Construction method and application of igz gene knockout zebrafish mucosal immune antibody deletion model

By knocking out the IgZ gene in zebrafish using the CRISPR/Cas9 system, an IgZ gene knockout zebrafish model was constructed, solving the problem of the lack of IgZ gene research in existing technologies and enabling rapid screening and evaluation of drugs to alleviate mucosal inflammation.

CN119699270BActive Publication Date: 2025-12-05HUAZHONG AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411403528.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-09
Publication Date
2025-12-05
Estimated Expiration
2044-10-09

AI Technical Summary

Technical Problem

Currently, there is no zebrafish model with IgZ gene knockout constructed using CRISPR/Cas9 gene knockout technology. This makes it impossible to effectively study the function of the IgZ gene in zebrafish mucosal immunity and its impact on immune response. Furthermore, there is a lack of drugs and natural active ingredients for rapidly screening to alleviate mucosal inflammation.

Method used

The IgZ gene in zebrafish was knocked out using the CRISPR/Cas9 system to construct a zebrafish mucosal immune antibody deficiency model. By designing specific nucleotide sequences as targets, gRNA and Cas9 protein were injected into zebrafish embryos to obtain IgZ gene mutants, and F1 generation homozygous models were screened.

Benefits of technology

A zebrafish model with IgZ gene knockout was successfully constructed, revealing the biological function of the IgZ gene, studying its impact on immune response, and providing a platform for rapid screening and evaluation of drugs and natural active ingredients that alleviate mucosal inflammation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119699270B_ABST
    Figure CN119699270B_ABST
Patent Text Reader

Abstract

The application discloses a kind of IgZ gene knockout zebrafish mucosal immunity antibody deletion model construction method and application, belong to genetic engineering technical field.The model construction method includes the following steps: S1, with the nucleotide sequence as shown in SEQ ID NO:1 as target point, using gene editing system to carry out IgZ gene knockout to zebrafish embryo, obtain IgZ gene knockout F0 generation mutant zebrafish;S2, F0 generation mutant zebrafish is self-crossed with the mutant zebrafish of target type same, sequencing obtains IgZ gene mutation F1 generation homozygote mutant zebrafish, it is IgZ gene knockout zebrafish mucosal immunity antibody deletion model.The zebrafish mucosal immunoglobulin synthesis disorder model is first constructed in the present application, and the model has good application value in the rapid screening and evaluation of drugs and natural efficacy factors with mucosal inflammation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a method for constructing and applying an IgZ gene knockout zebrafish mucosal immune antibody deficiency model. Background Technology

[0002] Immunoglobulin Z (IgZ) was discovered in zebrafish in 2005. This gene is similar to the IgT gene in rainbow trout, and its discovery changed our understanding of the traditional arrangement of immunoglobulin heavy chain gene loci in bony fish. Earlier studies suggested that immunoglobulin heavy chain loci in bony fish were arranged in a translocation manner: VH-Dμ / δ-Jμ / δ-Cμ-Cδ. However, the DJC region encoding the τ chain found in zebrafish forms a specific coding cluster before the DJC region encoding IgM, and its coding pattern is similar to the locus arrangement of αβTCR in mammals. Zebrafish IgZ has two subtypes. After bacterial infection, the concentration of IgZ1 antibodies in zebrafish serum, skin mucus, and gill mucus increases significantly. IgZ1 and B cells are also increased to some extent in the spleen, head kidney, peripheral blood, gills, skin, and intestines. These studies all indicate that zebrafish IgZ1 can play a corresponding role in both systemic immunity and mucosal immunity.

[0003] Zebrafish, with their small size, short reproductive cycle, and clear genetic background, are a common model organism. With the deepening of research on mucosal immunity, mucosal immunoglobulins have become a current research hotspot. Current research suggests that IgZ in zebrafish functions similarly to IgA in mammals, and that IgZ, in addition to being widely distributed in mucosal immune tissues, is also found in peripheral serum, playing an important role in both systemic and mucosal immunity.

[0004] Currently, there are no reports of using CRISPR / Cas9 gene knockout technology to construct zebrafish animal models with IgZ gene knockout. Summary of the Invention

[0005] The purpose of this invention is to provide a method for constructing and applying a zebrafish mucosal immune antibody deficiency model by knocking out the IgZ gene. This invention is the first to knock out the IgZ gene in zebrafish, constructing a model of impaired mucosal immunoglobulin synthesis, which has good application value in the rapid screening and evaluation of drugs and natural active ingredients that can alleviate mucosal inflammation.

[0006] In a first aspect, the present invention provides a method for constructing an IgZ gene knockout zebrafish mucosal immune antibody deficiency model, comprising the following steps: S1, using the nucleotide sequence shown in SEQ ID NO: 1 as the target, the IgZ gene is knocked out in zebrafish embryos using a gene editing system to obtain an IgZ gene knockout F0 generation mutant zebrafish; S2, the F0 generation mutant zebrafish are self-crossed with mutant zebrafish of the same target type, and sequencing is performed to obtain an IgZ gene-mutated F1 generation homozygous mutant zebrafish, which is the IgZ gene knockout zebrafish mucosal immune antibody deficiency model.

[0007] In this invention, the inventors used a gene editing system for the first time to knock out the IgZ gene in zebrafish, thereby obtaining a model of impaired synthesis of immunoglobulin Z in zebrafish mucosa. This model helps to explore the biological function of the IgZ gene and study the impact of impaired immunoglobulin Z synthesis on the immune response of zebrafish. It also has good application value in the rapid screening and evaluation of drugs and natural efficacy factors that can alleviate mucosal inflammation.

[0008] In some implementations, in step S1, the gene editing system is a CRISPR / Cas9 system.

[0009] It should be noted that the gene editing system can be conventionally selected according to actual needs. For example, zinc finger nuclease (ZFN) editing technology, transcription activator-like effector nuclease (TALEN) technology, and CRISPR / Cas9 editing technology can be selected. The preferred gene editing system in this invention is the CRISPR / Cas9 system.

[0010] In some implementations, the preparation method of gRNA used in the CRISPR / Cas9 system includes: synthesizing primers for amplifying the gRNA transcription template; using the primers and a pMD19T-gRNA plasmid as a template for PCR reaction; purifying the obtained PCR product and then performing in vitro transcription using T7 transcriptase to obtain gRNA.

[0011] In this invention, the method for preparing gRNA is simple and efficient, and the gRNA obtained is of high purity.

[0012] In some embodiments, the primers include a forward primer and a reverse primer, the nucleotide sequence of which is shown in SEQ ID NO: 2 and the nucleotide sequence of which is shown in SEQ ID NO: 3.

[0013] In some implementations, the procedure also includes injecting gRNA and Cas9 protein into zebrafish embryos.

[0014] In some implementations, the injection concentration of gRNA is 80-100 ng / μl, and the injection volume is 2-6 μl.

[0015] In some implementations, the injection concentration of Cas9 protein is 250-300 ng / μl, and the injection volume is 2-6 μl.

[0016] In some implementations, the zebrafish is a wild-type zebrafish.

[0017] In a second aspect, the present invention provides an application of the IgZ gene knockout zebrafish mucosal immune antibody deficiency model constructed according to any of the above construction methods in studying the biological function of the IgZ gene.

[0018] In a third aspect, the present invention provides an application of the IgZ gene knockout zebrafish mucosal immune antibody deficiency model constructed according to any of the above construction methods in screening and / or evaluating drugs or natural efficacy factors that alleviate mucosal inflammation.

[0019] The beneficial effects of this invention are as follows: Unlike the prior art, this invention is the first to use the CRISPR / Cas9 system to knock out the IgZ gene in zebrafish, thereby obtaining a model of zebrafish mucosal immunoglobulin synthesis disorder. This model helps to explore the biological function of the IgZ gene and study the impact of immunoglobulin Z synthesis disorder on the immune response of zebrafish. Furthermore, it has good application value in the rapid screening and evaluation of drugs and natural efficacy factors that can alleviate mucosal inflammation. Attached Figure Description

[0020] Figure 1 The zebrafish with IgZ gene knockout homozygous in Example 1 of this invention (IgZ) - / - Image showing the sequence alignment results between wild-type zebrafish (WT) and other gene sequences;

[0021] Figure 2 The zebrafish with IgZ gene knockout homozygous in Example 1 of this invention (IgZ) - / - Comparison of morphology between adult zebrafish (WT) and wild-type zebrafish (WT);

[0022] Figure 3 This is a diagram showing the results of IgZ gene expression analysis using homozygous IgZ gene knockout zebrafish and wild-type zebrafish as materials in Example 2 of the present invention.

[0023] Figure 4 This is a diagram showing the results of IgZ protein expression analysis using homozygous IgZ gene knockout zebrafish and wild-type zebrafish as materials in Example 3 of the present invention. Detailed Implementation

[0024] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0025] Experimental methods not specifically described in the examples are generally performed according to conventional experimental methods in the field of molecular biology, including but not limited to those described in *Molecular Cloning: A Laboratory Manual* by M.R. Green and *Molecular Biology* by Robert F. Weaver, or according to the experimental methods recommended by the reagent kit and instrument manufacturers. Unless otherwise specified, all reagents and biological materials used in the examples are commercially available.

[0026] Example 1: Construction of an IgZ gene knockout zebrafish mucosal immune antibody deficiency model

[0027] The method for constructing the IgZ gene knockout zebrafish mucosal immune antibody deficiency model in this embodiment includes the following steps:

[0028] Step 1: Locate the zebrafish IgZ gene sequence (accession number: AAT67444.1) on NCBI (https: / / www.ncbi.nlm.nih.gov / ). Based on the CRISPR / Cas9 target design principles, design the target site for the IgZ gene. Its nucleotide sequence is shown in SEQ ID NO: 1.

[0029] The nucleotide sequence of the target site of the IgZ gene is: GACTTCAGATGGAGTAGTAA (SEQ ID NO: 1).

[0030] Step 2: Design and synthesize primers for amplifying the gRNA transcription template using software. The primers include a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown in SEQ ID NO: 2, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO: 3.

[0031] The nucleotide sequence of the forward primer is: TGTAATACGACTCACTATAGACTTCAGATGGA

[0032] GTAGTAAGTTTTAGAGCTAGAAATAGC (SEQ ID NO: 2);

[0033] The nucleotide sequence of the reverse primer is: AAAAAAAGCACCGACTCGGTGCCACT (SEQ ID NO: 3);

[0034] Using the synthesized primers described above, and with pMD19T-gRNA plasmid as a template, a PCR reaction was performed. The PCR reaction system is shown in Table 1 below:

[0035] Table 1 PCR reaction system

[0036]

[0037] Prepare a 200 μl system. The PCP amplification program is as follows: 94℃ for 5 min; 94℃ for 30 s; 60℃ for 30 s; 72℃ for 30 s, 30 cycles; 72℃ for 10 min.

[0038] The amplified products obtained above were purified using a purification column (Fermentas GeneJET™ PCR Purification Kit), specifically including the following steps:

[0039] 1) Add 1 volume of isopropanol and binding buffer to the PCR amplification solution and mix well;

[0040] 2) Add the well-mixed solution from step 1) into the GeneJET™ purification column, centrifuge at 12000 rpm for 60 s, and discard the column buffer.

[0041] 3) Add 700 μl of wash buffer to the purification column in step 2), centrifuge at 12000 rpm for 1 min, discard the column buffer, and centrifuge the empty tube at 12000 rpm for 2 min.

[0042] 4) Place the purification column from step 3) into a new 1.5 ml RNase-free EP tube, add 35 μl of RNase-free water (using an RNase-free pipette tip), and centrifuge at 12000 rpm for 1.5 min; retain the column buffer as the purified gRNA transcription template.

[0043] 5) The concentration of the purified gRNA transcription template obtained in step 4) is detected. The gRNA transcription template should be greater than 100 ng / μl. Electrophoresis is performed to detect the size, which is about 120 bp.

[0044] S3. The purified gRNA transcription template obtained in step S2 is transcribed in vitro using T7 transcriptase to synthesize gRNA. Specifically, the reaction system shown in Table 2 is prepared according to the instructions in the Novizan T7 high-yield RNA transcription kit:

[0045] Table 2 Reverse transcription reaction system

[0046]

[0047] The components were mixed according to the volume of each component in Table 2, and the reaction was carried out at 37℃ for 2 hours. The synthesized gRNA was then purified, and the specific steps are as follows:

[0048] 1) DNase I treatment: Add 1 μl of DNase I and react at 37°C for 15 min to remove the DNA template, then purify.

[0049] 2) Place the purification column in a 2ml collection tube and centrifuge at 2800rpm for 15s;

[0050] 3) After loosening the tube cap, break the bottom sealing column, discard the tube cap, put the purification column back into the collection tube, and centrifuge at 2800 rpm for 2 min.

[0051] 4) Place the purification column into a new RNase-free EP tube and discard the collection tube;

[0052] 5) Carefully add the synthesized gRNA to the top of the purification column, avoiding clogging the pipette tip, and centrifuge at 2800 rpm for 4 min.

[0053] 6) Retain the column buffer and check the concentration of purified gRNA to ensure that the concentration of purified gRNA is greater than 150 ng / μl. Store in a -80 degree freezer for later use.

[0054] Step 3: The gRNA and Cas9 protein prepared in Step 2 were injected into wild-type (WT) zebrafish embryos. The concentration of gRNA used was 100 ng / μl, and the concentration of Cas9 protein was 250 ng / μl, with an injection volume of 4 μl for both. The injected F0 generation embryos were then raised until sexual maturity. The embryos were anesthetized, their tails were clipped, and the F0 generation zebrafish genome was extracted. After PCR amplification and sequencing verification, IgZ gene knockout F0 generation mutant zebrafish were obtained.

[0055] Step 4: Cut off the tails of each sexually mature F0 generation zebrafish, extract their genomes, and sequence them. Select F1 generation female and male zebrafish with the same type of IgZ gene mutation, self-fertilize them to obtain F1 generation embryos, raise them to sexual maturity, and screen for F1 generation gene knockout homozygous mutants.

[0056] The primers used for sequencing are shown below:

[0057] The nucleotide sequence of the sequencing forward primer is: GTCTATGAACGCAGCACACA (SEQ ID NO: 4);

[0058] The nucleotide sequence of the reverse primer for sequencing is: AGAACCAAACTCAGGGTTGG (SEQ ID NO: 5).

[0059] Gene sequencing was performed on the F1 generation mutants obtained above, and the morphology of the adult fish was observed. The results are as follows: Figure 1 and Figure 2 As shown.

[0060] from Figure 1 As can be seen, compared with wild-type zebrafish (WT), the F1 generation gene knockout homozygous mutant showed an 11-base insertion in the IgZ gene. These results indicate that the present invention successfully obtained an IgZ gene knockout zebrafish mucosal immune antibody deficiency model. Furthermore, from... Figure 2 As can be seen, there was no significant difference in the body size of adult zebrafish, proving that the knockout model has no effect on growth.

[0061] Example 2: Analysis of IgZ gene expression levels in different tissues of an IgZ gene knockout zebrafish mucosal immune antibody deficiency model.

[0062] RNA was extracted from different tissues of IgZ gene knockout zebrafish and wild-type zebrafish, specifically including the following steps:

[0063] Add 500 μl of Trizol and steel beads (30-40 mm in diameter, soaked in alcohol) to a 2 ml RNA-free tube beforehand. Add different tissues to be extracted into different centrifuge tubes and break them up until no tissue fragments are visible in the centrifuge tubes. Add 200 μl of chloroform, vortex vigorously to form an emulsion, incubate at 4°C for 5-10 min, and centrifuge at 12000g at 4°C for 15 min. Transfer as much of the supernatant as possible to a new EP tube, add an equal volume of isopropanol, incubate at 4°C for 5-10 min, and centrifuge at 12000g at 4°C for 10 min. Discard the supernatant, add 1 ml of 75% ethanol / DEPC water, and mix gently. Centrifuge at 12000g at 4°C for 5-10 min. Repeat the previous step, discard the supernatant, retain the precipitate, and air dry to remove the ethanol. Dissolve the precipitate in an appropriate amount of DEPC water, generally 20 μl, to obtain RNA from different tissues.

[0064] RNA from different tissues was reverse transcribed into cDNA using the SteadyPure RNA Extraction Kit from Aikerui Biotechnology. The cDNA was then analyzed by qPCR according to the instructions for Hieff qPCR SYBR Green Master Mix (No Rox), with the internal reference gene β-actin used as a control. The relative expression levels of the target gene were calculated. The results are as follows: Figure 2 As shown.

[0065] The primer sequences for detecting the β-actin gene and the IgZ gene are shown below:

[0066] β-actin-F: AGGTCATCACCATCGGCAAT (SEQ ID NO: 6);

[0067] β-actin-R:GATGTCCACGTCGCACTTCA (SEQ ID NO: 7);

[0068] IgZ-F: GTCTATGAACGCAGCACACA (SEQ ID NO: 8);

[0069] IgZ-R: AGAACCAAACAGGGTTGG (SEQ ID NO: 9).

[0070] from Figure 3 As can be seen, the content of IgZ gene is high in different tissues of wild-type zebrafish; while the content of IgZ gene is extremely low in different tissues of IgZ gene knockout zebrafish. The results indicate that the present invention has successfully constructed a model of IgZ gene knockout zebrafish lacking mucosal immune antibodies.

[0071] Example 3: Analysis of IgZ protein expression in different tissues of an IgZ gene knockout zebrafish mucosal immune antibody deficiency model.

[0072] Blood was collected from IgZ gene knockout zebrafish and wild-type zebrafish after anesthesia. Before blood collection, the pipette tip or syringe was rinsed with heparin sodium. The collected blood was placed in a centrifuge tube and centrifuged at 5000g (rcf) for 6 min at 4°C. The serum was then transferred to another clean centrifuge tube and stored at -80°C. The sample was diluted 1:10 with PBS, and an equal volume of 2× non-reducing loading buffer was added. The prepared sample was incubated in a 98°C metal bath for 8-10 min. The pre-prepared ACE gel was placed on a rack and checked for leaks. SDS electrophoresis buffer was then added to the gel electrophoresis container, with the inner side containing the new gel and the outer side containing the old gel electrophoresis buffer. The prepared sample and label (10 μL) were added to the gel wells, the black and red wires were connected, and electrophoresis was performed at a constant voltage of 160V for 55 min. Cut the required protein gel according to the target band, place the protein gel in the trans buffer, cut a PVDF membrane (6×9cm), soak the PVDF membrane in 100% methanol for 30s, and then place it in the trans buffer. Thoroughly wet the filter paper with the trans buffer. Place the membrane in the transfer apparatus in the order of "filter paper-PVDF membrane-gel-filter paper," using a constant voltage of 9V for 1 hour. After transfer, wash the membrane rapidly with PBS (rapid shaking at 80 rpm, slow shaking at 10 rpm, the same applies below) for 5 minutes. In a sealing chamber, wet the membrane with 8% milk (the milk needs to be filtered through a fine sieve), and then slowly block it on a shaker for 1 hour. After blocking, discard the milk and wash the membrane rapidly with PBS for 5 minutes. Incubate the membrane in the sealing chamber with primary antibody (IgZ polyclonal antibody, purchased from Wuhan Maisi Biotechnology Co., Ltd.) slowly for 1 hour, then wash rapidly four times with PBST, 5 minutes each time. The membrane in the sealed chamber was slowly incubated with the secondary antibody (HRP-conjugated Goat anti-Rabbit IgG (H+L)) for 40 min, then washed three times with PBST for 5 min each time, followed by one more wash with PBS for 5 min. The membrane was then immersed in ECL luminescent solution (A and B, 1:1 mixture), gently rinsed several times, and then exposed to a gel illuminator for observation of the bands. The results are as follows. Figure 3 As shown.

[0073] from Figure 4 As can be seen, in the target band segment (150-250 kDa), a clear protein band appeared in the serum of wild-type zebrafish, while no clear protein band appeared in the serum of IgZ gene knockout zebrafish. The results indicate that the present invention successfully obtained an IgZ gene knockout zebrafish mucosal immune antibody deficiency model.

[0074] It should be noted that all the above embodiments belong to the same inventive concept, and the descriptions of each embodiment have different focuses. Where the description in a particular embodiment is not detailed, please refer to the description in other embodiments.

[0075] The embodiments described above are merely illustrative of implementation methods of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. A method for constructing an IgZ gene knockout zebrafish mucosal immune antibody deletion model, characterized in that, Comprising the following steps: S1, using a gene editing system to knockout IgZ gene of zebrafish embryo with the nucleotide sequence as shown in SEQ ID NO: 1 as a target, obtaining F0 generation mutant zebrafish with IgZ gene knockout; S2, self-crossing the F0 generation mutant zebrafish with the same target type of mutant zebrafish, and obtaining F1 generation homozygote mutant zebrafish with IgZ gene mutation through sequencing, that is, IgZ gene knockout zebrafish mucosal immune antibody deletion model; In step S1, the gene editing system is a CRISPR / Cas9 system; The preparation method of the gRNA used by the CRISPR / Cas9 system comprises: synthesizing primers for amplifying a gRNA transcription template; Using the primers and taking pMD19T-gRNA plasmid as a template to perform PCR reaction, the obtained PCR product is purified, and T7 transcriptase is used to perform in vitro transcription, thereby obtaining gRNA; The primers comprise a forward primer and a reverse primer, the nucleotide sequence of the forward primer is shown in SEQ ID NO: 2, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO:

3.

2. The method of claim 1, wherein the IgZ knockout zebrafish mucosal immune antibody deletion model is constructed by the following steps: (1) obtaining the IgZ knockout zebrafish mucosal immune antibody deletion model by the method of claim 1; and (2) obtaining the IgZ knockout zebrafish mucosal immune antibody deletion model by the method of claim 1. Further comprising a step of injecting the gRNA and cas9 protein into the embryo of zebrafish.

3. The method of claim 2, wherein the IgZ knockout zebrafish mucosal immune antibody deletion model is constructed by the following steps: (1) obtaining the IgZ knockout zebrafish mucosal immune antibody deletion model by the method of claim 1; and (2) obtaining the IgZ knockout zebrafish mucosal immune antibody deletion model by the method of claim 1. The injection concentration of the gRNA is 80-100 ng / μl, and the injection volume is 2-6 μl.

4. The method of claim 2, wherein the IgZ knockout zebrafish mucosal immune antibody deletion model is constructed by the following steps: (1) obtaining the IgZ knockout zebrafish mucosal immune antibody deletion model by the method of claim 1; and (2) obtaining the IgZ knockout zebrafish mucosal immune antibody deletion model by the method of claim 1. The injection concentration of the cas9 protein is 250-300 ng / μl, and the injection volume is 2-6 μl.

5. The method of claim 1, wherein the IgZ knockout zebrafish mucosal immune antibody deletion model is constructed by the following steps: (1) obtaining the IgZ knockout zebrafish mucosal immune antibody deletion model by the method of claim 1; and (2) obtaining the IgZ knockout zebrafish mucosal immune antibody deletion model by the method of claim 1. In step S1, the zebrafish is a wild type zebrafish.

6. Application of the IgZ gene knockout zebrafish mucosal immune antibody deletion model constructed according to the construction method of any one of claims 1-5 in the research of biological functions of IgZ gene.

7. Application of the IgZ gene knockout zebrafish mucosal immune antibody deletion model constructed according to the construction method of any one of claims 1-5 in screening and / or evaluating drugs or natural efficacy factors with the function of relieving mucosal inflammation.

Citation Information

Patent Citations

  • Eef1b2-gene-knocked-out epileptic zebrafish model and application thereof

    CN113897360A