Breeding method of high-yield and high-taste high-quality black rice indica rice
By using Wx and ALK genes for hybrid breeding, new black rice indica rice varieties with low amylose content, high alkaline depletion value and large glue consistency were cultivated, which solved the problem of poor food taste quality in the existing black rice steaming and cooking, achieved the effect of high yield, excellent food taste, and low gelatinization temperature, and increased consumers' acceptance of black rice.
Patent Information
- Application Number
- CN202510183089.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-18
- Publication Date
- 2025-03-28
AI Technical Summary
The current black rice has poor taste and hard texture and rough taste, which affects consumers' acceptance of black rice.
Through hybrid breeding, using the Wx and ALK genes, a new black rice indica rice variety with amylose content less than 2%, alkali depletion value higher than 5.0, and gel consistency greater than 60mm was cultivated to improve its steamed and cooked food quality.
The black rice indica rice has achieved high yield and excellent food taste, lower gelatinization temperature and shortened steaming time, which significantly improves consumers' acceptance of black rice and meets consumers' demand for excellent food taste quality and nutritious and healthy food.
Smart Images
Figure CN119699180A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of crop breeding, and in particular to a method for breeding black rice with high yield and good taste. Background Art
[0002] Rice is rich in carbohydrates and is the main source of energy for the human body. It is also the staple food of more than half of the world's population. China is the largest rice producer and consumer. High yield has always been the primary goal of Chinese rice breeding. However, with the improvement of living standards, people's requirements for rice quality are also rising. On the basis of being full, the taste characteristics and nutrition of rice have also received widespread attention.
[0003] As a representative of black food, black rice has significant kidney-tonifying and qi-invigorating effects. As a precious colored rice, it has higher content of protein, essential amino acids, dietary fiber and unsaturated fatty acids than white rice. Studies have shown that black rice is rich in active substances such as anthocyanins, specific phenolic acids, alkaloids, carotenoids, etc., which are not found in white rice, and these compounds have biological functions such as antioxidant, anti-inflammatory and anti-aging. Whether it is healthy people or people with certain chronic diseases (such as hypertension, diabetes, etc.), they can eat black rice in moderation to supplement nutrition and regulate the body. A large number of studies have confirmed that eating black rice or its extracts can help prevent some fatal diseases and can assist in the treatment of a variety of chronic diseases, such as atherosclerosis, obesity, type II diabetes, hyperlipidemia, osteoporosis and certain cancers. At present, many rice breeding experts have proposed to use black rice instead of white rice as a staple food to more comprehensively meet the human body's nutritional needs. This development can increase the edible part rich in essence by about 30%.
[0004] However, since black rice is mainly consumed in the form of brown rice, the disadvantages of brown rice, such as long cooking time, hard texture and rough taste, pose certain challenges to consumer acceptance. Therefore, it is crucial to improve the steaming and cooking taste quality of black rice and increase consumer acceptance of black rice.
[0005] The cooking and eating quality of black rice mainly depends on the physicochemical properties of its main components. The starch content accounts for 75% to 84% of the dry weight of black rice, which is similar to white rice and brown rice, and is mainly composed of amylose and amylopectin. Amylose content (AC), gel consistency (GC) and alkali digestibility value (ASV) are key indicators for evaluating the cooking and eating quality of black rice, and these traits are mainly determined by the genotype of triploid endosperm. Starch synthase-related genes determine the cooking and eating qualities (ECQs) of rice by affecting the complex genetic network formed by amylose content (AC), gel consistency (GC) and gelatinization temperature (GT).
[0006] Wx and ALK are the main genes that affect AC, GC, and GT. Wx is the only gene that has a major effect on AC and GC, but has a minor effect on GT; ALK is the only gene that has a major effect on GT, but has a minor effect on AC and GC. The ALK gene contains 8 exons. There are 3 single nucleotide polymorphisms (SNPs) in the 8th exon, located at Ex8-733bp (A / G) and Ex8-864 / 865bp (G / T and C / T), respectively. The polymorphism differences at these three sites produce three types of allelic variations, namely A-GC, G-GC, and G-TT. ALK a (A-GC), ALK b (G-TT) regulates low GT, ALK c (G-GC) regulates high GT, and these three ALK alleles are considered to be the main reasons for GT diversity among rice varieties. Therefore, how to use Wx and ALK genes to create new black rice indica germplasm with high yield and good taste through hybrid breeding, and cultivate new black rice indica rice varieties with low amylose content and excellent comprehensive agronomic traits is crucial to the development of black rice related industries. Summary of the invention
[0007] The invention aims to provide a method for breeding black rice with high yield and good taste, which can cultivate black rice with good taste and good content of amylose less than 2%, alkali elimination value higher than 5.0, gel consistency greater than 60mm and excellent comprehensive agronomic traits.
[0008] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:
[0009] The present invention provides a method for breeding black rice with high yield and good taste, comprising the following steps:
[0010] (1) using a black rice indica rice line with a taste score higher than 80 points as the female parent and a high-quality indica rice line with high yield and excellent comprehensive agronomic traits as the male parent for hybridization to obtain F1 seeds;
[0011] (2) Planting F1 plants, self-pollinating, and selecting and harvesting F2 generation seeds after maturity;
[0012] (3) Planting F2 plants, self-pollinating, and further selecting molecular markers for wx and ALK b From the individual black rice plants with homozygous genotype, seeds are harvested to obtain F3 generation seeds;
[0013] (4) Planting F3 plants, self-pollinating, and screening to obtain F4 generation seeds;
[0014] (5) Planting F4 plants, and then self-pollinating for 2 to 6 generations to obtain wx and ALK bA black rice indica with homozygous genotype, high yield and excellent taste.
[0015] Furthermore, in step (1), the black rice indica strain is a black rice indica strain having a taste score higher than 80 points and an amylose content lower than 2%.
[0016] Furthermore, in step (2), the screening condition is: the fruit setting rate exceeds 85%.
[0017] Furthermore, in step (3), the screening conditions are: the rice seed coat is black, the fruit setting rate is more than 85%, and the comprehensive agronomic traits are excellent.
[0018] Furthermore, in step (4), the screening conditions are: fruit setting rate exceeding 85%, excellent comprehensive agronomic traits of the plants, amylose content less than 2%, and taste score higher than 80 points.
[0019] Furthermore, in step (5), the screening conditions are: fruit setting rate exceeding 85%, amylose content less than 2%, alkali elimination value higher than 5.0, gel consistency greater than 60 mm, and taste value exceeding 80 points.
[0020] The beneficial effects of the present invention compared with the prior art are:
[0021] (1) The present invention provides a method for breeding black rice with high yield and good taste, which comprises hybridizing black rice with high yield and good comprehensive agronomic traits, self-pollinating for multiple times, and selecting plants with high yield and good taste through molecular marker assistance, and selecting seeds with a fruit setting rate of more than 85%, a black seed coat, an amylose content of less than 2%, an alkali elimination value of more than 5.0, and a gel consistency of more than 60 mm, thereby obtaining black rice with high yield and good taste.
[0022] (2) The indica black rice cultivated by the present invention has an amylose content of less than 2%, which makes the indica black rice have a glutinous rice taste and overcomes the shortcomings of the current black rice, which is hard and rough in taste. In addition, the indica black rice also carries ALK for regulating low gelatinization temperature. b The alkali elimination value is higher than 5.0. Compared with the current black rice, the gelatinization temperature of the black rice of the invention is lower, and the black rice can be cooked at a lower temperature, which significantly shortens the cooking time and improves the public's acceptance of black rice.
[0023] (3) The taste score of the black rice cultivated by the present invention is higher than 80 points, which can meet the needs of consumers for rice varieties with excellent taste quality and nutritional health. At the same time, the cultivated varieties have high yields, which is conducive to the large-scale promotion and industrial development of black rice varieties. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.
[0025] Figure 1 This is a picture of black rice steamed from the color-changed black rice 11 according to Example 1 of the present invention;
[0026] Figure 2 This is an agarose electrophoresis gel image of the wx genotype in the molecular marker detection and tracking analysis in step (5) of Example 1 of the present invention;
[0027] Figure 3 It is the ALK genotype of purple black rice, R911, and color-changed black Xiang 11 in step (5) of Example 1 of the present invention. DETAILED DESCRIPTION
[0028] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0029] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.
[0030] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.
[0031] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to the skilled artisan. The present invention description and examples are exemplary only.
[0032] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0033] The present invention provides a method for breeding black rice with high yield and good taste, which comprises the following steps:
[0034] (1) A black rice with an amylose content of less than 2% and a taste score of more than 80 points is used as a parent and is hybridized with a high-quality indica rice with high yield and excellent comprehensive agronomic traits to obtain F1 generation seeds.
[0035] (2) The F1 generation is self-pollinated and the F2 generation seeds with a fruit set rate exceeding 85% are harvested.
[0036] (3) In the F2 generation population, individual plants with black seed coat, a fruiting rate of more than 85%, and excellent comprehensive traits were selected, and seeds were harvested from the individual plants. The Wx and ALK genotypes of these individual seeds were analyzed using molecular marker methods, and the wx and ALK genotypes were selected. b The seeds of the homozygous black rice plants were harvested to obtain F3 generation seeds.
[0037] (4) In the F3 generation population, single plants with excellent comprehensive agronomic traits and a fruit set rate of more than 85% were selected, and seeds were harvested by single plant. At the same time, seeds were mixed and harvested according to strains. The harvested seeds were subjected to indoor physiological and biochemical analysis. Strains with a fruit set rate of more than 85%, excellent comprehensive agronomic traits, amylose content of less than 2%, and a taste score of more than 80 points were selected, and seeds were harvested by single plant to obtain F4 generation seeds.
[0038] (5) Among the F4 generation lines, individual plants with a fruit set rate higher than 85% were selected, and seeds of the mixed lines were harvested for physical and chemical quality testing of rice. Lines with a fruit set rate higher than 85%, an alkali consumption value higher than 5.0, a gel consistency greater than 60 mm, and a taste score higher than 80 points were selected, and seeds were harvested individually to obtain F5 generation seeds.
[0039] (6) Repeat (5) on the F5-F7 self-pollinated progeny and carry out systematic breeding to obtain wx and ALK b A black rice with homozygous genotype, amylose content below 2%, alkali elimination value above 5.0, gel consistency greater than 60mm, excellent comprehensive agronomic traits, high yield and good taste.
[0040] Example 1
[0041] Embodiment 1 of the present invention provides a method for breeding black rice with high yield and good taste, and the specific steps are as follows:
[0042] (1) The cooking and eating quality of black rice was identified by manual tasting. Black rice indica varieties with AAC content less than 2%, gel consistency (GC) higher than 60 mm, alkali elimination value (ASV) higher than 5, and manual tasting taste score greater than 80 points were selected from the existing black rice indica resources. The wx and ALK-carrying indica varieties independently bred by the Hunan Hybrid Rice Research Center were selected. b The genotype of black rice variety purple pulp black rice has an amylose content of 0.4%, a taste score of 86.5 points, an alkali elimination value of 6.5, a gel consistency of 90mm, and good cooking and taste quality. Researchers of this purple pulp black rice can contact Bai Bin, a breeder at the Hunan Hybrid Rice Research Center, to purchase it, but the fruit setting rate of this purple pulp black rice is only 25%, and the yield is low (Table 1).
[0043] Sensory evaluation was conducted in accordance with the national standard GB / T 15682-2008. Taste evaluation includes aroma, appearance, palatability (viscosity, hardness and elasticity), mouthfeel and cold rice texture. Taste value: ≤50 points for very poor; 51-60 for poor; 61-70 for fair; 71-80 for good; 81-90 for good; 90 for very good.
[0044] (2) Purple black rice was used as the female parent, and R911, a variety bred by Kenfeng Changjiang Seed Technology Co., Ltd., which has high yield and excellent comprehensive agronomic traits, was used as the male parent. R911 carries Wx b , ALK c Gene (see Figure 2 , Figure 3 ), room temperature setting rate 82%, amylose content 13%, alkali elimination value 2.5, gel consistency 75mm.
[0045] (3) In the spring of 2019, at the Changsha Experimental Base, purple black rice was hybridized with R911 to obtain 26 F1 seeds.
[0046] (4) In the autumn of 2019, F1 plants were planted at the Sanya Experimental Base in Hainan Province and allowed to self-pollinate. After maturity, F1 plants with a fruit set rate of more than 85% were selected, and 3,000 F2 seeds were harvested;
[0047] (5) In the spring of 2020, the F2 population was planted in Changsha, and individual plants with black seed coat, more than 85% fruit set rate, and excellent comprehensive traits were selected. The individual plants were harvested by division, and a total of 289 plants were selected. Molecular marker detection and tracking analysis screened out the wx and ALK b There were 68 homozygous genotype plants, and the F3 generation seeds were obtained by harvesting the individual plants.
[0048] The sequences used for molecular marker detection and tracking analysis are:
[0049] SEQ ID NO.1-wx-F: GACCGTCGTCGTTCAACT;
[0050] SEQ ID NO.2-wx-R: TGCACCACAAAAACTTGGGT;
[0051] SEQ ID NO.3-ALK-F: GCATCTCCTGCTGTTTGTTA;
[0052] SEQ ID NO. 4-ALK-R: CATTTTGACGGCACAACTTC.
[0053] The results of molecular marker detection are as follows Figure 2 , Figure 3 shown.
[0054] (6) In the autumn of 2020, the selected seeds of the F3 generation were planted individually in the experimental field in Sanya, Hainan, to obtain the F3 generation strains. In the F3 generation population, individual plants with excellent comprehensive agronomic traits and a fruit set rate of more than 85% were selected, and seeds were harvested by individual plants. At the same time, seeds were mixed and harvested according to strains, and the harvested seeds were subjected to indoor physiological and biochemical analysis. 35 strains with an amylose content of less than 2% and a taste score of more than 80 points were selected, and the seeds were harvested by individual plants to obtain F4 generation seeds.
[0055] (7) In the spring of 2021, select the excellent individual plants with excellent comprehensive agronomic traits and a fruit set rate of more than 85% from the F4 generation strains. At the same time, collect the seeds of each strain according to the strain, and measure the rice quality. Select the strains with alkali elimination value higher than 5.0, gel consistency greater than 60 mm, and taste value higher than 80 points, and collect the seeds by individual plant division to obtain F5 generation seeds.
[0056] (8) Repeat step (7) in the F5-F7 self-pollinated progeny, carry out systematic breeding, detect Wx and ALK genotypes, and obtain wx and ALK b A black rice indica variety with good taste, homozygous genotype, amylose content less than 2%, alkali elimination value higher than 5.0, gel consistency greater than 60 mm, and excellent comprehensive agronomic traits is named Sebian Heixiang 11.
[0057] The main characteristics of the color change black Xiang 11 are: wx and ALK b Genotype homozygous (see Figure 2 , Figure 3 ), amylose content less than 2%, soft gelatin (> 60mm), high alkali elimination value (> 5), high fruit setting rate (> 85%), good taste (> 80 points) (Table 1), high yield and excellent cooking and taste quality black rice indica variety Sebian Heixiang 11 ( Figure 1 ).
[0058] The black rice with high yield and good taste cultivated by the invention can meet the needs of consumers for rice varieties with excellent taste quality and healthy nutrition. Meanwhile, the cultivated varieties have high yield, which is conducive to the large-scale promotion and industrial development of black rice varieties.
[0059] Table 1 Physical and chemical indicators of three rice varieties
[0060]
[0061] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.
Claims
1. A method for breeding black rice with high yield and good taste, characterized in that: The steps include: (1) using a black rice indica rice line with a taste score higher than 80 points as the female parent and a high-quality indica rice line with high yield and excellent comprehensive agronomic traits as the male parent for hybridization to obtain F1 seeds; (2) Planting F1 plants, self-pollinating, and selecting and harvesting F2 generation seeds after maturity; (3) Planting F2 plants, self-pollinating, and further selecting molecular markers for wx and ALK b From the individual black rice plants with homozygous genotype, seeds are harvested to obtain F3 generation seeds; (4) Planting F3 plants, self-pollinating, and screening to obtain F4 generation seeds; (5) Planting F4 plants, and then self-pollinating for 2 to 6 generations to obtain wx and ALK b A black rice indica with homozygous genotype, high yield and excellent taste.
2. The method for breeding black rice with high yield and good taste according to claim 1, characterized in that: In step (1), the black rice indica strain has a taste score higher than 80 points and an amylose content lower than 2%.
3. The method for breeding black rice with high yield and good taste according to claim 1, characterized in that: In step (2), the screening condition is: the fruit setting rate exceeds 85%.
4. The method for breeding black rice with high yield and good taste according to claim 1, characterized in that: In step (3), the screening conditions are: the rice seed coat is black, the fruit setting rate is more than 85%, and the comprehensive agronomic traits are excellent.
5. The method for breeding black rice with high yield and good taste according to claim 1, characterized in that: In step (4), the screening conditions are: fruit setting rate exceeding 85%, excellent comprehensive agronomic traits of the plants, amylose content less than 2%, and taste score higher than 80 points.
6. The method for breeding black rice with high yield and good taste according to claim 1, characterized in that: In step (5), the screening conditions are: fruit setting rate exceeding 85%, amylose content less than 2%, alkali elimination value higher than 5.0, gel consistency greater than 60 mm, and taste value exceeding 80 points.