subunits. In certain embodiments, the length of the oligomeric compound is 14 to 21 subunits. In certain embodiments, the length of the oligomeric compound is 15 to 30 subunits. In certain embodiments, the length of the oligomeric compound is 15 to 21 subunits. In certain embodiments, the length of the oligomeric compound is 16 to 30 subunits. In certain embodiments, the length of the oligomeric compound is 16 to 21 subunits. In certain embodiments, the length of the oligomeric compound is 17 to 30 subunits. In certain embodiments, the length of the oligomeric compound is 17 to 21 subunits. In certain embodiments, the length of the oligomeric compound is 18 to 30 subunits. In certain embodiments, the length of the oligomeric compound is 18 to 21 subunits. In certain embodiments, the oligomeric compound is 20 to 30 subunits in length. In certain embodiments, the oligomeric compound is 15 subunits in length. In certain embodiments, the oligomeric compound is 16 subunits in length. In certain embodiments, the oligomeric compound is 17 subunits in length. In certain embodiments, the oligomeric compound is 18 subunits in length. In certain embodiments, the oligomeric compound is 20 subunits in length. In certain embodiments, the oligomeric compound is 21 subunits in length. In certain embodiments, the oligomeric compound is 22 subunits in length. In certain embodiments, the oligomeric compound is 23 subunits in length. In certain embodiments, the oligomeric compound is 25 subunits in length. In certain embodiments, the oligomeric compound is 25 subunits in length. In other embodiments, the oligomeric compound is 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked subunits.In certain such embodiments, the oligomeric compound is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85 , 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 connected subunits, or a range defined by any two of the above values. In some embodiments, the oligomeric compound is siRNA.

[0177] The length of the oligomeric compound (e.g., siRNA compound) can be increased or decreased, and / or base mismatches can be introduced without eliminating activity (U.S. Pat. No. 7,772,203, incorporated herein by reference). For example, non-canonical base pairs (e.g., A:G, A:C, G:U, I:U, I:A, I:C) can be introduced into the oligomeric compound without eliminating activity. In certain embodiments, an oligomeric compound designed to have one or more non-canonical base pairs (i.e., mismatches) enhances the activity of the oligomeric compound.

[0178] The oligomeric compound may comprise mismatches with the target, between oligomeric strands within the duplex, or a combination thereof. The mismatch may occur throughout the siRNA, for example, in an overhang (a portion of the sense or antisense strand without complementary strands at the 5' and / or 3' ends of the double-stranded siRNA) or in a duplex.

[0179] Oligomeric compound motif

[0180] A motif refers to a modification pattern of an oligomeric compound. Various motifs have been described in the art and are incorporated herein by reference (e.g., U.S. Pat. No. 11,203,755; U.S. Pat. No. 10,870,849; European Patent No. 1,532,248; U.S. Pat. No. 11,406,716; U.S. Pat. No. 10,668,170; U.S. Pat. No. 9,796,974; U.S. Pat. No. 8,754,201; U.S. Pat. No. 10,837,013; U.S. Pat. No. 7,732,593; U.S. Pat. No. 7,015,315 ...1,406,716; U.S. Pat. No. 11,406,716; U.S. Pat. No. 11,406,716; U.S. Pat. No. 11,406,716; U.S. Pat. No. 11,406,716; U.S. Pat. No. 11,406,716; U.S. Pat. U.S. Patent 7,750,144; U.S. Patent 8,420,799; U.S. Patent 8,809,516; U.S. Patent 8,796,436; U.S. Patent 8,859,749; U.S. Patent 9,708,615; U.S. Patent 10,233,448; U.S. Patent 10,273,477; U.S. Patent 10,612,024; U.S. Patent 10,612,027; U.S. Patent 10,669,544; U.S. Patent 11,401,517; USSN 2020 / 0031862; USSN 2016 / 0272970). However, the search for new and improved motifs is ongoing.

[0181] In certain embodiments, the oligomeric compounds disclosed herein (e.g., siRNA) have chemically modified subunits arranged in motifs so that the oligomeric compounds have beneficial properties, including but not limited to: enhancing inhibitory activity to improve efficacy; increasing binding affinity to enhance specificity for target nucleic acids, thereby limiting off-target effects and improving safety; or enhancing resistance to in vivo nuclease degradation, thereby improving stability and durability. In certain embodiments, the oligomeric compound is a chimera, wherein the peripheral nucleobase of the oligomeric compound comprises a motif with various modified or unmodified nucleobases to improve stability, specificity, safety and efficacy, and the central portion of the compound comprises various modified or unmodified nucleobases as a substrate for RISC-mediated degradation. Each different portion may comprise a uniform sugar moiety, a modified or alternating sugar moiety. Each portion may comprise different patterns of phosphate bonds and phosphorothioate bonds.

[0182] In certain embodiments, the oligomeric compound targeting AGT nucleic acid comprises a sense strand having a sequence and a chemical modification motif as shown in Table 2, Table 5, Table 7, Table 9, Table 10 or Table 13. In certain embodiments, the oligomeric compound targeting AGT nucleic acid comprises an antisense strand having a sequence and a chemical modification motif as shown in Table 2, Table 5, Table 7, Table 9, Table 10 or Table 13.

[0183] Target nucleic acids, target regions and nucleotide sequences

[0184] Several embodiments relate to methods of modulating gene expression by dsRNA inhibition.

[0185] In certain embodiments, the method of inhibiting expression of angiotensinogen (AGT) gene in a cell comprises administering to the cell a dsRNA compound that targets the mRNA (or its corresponding cDNA) transcript of AGT (GenBank NM_001382817.3, incorporated herein as SEQ ID NO: 1).

[0186] The nucleic acid sequences and chemical modification motifs of the dsRNA targeting the AGT transcript are shown in Table 2, Table 5, Table 7, Table 9, Table 10 and Table 13. It should be understood that the sequence listed in each SEQ ID NO in the examples contained herein is independent of any modification to the sugar moiety, the internucleoside bond or the nucleobase. Therefore, the siRNA compound defined by the SEQ ID NO can independently contain one or more modifications to the sugar moiety, the internucleoside bond or the nucleobase. The siRNA compound represented by the ARNATAR name represents a combination of sequence and motif.

[0187] Hybridization

[0188] In some embodiments, hybridization occurs between an oligomeric compound disclosed herein and an mRNA. The most common hybridization mechanism involves hydrogen bonding (eg, Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.

[0189] In Watson-Crick canonical base pairing, adenine (A) is complementary to thymine (T) in DNA, adenine (A) is complementary to uracil (U) in RNA, and guanine (G) is complementary to cytosine (C) in DNA and RNA. During hybridization of the oligomeric compound to the target nucleic acid or target region, the base pairs or complementary nucleobases are usually Watson-Crick base pairs (C:G, A:U, A:T), but non-canonical base pairs are also allowed, such as Hoogsteen base pairs (e.g., A:G, A:U), Wobble base pairs (e.g., G:U, I:U, I:A, I:C, where I is hypoxanthine), etc. Wobble base pairs have been described in RNAi agents before (see, e.g., U.S. Pat. No. 7,732,593; U.S. Pat. No. 7,750,144).

[0190] Nucleobase complementarity facilitates hybridization of the oligomeric compounds described herein to their target nucleic acids, and the stronger the pairing (e.g., the more base pairs and / or the stronger the hydrogen bonds), the stronger the hybridization of the oligomeric compound to the target. Hybridization can occur under different conditions. Stringent conditions are sequence-dependent and are determined by the nature and composition of the oligomeric compound to be hybridized.

[0191] Methods for determining whether a sequence can specifically hybridize to a target nucleic acid are well known in the art. In certain embodiments, the oligomeric compounds provided herein can specifically hybridize to a target mRNA with little off-target binding.

[0192] Complementarity

[0193] The oligomeric compound and target nucleic acid are complementary to each other when a sufficient number of nucleobases of the oligomeric compound can hybridize to corresponding nucleobases of the target nucleic acid, thereby producing the desired effect (eg, inhibition of the target nucleic acid, such as an mRNA nucleic acid).

[0194] Non-complementary nucleobases between oligomeric compounds and mRNA nucleic acid can be tolerated, provided that the oligomeric compounds are still capable of specific hybridization with target nucleic acid. In addition, oligomeric compounds can hybridize on one or more fragments of mRNA nucleic acid, thereby making the middle or adjacent fragments not participate in hybridization events (e.g., loop structures, mispairings or hairpin structures).

[0195] In certain embodiments, the oligomeric compounds provided herein or their designated portions are complementary to mRNA nucleic acids, target regions, target fragments or their designated portions, or at least complementary, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%. The complementarity percentage of the oligomeric compounds and the target nucleic acid can be determined using conventional methods.

[0196] For example, an oligomeric compound, wherein 18 of the 20 nucleobases of the antisense strand of the oligomeric compound are complementary to the target region, so specific hybridization will occur, representing 90 percent complementarity. In this example, the remaining non-complementary nucleobases can be aggregated or interspersed with complementary nucleobases, without being continuous with each other or continuous with complementary nucleobases. The complementarity percentage of the oligomeric compound to the target nucleic acid region can be routinely determined using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., 1990, J. Mol. Biol., 215: 403-410; Zhang and Madden, 1997, Genome Res., 7: 649-656), which can be obtained through the National Center for Biotechnology Information website (NCBI, https: / / blast.ncbi.nlm.nih.gov / Blast.cgi). The percent homology, sequence identity or complementarity can be determined, for example, by NCBI Blast (Johnson et al., Nucleic Acids Res. 2008, 36 (Web Server issue): W5-W9).

[0197] In certain embodiments, the oligomeric compound or its designated portion provided herein is fully complementary (i.e., 100% complementary) to a target nucleic acid or its designated portion. For example, the oligomeric compound can be fully complementary to an mRNA nucleic acid, or a target region, or a target fragment or its target sequence. As used herein, "fully complementary" means that each nucleobase of the oligomeric compound can be accurately base-paired with the corresponding nucleobase of the target nucleic acid. For example, an oligomeric compound of 20 nucleobases is fully complementary to a target sequence of 400 nucleobases in length, as long as there are corresponding 20 nucleobase portions in the target nucleic acid that are fully complementary to the oligomeric compound.

[0198] Fully complementary can also be used with reference to a specified portion of the oligomeric compound or the nucleic acid target. For example, a 20 nucleobase portion of a 30 nucleobase oligomeric compound can be "fully complementary" to a target sequence that is 400 nucleobases long. If the target sequence has a corresponding 20 nucleobase portion, each of which is complementary to the 20 nucleobase portion of the oligomeric compound, then the 20 nucleobase portion of the 30 nucleobase oligomer is fully complementary to the target sequence. At the same time, the entire 30 nucleobase oligomeric compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the oligomeric compound are also complementary to the target sequence.

[0199] The position of the non-complementary nucleobase can be at the 5' end or the 3' end of the oligomeric compound. Alternatively, one or more of the non-complementary nucleobases (nucleobase or nucleobases) can be located at an internal position of the oligomeric compound. When there are two or more non-complementary nucleobases, they can be continuous (i.e. connected) or non-continuous.

[0200] In certain embodiments, an oligomeric compound that is or is up to 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 nucleobases in length comprises no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase relative to a target nucleic acid (e.g., an mRNA nucleic acid) or a specified portion thereof.

[0201] In certain embodiments, an oligomeric compound that is or is up to 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprises no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase relative to a target nucleic acid (e.g., an mRNA nucleic acid), or a specified portion thereof.

[0202] The oligomeric compound provided herein also includes a core base complementary to a portion of the target nucleic acid. As used herein, "part" refers to a continuous (i.e., connected) core base of a limited number in a target nucleic acid region or fragment. "Part" may also refer to a continuous core base of a limited number in an oligomeric compound. In certain embodiments, the oligomeric compound is partially complementary to at least 8 core bases of a target fragment. In certain embodiments, the oligomeric compound is partially complementary to at least 9 core bases of a target fragment. In certain embodiments, the oligomeric compound is partially complementary to at least 10 core bases of a target fragment. In certain embodiments, the oligomeric compound is partially complementary to at least 11 core bases of a target fragment. In certain embodiments, the oligomeric compound is partially complementary to at least 12 core bases of a target fragment. In certain embodiments, the oligomeric compound is partially complementary to at least 13 core bases of a target fragment. In certain embodiments, the oligomeric compound is partially complementary to at least 14 core bases of a target fragment. In certain embodiments, the oligomeric compound is partially complementary to at least 15 core bases of a target fragment. Also contemplated are oligomeric compounds that are complementary to at least 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleobase portions of a target fragment, or a range bounded by any two of these values.

[0203] Identity

[0204] The oligomeric compounds provided herein can also have a defined percentage identity with a specific nucleotide sequence, a SEQ ID NO or a compound represented by a specific ARNATAR number or a portion thereof. As used herein, if the oligomeric compound has the same nuclear base pairing ability, it is identical to the sequence disclosed herein. For example, since both uracil and thymidine are paired with adenine, an RNA containing uracil instead of thymidine in the disclosed DNA sequence will be considered identical to the DNA sequence. Shortened and lengthened versions of the oligomeric compounds described herein, as well as compounds with non-identical bases relative to the oligomeric compounds provided herein, can also be considered. The non-identical bases can be adjacent to each other or dispersed throughout the oligomeric compound. The percentage identity of the oligomeric compound is calculated based on the number of bases with identical base pairing relative to the compared sequence.

[0205] In certain embodiments, a portion of the oligomeric compound is compared to an equal length portion of the target nucleic acid. In certain embodiments, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleobase portions of the oligomeric compound are compared to an equal length portion of the target nucleic acid.

[0206] Chemical modification

[0207] Nucleoside is a base-sugar combination. The core base (also referred to as base) part of the nucleoside is usually a heterocyclic base part. Nucleotide is a nucleoside that also includes the covalent connection (for example, phosphate group as described below or chemically modified key) of the sugar part of the nucleoside. Oligonucleotide is formed by covalently connecting adjacent nucleotides to each other to form a linear sequence of connected nucleotides. In the oligonucleotide structure, a linking group is generally referred to as the internucleoside bond forming the oligonucleotide. Oligomeric compounds are composed of one (for example ssRNA, antisense oligonucleotide or miRNA) or more oligonucleotides (for example dsRNA, for example siRNA or shRNA).

[0208] Modifications to oligomeric compounds encompass substitutions or changes to nucleobases, internucleoside bonds, or sugar moieties. Modified oligomeric compounds as disclosed herein are generally superior to native or unmodified forms due to desired properties, such as enhanced delivery (e.g., enhanced cellular uptake), enhanced specificity or affinity for nucleic acid targets, enhanced stability in the presence of nucleases, enhanced safety (e.g., reduced side effects after administration of the compound to a subject), or enhanced potency (e.g., inhibitory activity).

[0209] Nucleobase modification

[0210] Nucleobases are heterocyclic moieties that are capable of base pairing with a nucleobase of another nucleic acid. Modifications to nucleobases may be beneficial to oligomeric compounds for a variety of reasons, including but not limited to enhancing the stability of the oligomeric compound, enhancing specificity, reducing the immunogenicity of the oligomeric compound, increasing the affinity of the oligomeric compound, increasing the potency of the oligomeric compound, and other desired characteristics.

[0211] Examples of nucleobase modifications and their advantages are well known in the art (Friedrich and Aigner, Therapeutic siRNA: State-of-the-Art and Future Perspectives, 2022, BioDrugs, 36(5): 549-571; Hu et al., Therapeutic siRNA: State of the Art, Signal Transduction and Targeted Therapy, 2020, 5: 101). Nucleobase modifications may include replacing a nucleobase with a nucleobase analog or modifying a portion of the nucleobase. Examples of nucleobase modifications include, but are not limited to, pseudouridine, 2'-thiouridine, N6'-methyladenosine and 5'-methylcytidine, 5'-fluoro-2'-deoxyuridine, N-ethylpiperidine 5'-triazole-modified adenosine, 5'-nitroindole, 2',4'-difluorotolyl ribonucleoside, N-ethylpiperidine 7'-EAA triazole-modified adenosine, 6'-phenylpyrrolocytosine, and the like.

[0212] In certain embodiments, the oligomeric compound of the targeting mRNA nucleic acid comprises one or more modified nucleobases. In certain embodiments, the modified nucleobase is, for example, a deoxyribonucleoside (D) that replaces a ribonucleoside (R). In certain embodiments, the modified nucleobase can be a thymine that replaces uracil. In certain embodiments, the multiple nucleobases of the oligomeric compound are modified. In certain embodiments, each nucleobase of the oligomeric compound is modified.

[0213] Internucleoside bond modification

[0214] The naturally occurring internucleoside bond of RNA and DNA is a 3' to 5' phosphodiester bond. For nucleosides including furanose, the phosphate group can be connected to the 2', 3' or 5' hydroxyl moiety of the sugar. Due to the desired characteristics, such as enhancing cellular uptake, enhancing affinity for target nucleic acids, reducing toxicity, enhancing stability and durability, reducing degradation and other desired features of oligomeric compounds, oligomeric compounds with one or more modified (i.e. non-naturally occurring) internucleoside bonds are generally selected, rather than oligomeric compounds with naturally occurring internucleoside bonds. Modified internucleoside bonds and their advantages are well known in the art (Friedrich and Aigner, Therapeutic siRNA: State-of-the-Art and Future Perspectives, 2022, BioDrugs, 36 (5): 549-571; Hu et al., Therapeutic siRNA: State of the Art, Signal Transduction and Targeted Therapy, 2020, 5: 101).

[0215] Oligomeric compounds with modified internucleoside bonds include internucleoside bonds that retain phosphorus atoms and internucleoside bonds that do not have phosphorus atoms. Representative phosphorus-containing internucleoside bonds include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates (e.g., 5'-methylphosphonate (5'-MP)), phosphoryl esters and thiophosphates (e.g., phosphorodithioate Rp isomers (PS, Rp), phosphorodithioate Rp isomers (PS, Sp), 5'-thiophosphate (5'-PS)), methoxypropylphosphonate, (S)-5'-C-methylphosphonate, peptide nucleic acid (PNA), 5'-(E)-vinylphosphonate.

[0216] In certain embodiments, the oligomeric compound of the targeting mRNA nucleic acid comprises one or more modified internucleoside bonds. In certain embodiments, the modified internucleoside bond is a phosphorothioate (PS) bond. In certain embodiments, one or more internucleoside bonds of the oligomeric compound are phosphorothioate internucleoside bonds. In certain embodiments, the PS bond is adjacent to a deoxyribonucleoside (sometimes referred to herein as DNA or "D") or a ribonucleoside (sometimes referred to herein as RNA, "R" or "r"). In certain embodiments, each internucleoside bond of the oligomeric compound is a phosphorothioate internucleoside bond.

[0217] Sugar modification

[0218] Natural sugars are sugar moieties in DNA (2'-H) or RNA (2'-OH), i.e., 2-deoxy-β-D-ribofuranose or β-D-ribofuranose, respectively. The oligomeric compounds provided herein may contain one or more nucleosides in which the natural sugar moiety has been modified. Such sugar-modified nucleosides may impart desired characteristics to the oligomeric compounds, such as enhanced stability, extended durability (e.g., extended half-life), enhanced binding affinity, reduced off-target effects, reduced immunogenicity, reduced toxicity, enhanced efficacy, or some other beneficial biological properties. Sugar modifications and their advantages are known in the art (Friedrich and Aigner, 2022, BioDrugs, 36(5):549-571; Hu et al., Therapeutic siRNA: State of the Art, Signal Transduction and Targeted Therapy, 2020, 5:101; Chiu and Rana, 2003, RNA, 9:1034-1048; Choung et al., Biochem Biophys Res Commun, 2006, 342:919-927; Amarzguioui et al., 2003, Nucleic Acids Res, 31(2):589-595; Braasch et al., 2003, Biochemistry, 42(26):7967-7975; Czauderna et al., 2003, Nucleic Acids Res, 31(11):2705-2716; Allerson et al., 2005, J Med Chem, 48:901-904; Layzer et al., 2004, RNA, 10:766-771; Ui-Tei, et al., 2008, Nucleic Acids Res, 36(7):2136-51; Bramsen and Kjems, 2012, Frontiers in Genetics, 3(154):1-22; Bramsen et al., 2010, Nucleic Acids Res, 38(17):5761-5773; Muhonen et al., 2007, Chem & Biodiversity, 4:858-873; which are incorporated herein by reference).

[0219] In certain embodiments, the nucleoside comprises a chemically modified furanose ring portion. Examples of chemically modified furanose rings may include, but are not limited to, the addition of substituent groups (e.g., 5' sugar modification, 2' sugar modification); bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNAs); replacement of ribose ring oxygen atoms with S, N (R) or C (R) (R = H, C1-C 12 alkyl or protecting group); nucleoside mimetics; and combinations thereof.

[0220] A 2'-modified sugar refers to a furanosyl sugar modified at the 2' position. A 2'-modified nucleoside refers to a nucleoside comprising a sugar modified at the 2' position of the furanose ring. In certain embodiments, such modifications include substituents selected from the group consisting of halides, including but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted aminoalkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl. In certain embodiments, the 2' modification is selected from the group consisting of substituents, including but not limited to the following: O[(CH2) n O] m CH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2, OCH2C(=O)N(H)CH3 and O(CH2) n ON[(CH2) n CH3]2, wherein n and m are 1 to 10. Other 2'-substituent groups may also be selected from: C1-C 12 Alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, NO2, N3, NH2, heterocycloalkyl, heterocycloalkylaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleavage group, reporter group, intercalator, group for improving pharmacokinetic properties and group for improving pharmacodynamic properties of oligomeric compounds, and other substituents with similar properties.

[0221] Other examples of nucleosides with modified sugar moieties include, but are not limited to, nucleosides containing 5'-vinyl, 5'-methyl (R or S), 2'-F-5'-methyl, 4'-S, 2'-deoxy-2'-fluoro (2'-F), 2'-OCH3 (2'-O-methyl, 2'-OMe), 2'-O(CH2)2OCH3 (2'-O-methoxyethyl, 2'-O-MOE, 2'-MOE), 2'-O-methyl-4-pyridine, phosphorodiamidate morpholinyl (PMO), tricyclic DNA (tcDNA), 2'-arabino-fluoro, 2'-O-benzyl, glycol nucleic acid (GNA) and unlocked nucleic acid (UNA) substituent groups. The substituent at the 2' position can also be selected from allyl, amino, azido, thio, O-allyl, O-C1-C 10 alkyl, OCF3, O(CH2)2SCH3, O(CH2)2-ON(Rm)(Rn) and O-CH2-C(=O)-N(Rm)(Rn), wherein each Rm and Rn is independently H or a substituted or unsubstituted C1-C 10 alkyl. 2'-OMe or 2'-OCH3 or 2'-O-methyl each refers to a nucleoside comprising a sugar comprising an -OCH3 group at the 2' position of the sugar ring. 2'-F refers to a sugar comprising a fluorine group at the 2' position. 2'-O-methoxyethyl or 2'-O-MOE or 2'-MOE each refers to a nucleoside comprising a sugar comprising an -O(CH2)2OCH3 group at the 2'-position of the sugar ring.

[0222] BNA refers to a modified nucleoside comprising a bicyclic sugar moiety, wherein the bridge connecting two carbon atoms of the sugar ring connects the 2' carbon and another carbon of the sugar ring. The example of bicyclic nucleosides includes but is not limited to the nucleosides comprising a bridge between 4' and 2' ribosyl ring atoms, such as the nucleosides in locked nucleic acids (LNA). In certain embodiments, provided herein is an oligomeric compound including one or more bicyclic nucleosides, wherein the bridge comprises 4' to 2' bicyclic nucleosides. Campbell and Wengel have described LNA and UNA (Chem Soc Rev, 2011, 40 (12): 5680-9), and are incorporated herein by reference.

[0223] In certain embodiments, the oligomeric compound comprises one or more nucleotides with modified sugar moieties. In certain embodiments, the modified sugar moieties have 2'-OMe modifications. In certain embodiments, the modified sugar moieties have 2'-F modifications. In certain embodiments, the 2'-OMe and / or 2'-F modified nucleotides are arranged in a motif. In a preferred embodiment, as disclosed in PCT / US2023 / 084688 (which is incorporated herein by reference), the modifications are arranged in an Arnatar motif.

[0224] In certain embodiments, the nucleic acid targeting oligomeric compound comprises a sense strand having a motif described by one of the following formulae:

[0225] Formula (I): 5'M-(Y)nZ-(Y)rDD 3',

[0226] Formula (II): 5'YZ-(Y)q-FFNM-(Y)qM-(Y)vDD 3',

[0227] Formula (III): 5'M*F*MMN*MN*MFFNMN*MN*MMFM*D*D 3',

[0228] Formula (X): 5'MFMMNMNMFFNMNMNMMNMDD 3', or

[0229] Formula (XI): 5'MFMMNMNMFFMMNMNMMFMDD 3',

[0230] in

[0231] Each D is a deoxyribonucleoside (D is a modification of R),

[0232] Each R is a ribonucleoside,

[0233] each N is a modified or unmodified nucleoside (e.g., D, R, M, F, UNA-modified, or LNA-modified),

[0234] Each M is a 2'-OMe modified nucleoside,

[0235] Each F is a 2'-F modified nucleoside,

[0236] Each * is a phosphorothioate (PS) bond,

[0237] each Y is two adjacent nucleosides with different modifications (e.g., MD, DM, DF, FD, MF, or FM) or a modified nucleoside adjacent to an unmodified nucleoside (e.g., DR, RD, MR, or RM),

[0238] Each Z is two adjacent unmodified nucleosides or two adjacent nucleosides with the same modification or two adjacent unmodified nucleosides (eg, MM, DD, RR or FF),

[0239] Each n is 6-8,

[0240] Each q is 2-3,

[0241] Each r is 1-2,

[0242] Each v is 0-1, and

[0243] wherein no single modification type modifies more than two consecutive nucleotides. In certain embodiments, the FFNM is FFRM or FFMM.

[0244] In certain embodiments, the nucleic acid targeting oligomeric compound comprises an antisense strand having a motif described by one of the following formulae:

[0245] Formula (IV): 5'-LM-(D)v-(Y)s-(Z)t-(Y)uZN-(Z)r 3',

[0246] Formula (V): 5'L-(Y)p-NM-(FMM)r-(Y)p-(Z)r 3',

[0247] Formula (VI): 5'LM*N*MNMFNMFMMNMFMMMN*M*M 3',

[0248] Formula (VII): 5'LM*D*MFMFNMFMMFMFFMMN*M*M 3',

[0249] Formula (VIII): 5'L-MNMNMFNMFMMNMFMFMM 3',

[0250] Formula (IX): 5'LM-(Y)pZ-(Y)p-(Z)r 3', or

[0251] Formula (XII): 5'L-MDMFMFNMFMMFMFMMMNMM 3',

[0252] in

[0253] Each D is a deoxyribonucleoside (D is a modification of R),

[0254] each R is a ribonucleoside, each N is a modified or unmodified nucleoside (e.g., D, R, M, F, UNA-modified, or LNA-modified),

[0255] Each M is a 2'-OMe modified nucleoside,

[0256] Each F is a 2'-F modified nucleoside,

[0257] Each L is 5' phosphate, 5' vinylphosphonate or 5' OH

[0258] Each * is a phosphorothioate (PS) bond,

[0259] each Y is two adjacent nucleosides with different modifications (e.g., MD, DM, DF, FD, MF, or FM) or a modified nucleoside adjacent to an unmodified nucleoside (e.g., DR, RD, MR, or RM),

[0260] Each Z is two adjacent unmodified nucleosides or two adjacent nucleosides with the same modification or two adjacent unmodified nucleosides (eg, MM, DD, RR or FF),

[0261] Each (5p) is a 5'-phosphate,

[0262] Each n is 6-8,

[0263] Each p is 3-5,

[0264] Each r is 1-2,

[0265] Each v is 0-1,

[0266] Each s is 2-7,

[0267] Each t is 0-2, and

[0268] wherein no single modification type modifies more than two consecutive nucleotides. In certain embodiments, the FNM is a FMM.

[0269] Oligomeric compound delivery systems

[0270] Oligomeric compounds need to enter target cells to exert their activity. There are many ways to transport oligomeric compounds into target cells, including viral delivery vectors, lipid-based delivery, polymer-based delivery, and conjugate-based delivery (Paunovska et al., Drug Delivery Systems for RNA Therapeutics, 2022, Nature Reviews Genetics, 23(5): 265-280; Chen et al., 2022, Molecular Therapy, Nucleic Acids, 29: 150-160).

[0271] Lipid-based particles can form specific structures, such as micelles, liposomes, and lipid nanoparticles (LPNs), to carry oligomeric compounds into cells. In order to form these particles, LPNs can include one or more of the following: cationic lipids or ionizable lipids (e.g., DLin-MC3-DMA, SM-102, ALC-0315), cholesterol, auxiliary lipids, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), polyethylene glycol (PEG) modified lipids (e.g., PEG-2000-C-DMG, PEG-2000-DMG, ALC-0159), C12-200, cKK-E12, etc. Different lipid combinations can be formulated to affect the delivery of the oligomeric compounds to different types of cells. In one example, the therapeutic siRNA patisiran was formulated in the cationic ionizable lipid DLin-MC3-DMA, cholesterol, the polar phospholipid DSPC, and PEG-2000-C-DMG for delivery to hepatocytes.

[0272] Polymer-based particles are also used for oligomeric compound delivery systems. Such polymers include polylactic-co-glycolic acid (PLGA), polyethyleneimine (PEI), poly (l-lysine) (PLL), poly (β-amino ester) (PBAE), dendritic macromolecules (e.g. polyamidoamine (PAMAM) or PLL) and other polymers or modified polymers thereof. Polymer compositions can vary according to the desired properties for delivering the oligomeric compound.

[0273] The oligomeric compounds disclosed herein can be covalently linked to one or more moieties or conjugates, thereby enhancing the activity, cellular distribution or cellular uptake of the resulting compound. The conjugate group can include cholesterol, lipids, carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluorescein, rhodamine, coumarin, dyes, etc. The delivery based on the conjugate can actively deliver the oligomeric compounds to specific cell types.

[0274] In an example, a moiety comprising N-acetylgalactosamine (GalNAc) is conjugated to an oligomeric compound and the oligomeric compound is delivered to a hepatocyte. Various GalNAc conjugates can be found in several publications including the following, all of which are incorporated herein by reference: Sharma et al., 2018, Bioconjugate Chem, 29: 2478-2488; Nair et al., J. Am. Chem. Soc. 2014, 136 (49): 16958-16961; Keam, 2022, Drugs, 82: 1419-1425; U.S. Patent No. 10,087,208; Prakash et al., 2014, Nucleic Acids Res, 42 (13): 8796-807; Debacker et al., 2020, Molecular Therapy, 28(8):1759-1771; PCT / US2023 / 084692; U.S. Patent 11,110,174; U.S. Patent 9,796,756; U.S. Patent 9,181,549; U.S. Patent 10,344,275; U.S. Patent 10,570,169; U.S. Patent 9,506,030; and U.S. Patent 7,582,744.

[0275] In certain embodiments, the following GalNAc conjugate precursor with a solid support can be used to conjugate the AGT dsRNA at the 3' end of the sense strand. In preferred embodiments, the dsRNA is an ARNATAR designed siRNA selected from Table 2, Table 5, Table 7, Table 9, Table 10 or Table 13.

[0276]

[0277] In a preferred embodiment, the GalNAc-containing moiety conjugated to the oligonucleotide is GalNAc-AN (also known as GA4 or GA-AN), as shown below:

[0278]

[0279] In one embodiment, GalNAc-AN is conjugated to the sense strand of the dsRNA compound. In a preferred embodiment, GalNAc-AN is conjugated to a dsRNA compound selected from any one of the compounds in Table 2, Table 5, Table 7, Table 9, Table 10 or Table 13.

[0280] Oligomeric compound synthesis

[0281] siRNAs are designed, synthesized, and prepared using methods known in the art.

[0282] The solid phase synthesis of oligonucleotides was carried out in MerMade TM 48x synthesizer (BioAutomation, LGC, Biosearch Technologies, Hoddesdon, UK), which can synthesize up to 48 1 μmol or 5 μmol oligonucleotides at a time using standard phosphoramidite chemistry. Phosphoramidite synthesis of oligonucleotides on solid supports is well known in the art (e.g., Beaucage and Caruthers, 1981, Tetrahedron Letters, 22 (20): 1859-1862; Roy and Caruthers, 2013, Molecules, 18: 14268-14284; and Roy and Caruthers et al., 2021, Nature Communications, 12: 2760). The solid support is a controlled pore glass loaded with a universal linker or loaded with a 3'-GalNAc conjugate. (e.g., AM Chemicals, Vista, CA, USA; Primetech ALC, Minsk, Belarus; Gene Link, Elmsford, NY, USA; or any GalNAc conjugate disclosed herein) or a universal solid support (AM Chemicals, Vista, CA, USA). Ancillary synthesis reagents and standard 2'-cyanoethyl phosphoramidite monomers (2'-fluoro, 2'-O-methyl, RNA, DNA) can be obtained from various sources (Hongene Biotech, Shanghai, China; Sigma-Aldrich, St. Louis, MO, USA; Glen Research, Sterling, VA, USA; ThermoFisher Scientific, Waltham, MA, USA; LGC Biosearch Technologies, Hoddesdon, UK). Phosphoramidite mixtures were prepared in anhydrous acetonitrile or 30% DMF:acetonitrile and coupled using 0.25M 4,5-dicyanoimidazole (DCI) (Sigma-Aldrich, St.Louis, MO, USA) over a coupling time range of 120-360 seconds. A solution of 0.02M iodine mixture in tetrahydrofuran (THF), pyridine and water was used to achieve standard phosphodiester bonds. 0.05M sulfurization reagent II (3-((dimethylaminomethylene)amino)-3H-1,2,4-dithiazole-3-thione, DDTT) (40:60, pyridine / acetonitrile) (LGCBiosearch Technologies, Hoddesdon, UK) was used to generate phosphorothioate bonds with an oxidation time of 6 minutes. All sequences were synthesized with the removal of the dimethoxytrityl (DMT) protecting group.

[0283] After solid phase synthesis is completed, the oligonucleotide is cut from the solid phase support and deprotected by cultivating in ammonium hydroxide at 55°C for 6 hours. Ammonium hydroxide is removed using a centrifugal vacuum concentrator to dry at room temperature. For sequences containing natural ribonucleotides (2'-OH) protected with tert-butyldimethylsilyl (TBDMS), triethylamine: trihydrogen fluoride (TEA:3HF) is used for the second deprotection. 100 μL DMSO and 125 μL TEA:3HF are added to each TBDMS protected oligonucleotide and cultivated at 65°C for 2.5 hours. After cultivation, 25 μL 3M sodium acetate is added to the solution, and then the solution is precipitated in butanol at -20°C for 30 minutes. The turbid solution is centrifuged into a cake shape, and the supernatant is then carefully decanted with a pipette. Then 75% ethanol: water and 100% ethanol are used as supernatants to complete the standard precipitation process. The oligonucleotide cake is dried in a centrifugal vacuum concentrator for 30 minutes.

[0284] Precipitate with 3M sodium acetate and use G25 After elution with a Sigma-Aldrich column (Sigma-Aldrich, St. Louis, MO, USA), desalting was performed without HPLC purification. Oligonucleotides were purified by anion exchange chromatography on a Gilson GX271 preparative HPLC system (Middleton, WI, USA) using BioWorks Q40 resin (Uppsala, Sweden). Final desalting was performed by All oligonucleotides were analyzed for purity by ion-pairing reversed-phase HPLC on an Agilent 1200 analytical HPLC (Santa Clara, CA, USA); intact mass negative ion mass spectrometry was performed on an Agilent 6130 single quadrupole mass spectrometer (Santa Clara, CA, USA); A260 quantification was performed by UV / Vis using an M Plex plate reader (Zurich, Switzerland).

[0285] Double-stranded oligomeric compound duplex formation

[0286] In general, for double-stranded oligomeric compounds (e.g., siRNA compounds), sense and antisense oligonucleotides are annealed together to form a duplex. The duplex is formed by contacting the sense strand prepared according to any of the methods described herein with the antisense strand prepared according to any of the methods described herein in a solution at an equimolar concentration. Optionally, the solution is heated to a temperature of about 94° C. and then the temperature is reduced to about 25° C. In an example, a sample is heated at 94° C. for 4 minutes in a module heater in 1x phosphate buffered saline, then the heating module containing the sample is removed from the module heater, and the sample is gradually cooled to room temperature over a time course of 1 hour, 50-300 mM duplex formation can be achieved.

[0287] Compositions and methods for preparing pharmaceutical compositions

[0288] The dsRNA compound (eg, the siRNA targeting AGT described herein) can be combined with a pharmaceutically acceptable active substance or an inert substance (eg, a diluent, an excipient, or a carrier) for preparing a pharmaceutical composition or formulation.

[0289] The composition and method used to formulate the pharmaceutical composition depends on a number of criteria including, but not limited to, the route of administration, the severity of the disease, or the dose to be administered.

[0290] In certain embodiments, the drug carrier or excipient is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acid compounds to an animal. The excipient may be liquid or solid and may be selected according to the planned mode of administration considered so as to provide the required volume, viscosity, etc. when combined with nucleic acid and other components of a given pharmaceutical composition. Typical drug carriers include, but are not limited to, adhesives (e.g., pregelatinized corn starch, polyvinyl pyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylate or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silicon dioxide, colloidal silicon dioxide, stearic acid, metal stearates, hydrogenated vegetable oils, corn starch, polyethylene glycol, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulfate, etc.).

[0291] Pharmaceutically acceptable organic or inorganic excipients, which do not react adversely with nucleic acid compounds, are suitable for parenteral or non-parenteral administration, and can also be used to prepare compositions of the present invention. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, saline, alcohol, polyethylene glycol, gelatin, lactose, straight-chain starch, magnesium stearate, talcum, silicic acid, viscous paraffin, hydroxymethyl cellulose, polyvinyl pyrrolidone, etc. Pharmaceutically acceptable diluents include phosphate buffered saline (PBS). PBS is a diluent suitable for parenteral delivery compositions. Therefore, in one embodiment, what is used in the methods described herein is a pharmaceutical composition comprising a dsRNA compound targeting AGT nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is PBS. In certain embodiments, the dsRNA compound is siRNA.

[0292] Pharmaceutical compositions comprising dsRNA compounds (e.g., siRNA) may encompass any pharmaceutically acceptable salt, ester, or salt of such ester, or any other dsRNA that is capable of providing (directly or indirectly) a biologically active metabolite or residue thereof after administration to an animal (including a human). Thus, for example, the present disclosure also relates to pharmaceutically acceptable salts, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents of dsRNA compounds. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

[0293] In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, etc.). In certain such embodiments, the pharmaceutical composition comprises a carrier and is formulated in an aqueous solution, such as water or a physiologically compatible buffer (e.g., Hanks solution, Ringer solution, or physiological saline buffer (e.g., PBS)). In certain embodiments, other ingredients (e.g., ingredients that aid in dissolution or serve as preservatives) are also included. In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, etc. Some pharmaceutical compositions for injection are presented in unit dosage forms (e.g., ampoules or multidose containers).

[0294] dose

[0295] For the purposes of the present disclosure, the amount or dosage of the active agent (oligomeric compound of the present invention) administered should be sufficient, for example, to inhibit the expression of AGT in an animal. In the animal (e.g., human), the dosage will be determined by the efficacy of the specific active agent and the condition of the animal and the weight of the animal to be treated.

[0296] Many assays for determining the administered dosage are known in the art.

[0297] The dosage of the active agent of the present disclosure will also be determined by the presence, nature and extent of any adverse side effects that may accompany the administration of a particular active agent of the present disclosure. Typically, the attending physician will decide on the dosage of the active agent of the present disclosure to treat each individual subject, taking into account various factors such as age, weight, overall health, diet, sex, the active agent of the present disclosure to be administered, the route of administration, and the severity of the condition being treated.

[0298] Drug administration

[0299] In certain embodiments, the pharmaceutical composition is administered according to a dosing regimen (e.g., dosage, dosage frequency, and duration), wherein the dosing regimen can be selected to achieve the desired effect, i.e., to have a therapeutic effect on the subject. The desired effect can be, for example, to reduce AGT or prevent, reduce, improve, or slow the progression of diseases, disorders, and / or conditions or their symptoms associated with AGT or RAAS pathways in the subject. In certain embodiments, the variables of the dosing regimen are adjusted to produce a desired concentration of the pharmaceutical composition in the subject. The "pharmaceutical composition concentration" used in connection with the dosing regimen may refer to a dsRNA compound or active ingredient of the pharmaceutical composition. For example, in certain embodiments, the dosage and dosage frequency are adjusted so that the tissue concentration or plasma concentration of the amount of the pharmaceutical composition is sufficient to achieve the desired effect.

[0300] Administration depends on the severity and responsiveness of the disease state to be treated, and the course of treatment lasts for several days to several months, or until the disease state is cured or alleviated. Administration also depends on the metabolic differences between drug efficacy and the subject. In certain embodiments, the subject's therapeutically effective dose is 0.01 μg to 50 mg per kg body weight, 0.01 μg to 100 mg per kg body weight, or within the administration range of 0.001 mg to 1000 mg, can be administered once or more every day, weekly, monthly, quarterly or annually, even once every 2 to 20 years. After successful treatment, it is best to allow the subject to receive maintenance therapy to prevent the disease state from recurring, wherein the dsRNA is administered with a maintenance dose, ranging from 0.01 μg to 100 mg per kg body weight, once a day or more, once a week or more, once a month or more, once a quarter or more, once a year or more, to once every 20 years or the administration range is 0.001 mg to 1000 mg. In certain embodiments, it may be desirable to administer the dsRNA compound up to once a day, once a week, once a month, once a quarter, once a year, once every two years, once every three years, once every four years, once every five years, once every ten years, to once every 20 years.

[0301] In certain embodiments, the therapeutically effective dose range is between any of 1 mg-1500 mg, 100 mg-1400 mg, 100 mg-1300 mg, 100 mg-1200 mg, 100 mg-1100 mg, 100 mg-1000 mg, 100 mg-900 mg, 200 mg-800 mg, 300 mg-700 mg, 400 mg-600 mg, 100 mg-400 mg, 200 mg-500 mg, 300 mg-600 mg, and 400 mg-700 mg. In certain embodiments, the therapeutically effective dose is about 100 mg, 150 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1000 mg, 1050 mg, 1100 mg, 1150 mg, 1200 mg, 1250 mg, 1300 mg, 1350 mg, 1400 mg, 1450 mg, or 1500 mg. In certain embodiments, the preferred dosage is selected from 700 mg, 800 mg and 900 mg.

[0302] In certain embodiments, the dsRNA of therapeutically effective amount is administered at about 150mg, 200mg, 300mg, 400mg, 500mg, 600mg, 700mg, 800mg or 900mg any one, twice a year. In certain embodiments, the dsRNA of therapeutically effective amount is administered at about 150mg, 200mg, 300mg, 400mg, 500mg, 600mg, 700mg, 800mg or 900mg per quarter. In certain embodiments, the dsRNA of therapeutically effective amount is administered at about 150mg, 300mg or 600mg once every 3 months. In certain embodiments, the dsRNA of therapeutically effective amount is administered at about 150mg, 300mg or 600mg once every 6 months.

[0303] Application

[0304] The dsRNA compound (eg, siRNA) or pharmaceutical composition of the present invention can be administered in a variety of ways, depending on whether local or systemic treatment is desired and the area to be treated. Administration can be oral administration, inhalation administration, or parenteral administration.

[0305] In certain embodiments, the compounds and compositions as described herein are administered parenterally. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial administration, such as intrathecal or intraventricular administration. In certain embodiments, parenteral administration is performed by infusion. Infusion can be chronic or continuous, or transient or intermittent. In certain embodiments, the infused agent is delivered with a pump.

[0306] In certain embodiments, parenteral administration is by injection. The injection can be delivered with a syringe or pump. In certain embodiments, the injection is a bolus injection. In certain embodiments, the injection is administered directly to a tissue or organ.

[0307] In certain embodiments, formulations for parenteral, intrathecal, or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents, and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds, and other pharmaceutically acceptable carriers or excipients.

[0308] In certain embodiments, the formulation for oral administration of the compound or composition may include, but is not limited to, a pharmaceutical carrier, excipient, powder or granule, microparticle, nanoparticle, suspension or solution of water or non-aqueous medium, capsule, gel capsule, pouch, tablet or mini tablet. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or adhesives are all desirable. In certain embodiments, oral formulations are formulations in which the compounds provided herein are administered in combination with one or more penetration enhancers, surfactants and chelating agents.

[0309] In vitro detection of dsRNA

[0310] Described herein are methods of treating cells with dsRNA (eg, siRNA), which dsRNA may be appropriately modified for treatment with other oligomeric compounds.

[0311] When cells reach about 60-80% confluence in culture, the cells can be treated with siRNA.

[0312] A reagent commonly used to introduce siRNA into cultured cells includes the cationic lipid transfection reagent Lipofectamine TM RNAiMAX (Invitrogen, Waltham, MA). siRNA can be expressed in OPTI-MEM 1 (ThermoFisher Scientific, Waltham, MA) and Lipofectamine TMRNAiMAX mix to achieve desired final siRNA concentration and Lipofectamine TM RNAiMAX concentrations can range from 0.001 to 300 nM siRNA. Transfection procedures were performed according to the manufacturer's recommended protocol.

[0313] Another technique for introducing siRNA into cultured cells involves electroporation.

[0314] siRNA conjugated to a GalNAc-containing moiety can be introduced into cells by incubating the siRNA with the cells without a transfection reagent, referred to herein as "free uptake." siRNA-GalNAc conjugates are transported to asialoglycoprotein receptor (ASGR)-positive cells, such as hepatocytes, by endocytosis.

[0315] Cells are treated with siRNA by conventional methods. Cells can be harvested 4-144 hours after siRNA treatment, and the mRNA (harvested at 4-144 hours) or protein levels (extracted at 24-96 hours) of the target nucleic acid are measured by methods known in the art and described herein. In general, treatment is carried out in multiple replicates, and data are presented in the form of the mean value plus standard deviation of the replicate treatments.

[0316] The concentration of siRNA used varies depending on the cell line and target. Methods for determining the optimal siRNA concentration for a specific target in a specific cell line are well known in the art. In general, cells are treated with siRNA in a dose-dependent manner to calculate the half-maximal inhibitory concentration value (IC50). TM When using RNAiMAX transfection, siRNA is typically used at a concentration ranging from 0.001 nM to 300 nM. When using electroporation or free uptake transfection, siRNA is used at higher concentrations ranging from 625 to 20,000 nM.

[0317] RNA Isolation

[0318] RNA analysis of AGT mRNA levels can be performed on total cellular RNA or poly (A) + mRNA. Methods for RNA isolation are well known in the art. RNA is prepared using methods well known in the art, such as TRIZOL reagent (Thermo Fisher Scientific, Waltham, MA), Qiagen RNeasy kit (Qiagen, Hilden, Germany) or AcroPrep Advance 96-well filter plates (Pall Corporation, Port Washington, New York), using Qiagen's RLT, RW1 and RPE buffers. RNA extraction procedures are performed according to the manufacturer's recommended protocols.

[0319] In vivo detection of dsRNA compounds

[0320] dsRNA compounds (e.g., siRNA) are tested in animals to assess their ability to inhibit AGT expression and / or the RAAS pathway, and produce phenotypic changes, such as a reduction in one or more RAAS pathway-related diseases. Detection can be performed in normal animals or in experimental disease models. For animal administration, dsRNA is formulated in a pharmaceutically acceptable diluent (e.g., phosphate-buffered saline). Administration includes parenteral administration routes, such as intraperitoneal administration, intravenous administration, and subcutaneous administration. The calculation of dsRNA doses and dosing frequency depends on factors such as the route of administration and the weight of the animal. In one embodiment, after a period of treatment with dsRNA, mRNA encoding AGT is isolated from liver tissue, and changes in AGT expression are measured. Changes in AGT protein levels can also be measured. Changes in AGT expression can also be measured by determining the level of inhibition of the RAAS pathway in the animal. RAAS pathway-related diseases, disorders, and / or conditions can be used as markers to determine the level of AGT inhibition in the animal.

[0321] Certain indications

[0322] In certain embodiments, the present invention provides a method for treating a subject, comprising administering to the subject one or more compounds and / or pharmaceutical compositions of the present invention. In certain embodiments, the subject suffers from a RAAS pathway-related disease, disorder and / or condition or its symptoms or is at risk of suffering from a RAAS pathway-related disease, disorder and / or condition or its symptoms. In certain embodiments, the present invention provides a method for prophylactically reducing AGT expression in a subject. Certain embodiments include treating the subject in need by administering to the subject a therapeutically effective amount of a dsRNA compound (e.g., siRNA) targeting an AGT nucleic acid.

[0323] In certain embodiments, a therapeutically effective amount of a dsRNA compound targeting an AGT nucleic acid is administered to a subject while monitoring the AGT level in the subject's plasma or tissue to determine the subject's response to the administration of the dsRNA compound. The physician uses the subject's response to the administration of the dsRNA compound to determine the amount and duration of therapeutic intervention.

[0324] In certain embodiments, administration of a dsRNA compound targeting an AGT nucleic acid to a subject results in a reduction in AGT expression of at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%, or a range defined by any two of these values. In certain embodiments, administration of a dsRNA compound targeting an AGT nucleic acid to a subject results in an inhibition of the RAAS pathway of at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%, or a range defined by any two of these values. In certain embodiments, administration of a dsRNA compound targeting an AGT nucleic acid to a subject results in a change in a RAAS pathway-related disease, disorder, condition, symptom, or marker (e.g., hypertension or organ damage) in the subject. In certain embodiments, administration of an AGT dsRNA compound to a subject results in an increase or decrease in the RAAS-related disease, disorder, condition, symptom, or marker by at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%, or a range defined by any two of these values ​​for the subject.

[0325] In certain embodiments, a pharmaceutical composition comprising a dsRNA compound targeted to AGT is used in the preparation of a medicament for treating a subject suffering from or susceptible to a RAAS-related disease, disorder, or condition.

[0326] In certain embodiments, the dsRNA compound is an siRNA targeting AGT designed by ARNATAR as listed in Table 2, Table 5, Table 7, Table 9, Table 10 or Table 13.

[0327] Certain combination therapies

[0328] In certain embodiments, a first agent comprising a dsRNA compound provided herein is co-administered to a subject with one or more second agents. In certain embodiments, the dsRNA compound is an ARNATAR siRNA listed in Table 2, Table 5, Table 7, Table 9, Table 10, or Table 13.

[0329] In certain embodiments, such a second agent is designed to treat the same RAAS pathway-related disease, disorder or condition as the first agent described herein. In certain embodiments, such a second agent is designed to treat a disease, disorder or condition different from the first agent described herein. In certain embodiments, such a second agent is designed to treat the adverse side effects of one or more pharmaceutical compositions as described herein. In certain embodiments, such a first agent is designed to treat the adverse side effects of the second agent. In certain embodiments, the second agent is co-administered with the first agent to treat the adverse effects of the first agent. In certain embodiments, the second agent is co-administered with the first agent to produce a combined effect or an additive effect. In certain embodiments, the second agent is co-administered with the first agent to produce a synergistic effect.

[0330] In certain embodiments, the co-administration of the first and second medicaments allows the use of a lower dose than the dose required to achieve a therapeutic or preventive effect when the two medicaments are administered as independent therapies. In certain embodiments, the dose of the co-administered second medicament is the same as the dose that would be administered if the second medicament were administered alone. In certain embodiments, the dose of the co-administered second medicament is greater than the dose that would be administered if the second medicament were administered alone.

[0331] In certain embodiments, the first medicament and one or more second medicaments are administered simultaneously. In certain embodiments, the first medicament and one or more second medicaments are administered at different times. In certain embodiments, the first medicament and one or more second medicaments are prepared together in a single drug formulation. In certain embodiments, the first medicament and one or more second medicaments are prepared separately.

[0332] In certain embodiments, the second agent includes, but is not limited to, certain procedures to reduce hypertension, dietary changes, lifestyle changes, anti-fibrotic drugs, and anti-hypertensive drugs, such as RAAS inhibitors, diuretics, calcium channel blockers, adrenergic receptor antagonists, adrenergic agonists, and vasodilators.

[0333] Examples of procedures that can reduce hypertension include, but are not limited to, renal denervation and baroreceptor activation therapy.

[0334] Examples of RAAS inhibitors include, but are not limited to, ACE inhibitors (e.g., captopril, enalapril, fosinopril, lisinopril, perindopril, quinapril, ramipril, trandolapril, and benazepril), angiotensin II receptor antagonists (e.g., candesartan, eprosartan, irbesartan, losartan, olmesartan, telmisartan, and valsartan), renin inhibitors (e.g., aliskiren), and aldosterone receptor antagonists (e.g., eplerenone and spironolactone).

[0335] Examples of diuretics include loop diuretics (e.g., bumetanide, ethacrynic acid, furosemide, torsemide), thiazide diuretics (e.g., epithiazide, hydrochlorothiazide, chlorothiazide, and bendroflumethiazide), thiazide diuretics (e.g., indapamide, chlorthalidone, and metolazone), and potassium-sparing diuretics (e.g., amiloride, triamterene, and spironolactone).

[0336] Examples of calcium channel blockers include dihydropyridines (eg, amlodipine, felodipine, isradipine, lercanidipine, nicardipine, nifedipine, nimodipine, and nitrendipine) and non-dihydropyridines (eg, diltiazem and verapamil).

[0337] Examples of adrenergic receptor antagonists include beta blockers (e.g., atenolol, metoprolol, nadolol, oxprenolol, pindolol, propranolol, and timolol), alpha blockers (e.g., doxazosin, phentolamine, indolamin, phenoxybenzamine, prazosin, terazosin, and tolazoline), and mixed alpha+beta blockers (e.g., bucinolol, carvedilol, and labetalol).

[0338] Examples of vasodilators include sodium nitroprusside and hydralazine and its derivatives.

[0339] Examples of adrenergic agonists include alpha-2 agonists (eg, clonidine, guanabenz, methyldopa, and moxonidine).

[0340] Other examples of antihypertensive drugs include guanethidine, reserpine, and the like.

[0341] The second agent can be used in combination with the therapeutic compounds described herein to reduce RAAS pathway-related diseases, disorders, and / or conditions, such as hypertension, organ damage, etc., in the subject.

[0342] Kit of the present invention

[0343] According to another aspect of the present invention, a kit is provided. The kit according to the present invention includes a package containing any of the compositions of the present invention or the oligomeric compounds of the present invention. In various aspects, the kit contains any of the compositions of the present invention as a unit dose. For the purposes of this article, "unit dose" refers to a discrete amount dispersed in an appropriate carrier.

[0344] The term "package" refers to any container containing the compositions described herein. In a preferred embodiment, the package can be a box or a parcel. Packaging materials used to package pharmaceuticals are well known to those skilled in the art. Examples of pharmaceutical packaging materials include, but are not limited to, blister packs, bottles, tubes, inhalers, pumps, bags, vials, containers, syringes (including prefilled syringes), bottles, and any packaging material suitable for the selected formulation and the intended mode of administration and treatment.

[0345] The kit may also contain items that are not contained within the package but are attached to the outside of the package, such as pipettes.

[0346] The kit may optionally contain instructions for administering the composition of the present invention to a subject suffering from a condition in need of treatment. The kit may also include instructions for use of the composition components described herein approved by a regulatory agency (e.g., the U.S. Food and Drug Administration). The kit may optionally contain a label or product insert of the composition. The packaging and / or any product insert itself may be approved by a regulatory agency. The kit may include a solid or liquid phase composition (e.g., a buffer provided) in the packaging. The kit may also include a buffer for preparing a solution for implementing the method, and a pipette for transferring a liquid from one container to another container.

[0347] The kit may also optionally contain one or more other compositions for use in the combined therapies described herein. In certain embodiments, the packaging is a container for any means of administration (e.g., intravitreal delivery, intraocular delivery, intratumoral delivery, peritumoral delivery, intraperitoneal delivery, intrathecal delivery, intramuscular injection, subcutaneous injection, intravenous delivery, intraarterial delivery, intraventricular delivery, intrasternal delivery, intracranial delivery, or intradermal injection).

[0348] Methods of use and compounds used

[0349] The present invention provides a method for inhibiting the expression of AGT in a subject and a method for treating RAAS-related diseases, disorders and / or conditions or symptoms thereof in a subject, comprising administering an effective amount of a dsRNA compound of the present invention or a pharmaceutical composition of the present invention to inhibit the expression of AGT in the subject. The present invention also provides a compound for therapeutic use for treating or preventing RAAS-related diseases, disorders and / or conditions in a subject.

[0350] In some embodiments of the present disclosure, the subject is a mammal, including but not limited to rodents (e.g., mice and hamsters), and lagomorphs (e.g., rabbits), carnivores (including felines (cats) and canines (dogs)), artiodactyls (including bovines (cows) and suidae (domestic pigs)), or odd-toed ungulates (including equines (horses)). In certain aspects, the mammal belongs to the order Primates, Ceboids, or Simoids (monkeys), or to the order Anthropoids (humans and apes). In preferred aspects, the mammal is a human.

[0351] Advantages of the present invention

[0352] Disclosed herein are dsRNA compounds (e.g., siRNA) targeting AGT, with an efficient RNA targeting (ARNATAR) capability that enhances its gene silencing activity. The dsRNA compound utilizes the ARNATAR motif to bind to a sequence targeting AGT to generate a stable and lasting therapeutic compound, providing more lasting benefits and / or reducing the frequency of administration of the therapeutic compound to acute and chronic diseases. In addition to stability and durability, the dsRNA compound utilizing the ARNATAR motif may have a faster mode of action (e.g., by knocking down AGT expression earlier than a reference compound), which is beneficial to acute diseases. In some cases, it has been found that ARNATAR dsRNA is more effective than a reference compound.

[0353] Another benefit of the dsRNA targeting AGT designed by ARNATAR is its short length, which enables a shorter synthesis scheme and shorter synthesis time, and reduces the cost of preparing the compound.

[0354] In addition, the dsRNA compounds designed by ARNATAR are very potent inhibitors of AGT. This high potency can reduce AGT in tissues other than the liver.

[0355] Therefore, there is a need for improved dsRNA compounds to treat disease.ARNATAR dsRNA compounds targeting AGT have been designed to improve speed, stability, specificity, safety and efficacy, thereby generating improved therapeutics.

[0356] Example

[0357] Although certain compounds, compositions and methods described herein have been specifically described according to certain embodiments, the following examples are only used to illustrate the compounds described herein and are not intended to limit their scope. The entire contents of each reference cited in this application are incorporated herein by reference.

[0358] Example 1: Design of AGT siRNAs with different chemical motifs

[0359] siRNA designed with the ARNATAR motif targeted angiotensinogen (AGT) transcript (Table 1).

[0360] Table 1: AGT target sequences

[0361] name SEQ ID NO: GenBank NM_001382817.3 1

[0362] The design of siRNA targeting AGT (also referred to as AGT siRNA) is shown in Table 2.

[0363] The following applies to all modified sequences disclosed herein:

[0364] Each nucleotide is preceded by a symbol indicating the type of chemical modification (if any) performed on the nucleotide. If there is no modification symbol before the letter designating the nucleotide, the nucleotide is a deoxyribonucleotide. The chemical modification symbols for the chain are as follows:

[0365] (5p) = 5'-phosphate

[0366] r = ribonucleotide

[0367] d (or no symbol before the nucleotide) = a deoxyribonucleotide that has been used to replace a ribonucleotide

[0368] f=2'-F

[0369] m=2'-OMe

[0370] * = phosphorothioate (PS) bond substituted for phosphate (PO) bond

[0371] gna = ethylene glycol nucleic acid

[0372] If more than one sequence is disclosed in one row of a table, the SEQ ID NO applies to the modified sequence ("sequence+chemical name").

[0373] Each ARNATAR positive strand is conjugated with a GalNAc-containing moiety as described by Sharma (Sharma et al., 2018, Bioconjugate Chem, 29: 2478-2488, incorporated herein by reference; also referred to herein as GalNAc3 or GA3; Gene Link, Elmsford, NY, USA) or GalNAc of AM Chemicals (U.S. Patent No. 10,087,208, incorporated herein by reference; also referred to herein as GalNAc2 or GA2). As a control, a reference siRNA (also referred to herein as ATXL-G or benchmark siRNA) was synthesized and included in the studies described herein. The reference siRNA ATXL-G (Table 2A) reflects a compound referred to as AD85481 in the prior art (WO2019 / 222166, incorporated herein by reference), and is considered to be Zilebesiran, which is currently undergoing clinical trials.

[0374] Table 2: AGT siRNA with modifications on both strands

[0375]

[0376]

[0377] Table 2A: Reference siRNAs

[0378]

[0379] In vitro screening of siRNA targeting human AGT mRNA in cells

[0380] The siRNA was incubated with human primary hepatocytes (HPH) and taken up by the cells by free uptake, i.e., the siRNA was incubated with the cells in the absence of a transfection reagent and entered the cells by endocytosis via the interaction of the GalNAc conjugate and the ASGR receptor. The cells were incubated for 41-48 hours at different final concentrations, and total RNA was prepared using AcroPrepAdvance 96-well filter plates (Pall Corporation, Port Washington, New York) and Qiagen's RLT, RW1 and RPE buffers. AGT mRNA levels were determined by qRT-PCR using an AGT-specific primer probe set as listed in Table 3. qRT-PCR was performed using the AgPath-ID real-time PCR system (ThermoFisher Scientific, Waltham, MA, USA). TMOne-step RT-PCR was performed using a single-step RT-PCR reagent. The AGT target RNA levels detected in the qRT-PCR assay were normalized to those using RiboGreen TM (ThermoFisher Scientific, Waltham, MA, USA) measured total RNA levels. Figure 1 The IC50 was calculated and shown in Table 4.

[0381] Table 3: Primer probe set sequences for human AGT

[0382] name sequence SEQ ID NO: hsAGT-F CTGATCCAGCCTCACTATGC 24 hsAGT-R AGGTCATAAGATCCTTGCAGC 25 hsAGT-P AGGGTCTCACTTTCCAGCAAAACTCC 26

[0383] Table 4: Inhibitory effect of AGT siRNA in HPH cells after 48 hours

[0384] AGT siRNAs IC50(uM) ATsi603 0.0009 <![CDATA[ATsi600 # ]]> 0.0015 ATsi609 0.0025 ATsi481 0.0027 ATsi489 0.0031 ATsi606 0.0042 ATXL-G(previous batch)* 0.0058 <![CDATA[ATsi484 # ]]> 0.0071 <![CDATA[ATsi483 # ]]> 0.0074 ATXL-G(DR)* 0.0136 ATsi480 0.0213 ATsi610 0.0254 ATsi611 0.0255 ATsi612 0.0269 ATsi605 0.032 ATsi613 1.672

[0385] *ATXL-G was synthesized in two batches: “previous batch” and “DR”

[0386] #Table 7 lists the sequences and chemical names of these siRNAs

[0387] The results showed that some of the ARNATAR-designed siRNAs appeared to be more effective than the reference siRNA ATXL-G targeting AGT.

[0388] Example 2: In vitro comparison of ARNATAR modification and ESC / ESC+ modification of different siRNA sequences

[0389] The above results show that the ARNATAR chemical modification motif produces a potent AGT siRNA. In order to further determine the effects of different siRNA modification motifs, siRNAs targeting 5 different regions of human AGT were designed. For comparison, siRNAs were designed using the ARNATAR motif, or siRNAs were designed using third-party structures and modifications (ESC or ESC+, as described in Hu et al., Therapeutic siRNA: State of the Art, Signal Transduction and Targeted Therapy, 2020, 5: 101; Zilebesiran uses the ESC+ modification motif). Since the chain length of the ESC / ESC+ motif is different from that of the ARNATAR motif, the AGT siRNA antisense sequence is matched from the 5' end to maintain a consistent seed sequence. In addition, in order to compare only the chemical modification motif, siRNA was prepared without a GalNAc conjugate. The siRNA designed by the ARNATAR has a 5'-phosphate on the antisense strand. The AGT siRNA sequence and chemical name are listed in Table 5. Third-party designs are indicated by the letters "AL" or "AL1".

[0390] Table 5: Oligomeric compounds targeting different regions of AGT mRNA.

[0391]

[0392]

[0393] ++ Due to the absence of gnaG, 612-Ala differs from normal ESC+ chemistry in the arrangement of the gna modification, however, gna at position 6 is also widely used in drug discovery (see PCT / US2019 / 032150).

[0394] +++ Due to the absence of gnaG, 598a-AL does not contain a gna at position 7, similar to the ESC chemical designation.

[0395] In vitro assays - comparison of the ARNATAR motif with third-party motifs

[0396] AGT siRNA without GalNAc conjugate was transfected into Hep3B cells at a concentration of 0-10 nM using RNAiMAX (Invitrogen, Waltham, MA), and the cells were further cultured for 24 hours. siRNA activity was determined by qRT-PCR using the primer probe sets listed in Table 3. The IC50 of siRNA targeting AGT is shown in Table 6, and the dose response curve of siRNA to AGT mRNA level in Hep3B cells is shown in Table 6. Figure 2 shown.

[0397] Table 6: Activity of siRNA targeting AGT in Hep3B cells

[0398]

[0399]

[0400] The results showed that for all these different sequences, the optimized ARNATAR design was more effective than the third-party design (P < 0.0001), indicating that the optimized ARNATAR motif is universal and the enhanced activity is applicable to different sequences.

[0401] Example 3: ARNATAR AGT siRNA shows better activity and longer duration in animals compared to reference siRNA

[0402] To compare the in vitro and in vivo activity and duration of siRNAs with the reference siRNA ATXL-G, selected ARNATAR siRNAs with different chemical names were designed and synthesized using GalNAc3 (Table 7).

[0403] Table 7: AGT oligomeric compounds with modifications on both chains

[0404]

[0405] In vitro assay

[0406] siRNA was delivered to human primary hepatocytes (HPH) at different final concentrations by free uptake, i.e., siRNA was incubated with cells in the absence of transfection reagents and entered the cells by endocytosis via GalNAc conjugate and ASGR receptor interaction. Cells were incubated for 42 hours and total RNA was prepared using AcroPrep Advance 96-well filter plates (Pall Corporation, Port Washington, New York) and Qiagen's RLT, RW1 and RPE buffers. AGT mRNA levels were determined by qRT-PCR using AGT-specific primer probe sets as listed in Table 3. qRT-PCR was performed using the AgPath-ID real-time PCR system (ThermoFisher Scientific, Waltham, MA, USA). TM One-step RT-PCR was performed using a single-step RT-PCR reagent. The AGT RNA levels detected in the qRT-PCR assay were normalized to those using RiboGreen TM (Thermo Fisher Scientific, Waltham, MA, USA) measured total RNA levels. Figure 3 IC50 was calculated and shown in Table 8.

[0407] Table 8: IC50 of siRNA inhibition of AGT mRNA in HPH

[0408] ATsi483 ATsi600 ATsi484 ATXL-G IC50(uM) 0.00258 0.00956 0.01543 0.00259

[0409] The results indicate that ARNATAR siRNA compounds (eg, ATsi483) exhibit comparable activity to the reference siRNA ATXL-G.

[0410] In vivo studies 1

[0411] In order to evaluate the in vivo activity of human AGT siRNA, a mouse model expressing human AGT was made. 7-week-old BALB / c mice were intravenously injected with adeno-associated virus (AAV) serotype AAV8 expressing human AGT mRNA (GenBank NM_001382817.3; Sands MS, AAV-Mediated Liver-Directed Gene Therapy, 2014, Methods Mol Biol, 807: 141-157). At least 3 weeks after viral administration, blood was collected from mice using lithium heparin as an anticoagulant, and blood samples were centrifuged at 2000 × g for 10 minutes at 4 ° C to prepare plasma. Then, plasma AGT protein levels were determined using a human AGT-specific ELISA kit (IBL, Minneapolis, MN, catalog number 27412). The AGT level of individual animals at this time point was used as a baseline for AGT (protein) expression.

[0412] To determine the in vivo activity of siRNA, siRNA was administered subcutaneously to AGT transgenic mice at 1 mg / kg (ATsi483, ATsi484, and ATXL-G) or 3 mg / kg (ATsi483, ATsi484, ATsi600, and ATXL-G) the day after baseline blood collection (N = 4-6 per siRNA dose cohort). Blood samples were then collected at designated times after siRNA administration, and AGT protein levels in plasma were measured by ELISA. Figure 4 Mean AGT protein levels relative to baseline levels (measured on day -1 prior to dosing) are shown.

[0413] Results showed that ARNATAR siRNAs displayed comparable (ATsi483 and ATsi484) or better (ATsi600) in vivo activity compared to the reference siRNA ATXL-G, with similar durations over the assay timeframe of more than 6 weeks. Interestingly, several siRNAs (e.g., ATsi484 and ATsi600) appeared slightly less active than the reference siRNA by free uptake in cell culture, but similar or better activity than the reference siRNA was observed in animals. These results suggest that there are some differences in activity between the cell culture and in vivo systems.

[0414] Example 4. In vivo evaluation of different sequences and modifications

[0415] To further evaluate the effects of sequence and chemical motifs on AGT siRNA activity, new ARNATAR siRNAs containing different sequences, different modification motifs or different lengths were synthesized. The siRNAs were conjugated with GalNAc3 (GA3 from Gene Link, Elmsford, NY, USA). Table 9 lists the siRNAs.

[0416] Table 9: AGT oligomeric compounds with modifications on both chains

[0417]

[0418] To make a mouse model expressing human AGT, 7-week-old BALB / c mice were intravenously injected with adeno-associated virus (AAV) serotype AAV8 expressing human AGT mRNA (GenBank NM_001382817.3; Sands MS, AAV-Mediated Liver-Directed Gene Therapy, 2014, Methods Mol Biol, 807: 141-157). At least 3 weeks after viral administration, blood was collected from mice, and blood samples were centrifuged at 2000 × g for 10 minutes at 4°C to prepare plasma. Plasma AGT protein levels were then determined using a human AGT-specific ELISA kit (IBL, Minneapolis, MN, catalog number 27412). The AGT level of individual animals at this time point was used as a baseline for AGT (protein) expression.

[0419] To determine the in vivo activity of siRNA, siRNA was administered subcutaneously at 3 mg / kg the day after baseline blood collection (N=3-4). Blood samples were then collected at the indicated times after siRNA administration, and AGT protein levels in plasma were measured by ELISA. Figure 5 The mean AGT protein levels relative to baseline levels (measured on day -1 before dosing) are shown. Figure 4 ), the reference compound ATXL-G had ~40% of the AGT level at the last time point (31 days), which is similar to ATsi610 and ATsi643. The results show that some siRNA compounds (such as ATsi643 and ATsi610) are comparable to the reference siRNA in terms of activity and duration.

[0420] Example 5: In vitro and in vivo evaluation of additional sequences and modifications

[0421] To further evaluate the effects of sequence and chemical motifs on siRNA activity, new ARNATAR siRNAs containing different sequences, different modified motifs, different lengths, or with native or TT overhangs were synthesized. For example, the sequences of ATsi603 and ATsi612 contained mutations that mismatched with SEQ ID NO: 1. The siRNAs were conjugated with GalNAc3 (GA3 from Gene Link, Elmsford, NY, USA). Table 10 lists the siRNAs.

[0422] Table 10: AGT oligomeric compounds with modifications on both chains

[0423]

[0424] In vitro assay

[0425] For better comparison, the two siRNAs evaluated above (ATsi600 and ATsi610) were also included in the evaluation of additional ARNATAR siRNAs.

[0426] siRNA was delivered to human primary hepatocytes (HPH) at different final concentrations by free uptake, i.e., siRNA was incubated with cells in the absence of transfection reagents and entered the cells by endocytosis via GalNAc conjugate and ASGR receptor interaction. Cells were incubated for 42 hours and total RNA was prepared using AcroPrep Advance 96-well filter plates (Pall Corporation, Port Washington, New York) and Qiagen's RLT, RW1 and RPE buffers. AGT mRNA levels were determined by qRT-PCR using AGT-specific primer probe sets as listed in Table 3. qRT-PCR was performed using the AgPath-ID real-time PCR system (ThermoFisher Scientific, Waltham, MA, USA). TM One-step RT-PCR was performed using a single-step RT-PCR reagent. The AGT RNA levels detected in the qRT-PCR assay were normalized to those using RiboGreen TM (Thermo Fisher Scientific, Waltham, MA, USA) measured total RNA levels. Figure 6 IC50 was calculated and shown in Table 11.

[0427] Table 11: IC50 of siRNA inhibition of AGT mRNA in human primary hepatocytes

[0428] ATsi603 ATsi610 ATsi612 ATsi633 ATsi600 ATXL-G IC50(uM) 0.101 0.267 0.201 1.617 0.137 0.043

[0429] In vivo studies

[0430] In order to make a mouse model expressing human AGT, 7-week-old BALB / c mice were intravenously injected with adeno-associated virus (AAV) serotype AAV8 expressing human AGT mRNA (GenBank NM_001382817.3; Sands MS, AAV-Mediated Liver-Directed Gene Therapy, 2014, Methods Mol Biol, 807: 141-157). At least 3 weeks after viral administration, blood was collected from mice, and blood samples were centrifuged at 2000×g for 10 minutes at 4°C to prepare plasma. Plasma AGT protein levels were then determined using an ELISA kit specific for human AGT (IBL, Minneapolis, MN, catalog number 27412). The AGT level of individual animals at this time point was used as a baseline for AGT (protein) expression.

[0431] To determine the in vivo activity of siRNA, selected siRNAs ATsi603, ATsi612, ATsi665 and benchmark siRNA ATXL-G (N=2-4) were administered subcutaneously at 3 mg / kg the day after baseline blood collection. Blood samples were then collected at the indicated times after siRNA administration, plasma was prepared, and AGT protein levels in plasma were measured by ELISA. The mean AGT protein levels relative to baseline levels (measured on day -1 before dosing) were as follows: Figure 7 As shown in Table 12.

[0432] Table 12: Percentage of plasma AGT protein levels relative to baseline AGT protein

[0433] ATsi665 ATXL-G ATsi612 ATsi603 Week 1 46.38 17.03 12.77 18.00 Week 2 46.8 18.7 18.6 17.9

[0434] The results again showed that although some siRNAs (eg, ATsi612) showed slightly lower activity in vitro, in vivo, this siRNA compound showed slightly better or comparable activity and duration to the reference siRNA.

[0435] Example 6: In vitro and in vivo evaluation of selected oligomeric compounds

[0436] To further evaluate the effect of GalNAc conjugates on siRNA activity, new ARNATAR siRNAs containing the sequence and chemical motifs of ATsi603 or ATsi612 (see Table 10) were designed, but conjugated with different GalNAc-containing moieties (GalNAc-AN is also referred to as GA-AN or GA4, and the description of GA4 is described above). Table 13 lists the new siRNAs.

[0437] Table 13: AGT oligomeric compounds with modifications on both chains

[0438]

[0439] In vitro assay: time course in Hep3B cells

[0440] siRNAs ATsi603, ATsi786, ATsi787 and benchmark siRNA ATXL-G targeting AGT were transfected into Hep3B cells at 0 nM, 0.008 nM, 0.04 nM, 0.2 nM, 1 nM and 5 nM using RNAiMAX (Invitrogen, Waltham, MA) and further cultured for 8 hours or 13 hours. siRNA activity was determined by qRT-PCR using the primer probe sets listed in Table 3.

[0441] AGT RNA levels detected in qRT-PCR assays were normalized to those expressed as RiboGreen TM Total RNA levels were measured by ELISA (Thermo Fisher Scientific, Waltham, MA, USA). The percentage of AGT mRNA levels was as follows Figure 8 ATsi786 and ATsi603 were more effective than ATXL-G, P = 0.0047 and 0.0033 at 8 hours and P = 0.0019 and 0.0385 at 12 hours.

[0442] In vivo assay

[0443] In order to make a mouse model expressing human AGT, 7-week-old BALB / c mice were intravenously injected with adeno-associated virus (AAV) serotype AAV8 expressing human AGT mRNA (GenBank NM_001382817.3; Sands MS, AAV-Mediated Liver-Directed Gene Therapy, 2014, Methods Mol Biol, 807: 141-157). At least 3 weeks after viral administration, blood was collected from mice, and blood samples were centrifuged at 2000×g for 10 minutes at 4°C to prepare plasma. Plasma AGT protein levels were then determined using an ELISA kit specific for human AGT (IBL, Minneapolis, MN, catalog number 27412). The AGT level of individual animals at this time point was used as a baseline for AGT (protein) expression.

[0444] To determine the in vivo activity of siRNA, siRNAs targeting AGT, ATsi786, ATsi787, and benchmark siRNA ATXL-G (N=3-4) were administered subcutaneously at 3 mg / kg the day after baseline blood collection. Blood samples were then collected weekly for up to 6 or 7 weeks after siRNA administration, plasma was prepared, and AGT protein levels in plasma were measured by ELISA. Fig. 9 Mean AGT protein levels relative to baseline levels (measured on day -1 before dosing) are shown. Fig. 9 As shown, ATsi786 was slightly more potent than baseline ATXL-G in reducing AGT expression at several time points.

[0445] Example 7: Evaluation of Selected Oligomeric Compounds in AGT Transgenic Mice

[0446] To evaluate the early kinetics of human AGT siRNA activity in vivo, a mouse model expressing human AGT was created. 7-8 week old BALB / c mice were intravenously injected with adeno-associated virus (AAV) serotype AAV8 (GenBank NM_001382817.3; Sands MS, AAV-Mediated Liver-Directed Gene Therapy, 2014, Methods Mol Biol, 807:141-157) expressing human AGT mRNA at 2.5×10 11 Viral genomes. Approximately 3 weeks after viral administration, blood was collected from mice using lithium heparin as an anticoagulant, and blood samples were centrifuged at 2000×g for 10 minutes at 4°C to prepare plasma. Plasma AGT protein levels were then determined using an ELISA kit specific for human AGT (IBL, Minneapolis, MN, catalog number 27412). The AGT levels of individual animals at this time point were used as a baseline for AGT (protein) expression.

[0447] To determine the in vivo activity of siRNA, human AGT siRNA ATsi786 or benchmark ATXL-G was administered at 3 mg / kg by subcutaneous (SC) injection on day 0 (N=3 per group). Approximately 50 μl of blood was collected by cheek bleeding on day -1 (baseline) and days 3, 5, 7, and 10 and placed in CB 300 lithium heparin LH tubes (Sarstedtstr, Nümbrecht Germany) were placed in the blood sample tubes and kept on ice for more than 20 minutes. Plasma was prepared by centrifuging blood samples at 2000×g for 20 minutes at 4°C using a 5425R centrifuge (Eppendorf, Hamburg, Germany), and the supernatant was collected. Human AGT protein levels were determined in plasma (1:1000 dilution) from day -1 to day 10 using a human total angiotensinogen assay kit (product number 27412; IBL-America, Minneapolis, MN, USA) based on the manufacturer's protocol. Relative AGT protein levels at different times were calculated in Excel as a percentage of the AGT protein level on day -1 of the individual animal. The average percentages for each group were calculated in Excel as shown in Table 14 and as shown in Table 14. Fig.10 Draw as shown.

[0448] Table 14: Average expression of AGT protein levels at different time points

[0449]

[0450]

[0451] The results showed that after the administration of ATsi786 siRNA in animals, the level of human AGT protein in plasma was rapidly reduced. ATsi786 reduced human AGT protein faster than the benchmark ATXL-G (P=0.0201).

[0452] sequence

[0453] Table 15: Sequence

[0454]

[0455]

[0456]

Claims

1. A double-stranded ribonucleic acid (dsRNA) compound for inhibiting the expression of angiotensinogen (AGT) in a cell, wherein the dsRNA compound comprises a sense strand and an antisense strand forming a double-stranded portion, wherein the sense strand comprises the nucleotide sequence of SEQ ID NO: 61, and wherein the antisense strand comprises the nucleotide sequence of SEQ ID NO:

62.

2. The double-stranded ribonucleic acid (dsRNA) compound according to the preceding claim, wherein the dsRNA compound is a shRNA compound or a siRNA compound.

3. A double-stranded ribonucleic acid (dsRNA) compound according to any one of the preceding claims, wherein the dsRNA compound comprises at least one modified nucleotide.

4. A double-stranded ribonucleic acid (dsRNA) compound according to any of the preceding claims, wherein substantially all of the nucleotides of the sense strand are modified nucleotides; substantially all of the nucleotides of the antisense strand are modified nucleotides; or substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides.

5. A double-stranded ribonucleic acid (dsRNA) compound according to any preceding claim, wherein all nucleotides of the sense strand are modified nucleotides; all nucleotides of the antisense strand are modified nucleotides; or all nucleotides of the sense strand and all nucleotides of the antisense strand are modified nucleotides.

6. A double-stranded ribonucleic acid (dsRNA) compound according to any preceding claim, wherein the strand comprises at least one phosphorothioate internucleotide (PS) bond.

7. A double-stranded ribonucleic acid (dsRNA) compound according to any of the preceding claims, wherein the sense strand comprises the nucleotide sequence of any one of SEQ ID NOs: 8, 33 and 55, and / or wherein the antisense strand comprises the nucleotide sequence of any one of SEQ ID NOs: 9 and 19.

8. The double-stranded ribonucleic acid (dsRNA) according to any one of the preceding claims, further comprising a conjugate moiety.

9. The double-stranded ribonucleic acid (dsRNA) of claim 8, wherein the conjugate moiety is a moiety comprising N-acetylgalactosamine (GalNAc).

10. The double-stranded ribonucleic acid (dsRNA) according to claim 8 or 9, wherein the conjugate moiety is attached to the 3' end of the sense strand.

11. The double-stranded ribonucleic acid (dsRNA) compound of any preceding claim, wherein the compound inhibits the expression of angiotensinogen (AGT) in a cell by at least about 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%.

12. A pharmaceutical composition for inhibiting the expression of angiotensinogen (AGT) in cells, wherein the pharmaceutical composition comprises the double-stranded ribonucleic acid (dsRNA) compound according to any of the preceding claims, or the pharmaceutical composition comprises the double-stranded ribonucleic acid (dsRNA) compound according to any of the preceding claims in combination with a pharmaceutically acceptable carrier or excipient.

13. A method for inhibiting the expression of angiotensinogen (AGT) in a cell, comprising contacting the cell with a compound according to any one of claims 1 to 11 or a pharmaceutical composition according to claim 12 in an amount sufficient to inhibit the expression of AGT, thereby inhibiting the expression of AGT in the cell.

14. A method for treating a RAAS-related disease, disorder and / or condition in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of a compound according to any one of claims 1-11 or a pharmaceutical composition according to claim 12, thereby treating the RAAS-related disease, disorder and / or condition in the subject.

15. The method of claim 14, wherein the RAAS-related disease, disorder and / or condition is selected from the group consisting of: hypertension, hypertension, borderline hypertension, essential hypertension, secondary hypertension, isolated systolic or diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, refractory hypertension, resistant hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt's hypertension, hypertension associated with low plasma renin activity or plasma renin concentration, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, unstable hypertension; hypertension heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vascular disease, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, glomerulosclerosis, aortic coarctation, aortic aneurysm, ventricular fibrosis, heart failure, myocardial infarction, angina pectoris, stroke, kidney disease, renal failure, systemic sclerosis, intrauterine growth restriction (IUGR), fetal growth restriction, obesity, hepatic steatosis / fatty liver, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD); glucose intolerance, type 2 diabetes (non-insulin-dependent diabetes mellitus) and metabolic syndrome.

16. The method of any one of claims 13-15, wherein the compound or pharmaceutical composition inhibits the expression of AGT by at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%.

17. A method for treating a subject suffering from a disease, disorder and / or condition that would benefit from reduced expression of angiotensinogen (AGT), comprising administering to the subject in need thereof a therapeutically effective amount of a compound as described in any one of claims 1-11 or a pharmaceutical composition as described in claim 12, thereby treating the subject suffering from the disorder that would benefit from reduced expression of AGT.

18. A method for preventing at least one symptom in a subject with a condition that would benefit from reduced expression of angiotensinogen (AGT), comprising administering to the subject in need thereof a preventive effective amount of a compound as described in any one of claims 1-11 or a pharmaceutical composition as described in claim 12, thereby preventing at least one symptom in the subject with the condition that would benefit from reduced expression of AGT.

19. The method of claim 17 or 18, wherein the disorder is a RAAS-related disease, disorder and / or condition.

20. The method of claim 19, wherein the RAAS-related disease, disorder and / or condition is selected from the group consisting of: hypertension, hypertension, borderline hypertension, essential hypertension, secondary hypertension, isolated systolic or diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, refractory hypertension, resistant hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt's hypertension, hypertension associated with low plasma renin activity or plasma renin concentration, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, unstable hypertension; hypertension heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vascular disease, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, glomerulosclerosis, aortic coarctation, aortic aneurysm, ventricular fibrosis, heart failure, myocardial infarction, angina pectoris, stroke, kidney disease, renal failure, systemic sclerosis, intrauterine growth restriction (IUGR), fetal growth restriction, obesity, hepatic steatosis / fatty liver, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD); glucose intolerance, type 2 diabetes (non-insulin-dependent diabetes mellitus) and metabolic syndrome.

21. The method of any one of claims 13-20, further comprising administering to the subject an additional therapeutic agent for treating a RAAS-related disease, disorder, and / or condition in the subject.

22. A kit comprising the compound of any one of claims 1-11 or the pharmaceutical composition of claim 12, and optionally a label.

23. A method for preparing the sense strand and / or antisense strand of the double-stranded ribonucleic acid (dsRNA) compound of any one of claims 1 to 11, wherein the method comprises the following steps: a. preparing the sense strand and / or antisense strand by sequentially coupling modified and / or unmodified nucleotides via phosphoramidite oligonucleotide synthesis on a solid support; b. optionally, coupling the sense strand and / or antisense strand comprising GalNAc to the solid support by phosphoramidite oligonucleotide synthesis; c. separating the sense strand and / or antisense strand from the solid support and removing the solid support; and d. Optionally, further purifying the sense strand and / or antisense strand, optionally using chromatography.

24. A method for preparing the sense strand and / or antisense strand of the double-stranded ribonucleic acid (dsRNA) compound of any one of claims 1 to 11, wherein the method comprises the following steps: a. coupling the GalNAc-containing moiety to a solid support by phosphoramidite oligonucleotide synthesis, b. coupling the modified and / or unmodified nucleotides to the GalNAc-containing portion on the solid support by phosphoramidite oligonucleotide synthesis; c. sequentially coupling additional modified and / or unmodified nucleotides by phosphoramidite oligonucleotide synthesis to prepare the sense strand and / or antisense strand; d. separating the sense strand and / or antisense strand from the solid support and removing the solid support; and e. Optionally, further purifying the sense strand and / or antisense strand, optionally using chromatography.

25. A method for preparing a double-stranded ribonucleic acid (dsRNA) compound according to any one of claims 1 to 11, comprising: a) contacting the sense strand prepared according to claim 23 or 24 with the antisense strand prepared according to claim 24 or 23 in a solution at equimolar concentrations; b) optionally heating the solution to a temperature of about 94° C.; and c) optionally reducing the temperature of the solution to about 25°C.

26. A double-stranded ribonucleic acid (dsRNA) compound as defined in any one of claims 1 to 11 for use in medicine.

27. A double-stranded ribonucleic acid (dsRNA) compound as defined in any one of claims 1 to 3 for use in treating or preventing a RAAS-related disease, disorder and / or condition in a subject.

28. The double-stranded ribonucleic acid (dsRNA) compound for use according to claim 27, wherein the RAAS-related disease, disorder and / or condition is selected from the group consisting of: hypertension, hypertension, critical hypertension, essential hypertension, secondary hypertension, isolated systolic or diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, refractory hypertension, resistant hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt's hypertension, hypertension associated with low plasma renin activity or plasma renin concentration, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, unstable Hypertension; hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vascular disease, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, glomerulosclerosis, aortic coarctation, aortic aneurysm, ventricular fibrosis, heart failure, myocardial infarction, angina pectoris, stroke, kidney disease, renal failure, systemic sclerosis, intrauterine growth restriction (IUGR), fetal growth restriction, obesity, hepatic steatosis / fatty liver, non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver disease (NAFLD); glucose intolerance, type 2 diabetes (non-insulin-dependent diabetes mellitus) and metabolic syndrome.

Images