Construction method and application of IgZ gene knockout zebrafish mucosal immune antibody deletion model

Abstract

The invention discloses a construction method and application of an IgZ gene knockout zebrafish mucosal immune antibody deletion model, and belongs to the technical field of gene engineering. The model construction method comprises the following steps: S1, by taking a nucleotide sequence as shown in SEQ ID NO: 1 as a target spot, carrying out IgZ gene knockout on a zebrafish embryo by utilizing a gene editing system to obtain an IgZ gene knockout F0-generation mutant zebrafish; and S2, carrying out selfing on the F0-generation mutant zebrafish and the mutant zebrafish with the same target type, and sequencing to obtain F1-generation homozygote mutant zebrafish with IgZ gene mutation, namely the IgZ gene knockout zebrafish mucosal immune antibody deletion model. The zebra fish mucosal immune globulin synthesis disorder model is constructed for the first time, and the model has good application value in rapid screening and evaluation of drugs and natural efficacy factors capable of relieving mucosal inflammation.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a method for constructing an IgZ gene knockout zebrafish mucosal immune antibody deficiency model and an application thereof. Background Art

[0002] Immunoglobulin Z (IgZ) was discovered in zebrafish in 2005. This gene is similar to the IgT gene of rainbow trout. Its discovery changed people's understanding of the arrangement of traditional teleost immunoglobulin heavy chain loci. Earlier studies believed that teleost immunoglobulin heavy chain loci were arranged in a "translocon" manner: VH-Dμ / δ-Jμ / δ-Cμ-Cδ, while the DJC region encoding the τ chain found in zebrafish formed a specific coding cluster before the DJC region encoding IgM, and its coding method was similar to the gene locus arrangement of mammalian αβTCR. Zebrafish IgZ has two subtypes. After bacterial infection, the concentration of IgZ1 antibodies in zebrafish serum, skin mucus, and gill mucus increased significantly, and IgZ1 and B cells increased to a certain extent in the spleen, head kidney, peripheral blood, gills, skin, and intestines. These studies all indicate that zebrafish IgZ1 can play a corresponding role in both systemic immunity and mucosal immunity.

[0003] Zebrafish is one of the common model animals because of its small size, short reproductive cycle and clear genetic background. With the deepening of mucosal immunity research, mucosal immunoglobulins have become one of the current research hotspots. Current research suggests that the function of IgZ in zebrafish is similar to that of IgA in mammals. In addition to being widely distributed in mucosal immune tissues, IgZ is also distributed in peripheral serum, playing an important role in both systemic immunity and mucosal immunity.

[0004] At present, there is no report on the construction of IgZ gene knockout zebrafish animal model using CRISPR / Cas9 gene knockout technology. Summary of the invention

[0005] The purpose of the present invention is to provide a method for constructing a zebrafish mucosal immune antibody deficiency model with IgZ gene knockout and its application. The present invention knocks out the IgZ gene of zebrafish for the first time, constructs a zebrafish mucosal immunoglobulin synthesis disorder model, and has good application value in rapid screening and evaluation of drugs and natural efficacy factors that can relieve mucosal inflammation.

[0006] In a first aspect, the present invention provides a method for constructing an IgZ gene knockout zebrafish mucosal immune antibody deficiency model, comprising the following steps: S1, using the nucleotide sequence shown in SEQ ID NO: 1 as a target, and using a gene editing system to knock out the IgZ gene in zebrafish embryos to obtain F0 generation mutant zebrafish with IgZ gene knockout; S2, selfing the F0 generation mutant zebrafish with a mutant zebrafish with the same target type, and sequencing to obtain an F1 generation homozygous mutant zebrafish with IgZ gene mutation, which is the IgZ gene knockout zebrafish mucosal immune antibody deficiency model.

[0007] In the present invention, the inventors used the gene editing system for the first time to knock out the IgZ gene of zebrafish, thereby obtaining a zebrafish mucosal immunoglobulin synthesis disorder model. This model is helpful to explore the biological function of the IgZ gene and study the effects of immunoglobulin Z synthesis disorder on the immune response of zebrafish, and has good application value in the rapid screening and evaluation of drugs and natural efficacy factors that can relieve mucosal inflammation.

[0008] In some embodiments, in step S1, the gene editing system is a CRISPR / Cas9 system.

[0009] It should be noted that the gene editing system can be routinely selected according to actual use needs, for example, zinc finger nuclease (ZFN) editing technology, transcription activator-like effector nuclease (TALEN) technology and CRISPR / Cas9 editing technology can be selected; the preferred gene editing system in the present invention is the CRISPR / Cas9 system.

[0010] In some embodiments, the method for preparing gRNA used in the CRISPR / Cas9 system includes: synthesizing primers for amplifying gRNA transcription templates; using the primers and performing a PCR reaction with a pMD19T-gRNA plasmid as a template, purifying the obtained PCR product, and then performing in vitro transcription using T7 transcriptase to obtain gRNA.

[0011] In the present invention, the preparation method of gRNA is simple and efficient, and the purity of the prepared gRNA is high.

[0012] In some embodiments, the primers include a forward primer and a reverse primer, the nucleotide sequence of the forward primer is shown in SEQ ID NO: 2, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 3.

[0013] In some embodiments, the method further comprises injecting gRNA and cas9 protein into zebrafish embryos.

[0014] In some embodiments, the injection concentration of gRNA is 80-100 ng / μl and the injection volume is 2-6 μl.

[0015] In some embodiments, the injection concentration of Cas9 protein is 250-300 ng / μl, and the injection volume is 2-6 μl.

[0016] In some embodiments, the zebrafish is a wild-type zebrafish.

[0017] In a second aspect, the present invention provides an application of an IgZ gene knockout zebrafish mucosal immune antibody deficiency model constructed according to any of the above construction methods in studying the biological function of the IgZ gene.

[0018] In a third aspect, the present invention provides an application of an IgZ gene knockout zebrafish mucosal immune antibody deficiency model constructed according to any of the above construction methods in screening and / or evaluating drugs or natural efficacy factors that can relieve mucosal inflammation.

[0019] The beneficial effects of the present invention are as follows: Different from the prior art, the present invention uses the CRISPR / Cas9 system for the first time to knock out the IgZ gene of zebrafish, thereby obtaining a zebrafish mucosal immunoglobulin synthesis disorder model, which is helpful to explore the biological function of the IgZ gene and study the effect of immunoglobulin Z synthesis disorder on the immune response of zebrafish, and has good application value in the rapid screening and evaluation of drugs and natural efficacy factors that can relieve mucosal inflammation. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The homozygous zebrafish with IgZ gene knockout in Example 1 of the present invention (IgZ - / - ) and wild-type zebrafish (WT) gene sequence alignment results; Figure 2 The homozygous zebrafish with IgZ gene knockout in Example 1 of the present invention (IgZ - / - ) and wild-type zebrafish (WT) adult fish morphology comparison results; Figure 3 This is a diagram showing the results of IgZ gene expression analysis using IgZ gene knockout homozygous zebrafish and wild-type zebrafish as materials in Example 2 of the present invention; Figure 4 This is a diagram showing the results of IgZ protein expression analysis using IgZ gene knockout homozygous zebrafish and wild-type zebrafish as materials in Example 3 of the present invention. DETAILED DESCRIPTION

[0021] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0022] The experimental methods without specific conditions in the examples are usually carried out according to conventional experimental methods in the field of molecular biology, including but not limited to the experimental methods described in Molecular Cloning: A Laboratory Manual by MR Green, Molecular Biology by Robert F. Weaver, etc., or according to the experimental methods recommended by the kit and instrument manufacturers. The reagents and biological materials used in the examples can be obtained from commercial channels unless otherwise specified.

[0023] Example 1 Construction of mucosal immune antibody deficiency model in IgZ gene knockout zebrafish The method for constructing the IgZ gene knockout zebrafish mucosal immune antibody deficiency model in this embodiment comprises the following steps: Step 1: Search the zebrafish IgZ gene sequence (accession number: AAT67444.1) on NCBI (https: / / www.ncbi.nlm.nih.gov / ). According to the CRISPR / Cas9 target design principle, design the target of IgZ gene. Its nucleotide sequence is shown in SEQ ID NO: 1: The nucleotide sequence of the target site of the IgZ gene: GACTTCAGATGGAGTAGTAA (SEQ ID NO: 1).

[0024] Step 2: Use software to design and synthesize primers for amplifying the gRNA transcription template. The primers include a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown in SEQ ID NO: 2, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 3: Nucleotide sequence of the forward primer: TGTAATACGACTCACTATAGACTTCAGATGGA GTAGTAAGTTTTAGAGCTAGAAATAGC (SEQ ID NO: 2); The nucleotide sequence of the reverse primer: AAAAAGCACCGACTCGGTGCCACT (SEQ ID NO: 3); The above-synthesized primers were used and the pMD19T-gRNA plasmid was used as a template for PCR reaction, wherein the PCR reaction system is shown in Table 1 below: Table 1 PCR reaction system

[0025] Prepare 200 μl system, and the PCP amplification program is as follows: 94°C for 5 min; 94°C for 30 s; 60°C for 30 s; 72°C for 30 s, 30 cycles; 72°C for 10 min; The amplified product was purified using a purification column (Fermentas GeneJETTM PCR Purification Kit), specifically, the steps include: 1) Add 1 volume of isopropanol and binding buffer to the PCR amplification solution and mix well; 2) Add the mixed solution in step 1) to the GeneJETTM purification column, centrifuge at 12000 rpm for 60 seconds, and discard the column liquid; 3) Add 700 μl of wash buffer to the purification column in step 2), centrifuge at 12,000 rpm for 1 min, discard the column liquid, and centrifuge the empty tube at 12,000 rpm for 2 min; 4) Place the purification column in step 3) into a new 1.5ml RNase-free EP tube, add 35μl RNase-free water (using an RNase-free pipette tip), and centrifuge at 12000rpm for 1.5min; the column liquid is the purified gRNA transcription template; 5) Perform a concentration test on the purified gRNA transcription template obtained in step 4), requiring the gRNA transcription template to be greater than 100 ng / μl, and perform electrophoresis detection, with a size of approximately 120 bp.

[0026] S3. Use T7 transcriptase to perform in vitro transcription on the purified gRNA transcription template obtained in step S2 to synthesize gRNA. Specifically, according to the method in the instruction manual of the Novagen T7 high yield RNA transcription kit, a reaction system as shown in Table 2 is prepared: Table 2 Reverse transcription reaction system

[0027] The components were mixed according to the volume of each component in Table 2, and reacted at 37°C for 2 hours to purify the synthesized gRNA. The specific steps are as follows: 1) DNase I treatment: Add 1 μl DNase I and react for 15 min at 37°C to remove the DNA template, and then purify; 2) Place the purification column in a 2 ml collection tube and centrifuge at 2800 rpm for 15 seconds; 3) After loosening the tube cap, twist off the sealing column at the bottom of the tube, discard the tube cap, put the purification column back into the collection tube, and centrifuge at 2800 rpm for 2 minutes; 4) Place the purification column in a new RNase-free EP tube and discard the collection tube; 5) Carefully add the synthesized gRNA to the top of the gel column in the purification column to avoid clogging the tip of the gun, and centrifuge at 2800 rpm for 4 minutes; 6) Keep the column liquid and detect the concentration of the purified gRNA to ensure that the concentration of the purified gRNA is greater than 150ng / μl, and store it in a -80 degree refrigerator for later use.

[0028] Step 3: Inject the gRNA and cas9 protein prepared in step 2 into wild-type (WT) zebrafish embryos. The concentration of gRNA used is 100 ng / μl, the concentration of cas9 protein is 250 ng / μl, and the injection volume is 4 μl. The injected F0 generation embryos are raised to sexual maturity. Anesthetize, cut the tail, extract the F0 generation zebrafish genome, and sequence and verify after PCR amplification to obtain the F0 generation mutant zebrafish with IgZ gene knockout.

[0029] Step 4: Cut the tails of sexually mature F0 generation zebrafish one by one, extract the genome and sequence it. Screen the F1 generation female and male zebrafish with the same type of IgZ gene mutation, self-fertilize them, obtain F1 generation embryos, raise them to sexual maturity, and screen to obtain F1 generation gene knockout homozygous mutants.

[0030] The primers used for sequencing are as follows: The nucleotide sequence of the sequencing forward primer: GTCTATGAACGCAGCACACA (SEQ ID NO: 4); The nucleotide sequence of the sequencing reverse primer was: AGAACCAAACTCAGGGTTGG (SEQ ID NO: 5).

[0031] The F1 mutants obtained above were sequenced and the morphology of the adult fish was observed. The results were as follows: Figure 1 and Figure 2 shown.

[0032] from Figure 1It can be seen from the results that compared with the wild-type zebrafish (WT), the IgZ gene of the F1 generation homozygous knockout mutant has 11 base insertions. The above results show that the present invention successfully obtains the IgZ gene knockout zebrafish mucosal immune antibody deficiency model. Figure 2 As can be seen, there is no obvious difference in the body size of adult zebrafish, proving that the knockout model has no effect on growth.

[0033] Example 2 Analysis of IgZ gene expression in different tissues of the IgZ gene knockout zebrafish mucosal immune antibody deficiency model The RNA of different tissues of IgZ gene knockout zebrafish and wild-type zebrafish are extracted respectively, specifically, comprising the following steps: Add 500μl of trizol and steel balls (30-40mm diameter steel balls soaked in alcohol) to a 2ml RNA-free test tube in advance, add different tissues to be extracted to different centrifuge tubes respectively, and crush until no tissue fragments are observed in the centrifuge tube; add 200μl of chloroform, shake vigorously to form an emulsion, let it stand at 4℃ for 5-10min, and centrifuge at 4℃ 12000g for 15min; aspirate as much supernatant as possible into a new EP tube, add an equal volume of isopropanol, let it stand at 4℃ for 5-10min, and centrifuge at 4℃ 12000g for 10min; discard the supernatant, add 1ml 75% ethanol / DEPC water, and mix gently; centrifuge at 4℃ 12000g for 5-10min; repeat the previous step and remove the supernatant, retain the precipitate, and air-dry to remove the ethanol; dissolve the precipitate in an appropriate amount of DEPC water, generally 20μl, to obtain RNA from different tissues.

[0034] The RNA of different tissues was reverse transcribed into cDNA using the SteadyPure RNA extraction kit from Acori Biotechnology. Then, the cDNA was subjected to qPCR detection according to the method in the instruction manual of Hieff qPCR SYBR Green Master Mix (No Rox). The internal reference gene β-actin was used as a control to calculate the relative expression of the target gene. The results are shown in Figure 2. Figure 2 shown.

[0035] Among them, the detection primer sequences of β-actin gene and IgZ gene are as follows: β-actin-F: AGGTCATCACCATCGGCAAT (SEQ ID NO: 6); β-actin-R:GATGTCCACGTCGCACTTCA (SEQ ID NO: 7); IgZ-F: GTCTATGAACGCAGCACACA (SEQ ID NO: 8); IgZ-R: AGAACCAAACAGGGTTGG (SEQ ID NO: 9).

[0036] from Figure 3 It can be seen that the IgZ gene content is high in different tissues of wild-type zebrafish; the IgZ gene content is extremely low in different tissues of IgZ gene knockout zebrafish. The results show that the present invention successfully constructs an IgZ gene knockout zebrafish mucosal immune antibody deficiency model.

[0037] Example 3 Analysis of IgZ protein expression in different tissues of the IgZ gene knockout zebrafish mucosal immune antibody deficiency model Blood was collected from IgZ knockout zebrafish and wild-type zebrafish after anesthesia. Before blood collection, the gun tip or syringe was rinsed with sodium heparin. The blood was placed in a centrifuge tube and centrifuged at 5000g (rcf) for 6 minutes in a 4°C centrifuge. The serum was drawn into another clean centrifuge tube and stored at -80°C. Diluted with PBS at 1:10, and an equal volume of 2× non-reducing loading buffer was added. The prepared sample was placed in a 98°C metal bath for 8-10 minutes. The pre-made ACE gel was placed on a rack and checked for leaks, and then SDS electrophoresis buffer was added to the gel electrophoresis container, with the new gel inside and the old gel electrophoresis buffer outside. The prepared sample and marker (10μL) were added to the gel well, black and red wires were connected, and electrophoresis was performed at a constant voltage of 160V for 55 minutes. Cut out the required protein gel according to the target band, put the protein gel into the trans buffer, cut the PVDF membrane (6×9cm), and soak the PVDF membrane in 100% methanol for 30s, then put it into the trans buffer, and the filter paper is fully soaked with the trans buffer. The transfer membrane is placed in the transfer instrument in the order of "filter paper-PVDF membrane-gel-filter paper", and the transfer membrane adopts a constant voltage current of 9V, and the transfer membrane is transferred for 1h. After the transfer, wash the membrane quickly with PBS (fast shaking speed is 80, slow shaking speed is 10, the same below) for 5min. In the closed box, soak the membrane with 8% milk (milk needs to be filtered with a fine mesh), and then block it slowly on the shaker for 1h. After blocking, pour off the milk and wash the membrane quickly with PBS for 5min. The membrane in the closed box is slowly incubated with the primary antibody (IgZ polyclonal antibody, purchased from Wuhan Maisi Biotechnology Co., Ltd.) for 1h, and then quickly washed with PBST 4 times, each time for 5min. The membrane in the closed box was slowly incubated with the secondary antibody (HRP-conjugated Goat anti-Rabbit IgG (H+L)) for 40 minutes, then the membrane was quickly washed 3 times with PBST, 5 minutes each time, and then the membrane was quickly washed once with PBS, 5 minutes. The membrane was soaked in ECL luminescent solution (A and B, 1:1 mixture), gently rinsed several times, and then exposed with a gel illuminator to observe the bands. The results are as follows: Figure 3 shown.

[0038] from Figure 4 It can be seen that in the target band position segment (150-250KDa), obvious protein bands appeared in the wild-type zebrafish serum, while no clear protein bands appeared in the IgZ gene knockout zebrafish serum. The results showed that the present invention successfully obtained the IgZ gene knockout zebrafish mucosal immune antibody deficiency model.

[0039] It should be noted that the above embodiments all belong to the same inventive concept, and the description of each embodiment has its own focus. For matters that are not described in detail in some embodiments, reference may be made to the description in other embodiments.

[0040] The above-mentioned embodiments only express the implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A method for constructing a mucosal immune antibody deficiency model of IgZ gene knockout zebrafish, characterized in that: The steps include: S1. Using the nucleotide sequence shown in SEQ ID NO: 1 as a target, knocking out the IgZ gene in zebrafish embryos using a gene editing system to obtain F0 generation mutant zebrafish with IgZ gene knockout; S2. Self-fertilizing the F0 generation mutant zebrafish with mutant zebrafish of the same target type, and obtaining F1 generation homozygous mutant zebrafish with IgZ gene mutation through sequencing, which is the IgZ gene knockout zebrafish mucosal immune antibody deficiency model.

2. The method for constructing an IgZ gene knockout zebrafish mucosal immune antibody deficiency model according to claim 1, characterized in that: In step S1, the gene editing system is a CRISPR / Cas9 system.

3. The method for constructing an IgZ gene knockout zebrafish mucosal immune antibody deficiency model according to claim 1, characterized in that: The preparation method of the gRNA used in the CRISPR / Cas9 system includes: synthesizing primers for amplifying the gRNA transcription template; using the primers and the pMD19T-gRNA plasmid as a template to perform a PCR reaction, purifying the obtained PCR product, and then using T7 transcriptase to perform in vitro transcription to obtain the gRNA.

4. The method for constructing an IgZ gene knockout zebrafish mucosal immune antibody deficiency model according to claim 3, characterized in that: The primers include a forward primer and a reverse primer, the nucleotide sequence of the forward primer is shown in SEQ ID NO: 2, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO:

3.

5. The method for constructing an IgZ gene knockout zebrafish mucosal immune antibody deficiency model according to claim 3, characterized in that: The method also includes injecting the gRNA and cas9 protein into zebrafish embryos.

6. The method for constructing an IgZ gene knockout zebrafish mucosal immune antibody deficiency model according to claim 5, characterized in that: The injection concentration of the gRNA is 80-100 ng / μl, and the injection volume is 2-6 μl.

7. The method for constructing an IgZ gene knockout zebrafish mucosal immune antibody deficiency model according to claim 5, characterized in that: The injection concentration of the Cas9 protein is 250-300 ng / μl, and the injection volume is 2-6 μl.

8. The method for constructing an IgZ gene knockout zebrafish mucosal immune antibody deficiency model according to claim 1, characterized in that: In step S1, the zebrafish is a wild-type zebrafish.

9. Application of an IgZ gene knockout zebrafish mucosal immune antibody deficiency model constructed according to any one of the construction methods of claims 1 to 8 in studying the biological function of the IgZ gene.

10. Use of an IgZ gene knockout zebrafish mucosal immune antibody deficiency model constructed according to any one of the construction methods of claims 1 to 8 in screening and / or evaluating drugs or natural efficacy factors that can alleviate mucosal inflammation.

Images