New therapeutic application of harpagide

Abstract

The invention discloses a novel application of harpagide in treatment. According to the invention, zebra fish is used as a research object to research the damage influence of harpagide on ionizing radiation induction. Results show that the harpagide can effectively prevent or treat ionizing radiation induced injury and has a wide clinical application prospect.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine and relates to a new therapeutic application of harpagine. Background Art

[0002] Radioactive pollution is a serious hazard. It is not only a public health issue, but also a national security issue. Water is a valuable global resource and one of the important ways for radioactive pollutants to spread. Once radioactive substances enter the water, they will accelerate the spread and expand the scope of pollution. Accidental nuclear leakage and improper handling of radioactive waste may cause water pollution. Therefore, the development of new and effective radiation protection drugs is of great significance to protecting the safety of marine life and even human health.

[0003] Currently, in terms of radiation protection drugs, only amifostine is used clinically to treat indications related to ionizing radiation damage. However, due to its rapid metabolism, serious side effects (can cause vomiting, diarrhea and neurotoxicity, etc.) and inconvenient injection, its application in combating high-dose ionizing radiation damage is largely limited. Here, scientists have also been committed to developing other new radiation protection drugs. The drugs that have obtained the US FDA's new drug clinical trial authorization include 5-androst-5-ene-3β,17β-diol (5-AED) / Neumune, genistein (BIO300), CBLB502 (Entolimod), HemaMax (recombinant human interleukin-12, rHuIL-12) and ON01210 (chlorobenzyl sulfone derivative). The drugs in the preclinical research stage include AEOL10150 (meso-porphyrin mimetic), ALXN4100TPO, Palifermin, phosphoinositide-3kinase (PI3K) inhibitor (LY294002), fibroblast growth factor peptide (FGF-P), histone deacetylase inhibitors-phenylbutyric acid and Geldanamycin analogs.

[0004] 17-dimethylamino-ethy-lamino-17-demethoxygeldanamycin (17-DMAG), etc.; some other chemical, biological and plant herbal medicine components and other radiation protectors are still in the primary basic research stage. The research and development of these radiation protectors is still a long way from actual clinical application. Summary of the invention

[0005] In the current situation where the problem of radioactive contamination of water bodies is prominent and there is an urgent need for radiation protection of aquatic organisms, the present invention intends to screen radiation protection agents with high safety and excellent effects from natural plant ingredients from the treasure house of traditional Chinese medicine and evaluate their protective effects, so as to provide protection and rescue for aquatic organisms from ionizing radiation damage, and open up new strategies for maintaining the safety of aquatic organisms and species diversity.

[0006] According to one aspect of the present invention, the present invention provides a pharmaceutical composition for preventing or treating ionizing radiation damage, wherein the pharmaceutical composition comprises a preventive or therapeutically effective amount of harpagside or a pharmaceutically acceptable salt thereof.

[0007] The term "pharmaceutically acceptable salt" refers to a pharmaceutically acceptable salt of harpagside, which means those carboxylates, amino acid addition salts, etc. of the compound (harpagside) of the present invention, which are suitable for contact with patients within the scope of sound medical judgment, do not produce undue toxicity, irritation, allergic reaction, etc., are commensurate with a reasonable benefit / risk ratio, and are effective for their intended use, including (if possible) zwitterionic forms of the compound (harpagside) of the present invention.

[0008] In some embodiments, examples of the "pharmaceutically acceptable salt of harpagside" include, but are not limited to: salts with alkali metal ions such as Li+, Na+ or K+ (as counter ions), or salts with alkaline earth metal ions such as Mg2+ or Ca2+, or salts with any other pharmaceutically acceptable metal ions such as Zn2+ or Al3+; or pharmaceutically acceptable salts formed with organic bases such as diethanolamine, ethanolamine, N-methylglucamine, triethanolamine or tromethamine.

[0009] In some embodiments, pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali metals and alkaline earth metal hydroxides or organic amines. Examples of metals used as cations are sodium, potassium, magnesium, calcium, etc. Examples of suitable amines are N, N'-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylenediamine, N-methylglucamine and procaine.

[0010] In some embodiments, base addition salts of acidic compounds can be prepared by contacting the free acid form with a sufficient amount of the desired base in a conventional manner to form the salt. The free acid can be regenerated by contacting the salt form with an acid in a conventional manner and then isolating the free acid. The free acid forms differ from their respective salt forms somewhat in certain physical properties, such as solubility in polar solvents, but for purposes of the present invention, the salts are equivalent to their respective free acids.

[0011] In some embodiments, the salt can be a sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate, chloride, bromide, iodide prepared from an inorganic acid, such as hydrochloric acid, nitric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, phosphoric acid, etc. Representative salts include: hydrobromide, hydrochloride, sulfate, bisulfate, nitrate, acetate, oxalate, valerate, oleate, palmitate, stearate, laurate, borate, benzoate, lactate, phosphate, toluenesulfonate, citrate, maleate, fumarate, succinate, tartrate, naphthoate, methanesulfonate, glucoheptonate, lactobionate, lauryl sulfonate, and isethionate, etc. Salts can also be prepared from organic acids, such as aliphatic mono- and dicarboxylic acids, phenyl-substituted alkanoic acids, hydroxyalkanoic acids, alkanedioic acids, aromatic acids, aliphatic and aromatic sulfonic acids, etc. Representative salts include acetate, propionate, octanoate, isobutyrate, oxalate, malonate, succinate, suberate, sebacate, fumarate, maleate, mandelate, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, naphthoate, benzenesulfonate, toluenesulfonate, phenylacetate, citrate, lactate, maleate, tartrate, methanesulfonate, etc. Pharmaceutically acceptable salts may include cations based on alkali metals and alkaline earth metals, such as sodium, lithium, potassium, calcium, magnesium, etc., as well as non-toxic ammonium, quaternary ammonium and amine cations, including but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, etc. Also contemplated are salts of amino acids, such as arginate, gluconate, galacturonate, etc.

[0012] According to a second aspect of the present invention, the present invention provides a pharmaceutical preparation for preventing or treating ionizing radiation damage, wherein the pharmaceutical preparation comprises the pharmaceutical composition described above.

[0013] Preferably, the dosage form of the pharmaceutical preparation includes an oral dosage form, a parenteral dosage form and / or a topical dosage form.

[0014] Preferably, the dosage form of the pharmaceutical preparation includes solutions, sustained-release preparations, suspensions, granules, tablets, capsules, powders, effervescent preparations, emulsions, syrups, drops and / or chewable preparations.

[0015] According to the third aspect of the present invention, the present invention provides use of harpagine or a pharmaceutically acceptable salt thereof in the preparation of a medicament for preventing or treating ionizing radiation damage.

[0016] Preferably, the ionizing radiation damage includes ionizing radiation-induced embryonic development retardation, ionizing radiation-induced enhanced inflammation, ionizing radiation-induced hematopoietic damage, ionizing radiation-induced hematopoietic erythroid cell reduction, and ionizing radiation-induced hematopoietic myeloid cell reduction.

[0017] Preferably, the drug further comprises pharmaceutically acceptable adjuvants and / or excipients.

[0018] Preferably, the dosage form of the drug includes an oral dosage form, a parenteral dosage form and / or a topical dosage form.

[0019] Preferably, the dosage form of the drug includes solutions, sustained-release agents, suspensions, granules, tablets, capsules, powders, effervescent agents, emulsions, syrups, drops and / or chewable tablets.

[0020] Preferably, the safe concentration of harpagside in the drug is 0-0.2 mM.

[0021] Preferably, the protective concentration of harpagside in the drug is 0.1 mM.

[0022] Preferably, the ionizing radiation is gamma-rays.

[0023] Preferably, the ionizing radiation is 2 Gy-6 Gy.

[0024] More preferably, the ionizing radiation is 2 Gy, 4 Gy, 6 Gy.

[0025] In some embodiments, the pharmaceutical composition or pharmaceutical preparation described in the present invention can be prepared into a dosage form suitable for oral administration, parenteral administration or topical administration by a known method, such as by conventional mixing, granulation, coating, solvent or freeze-drying methods, and the dosage form includes but is not limited to: tablets, capsules, granules, injections, powders for injection, transdermal patches, ointments, gels, suppositories, oral solutions, oral suspensions, emulsions for injection, oral emulsions, sustained-release tablets, controlled-release tablets, etc.

[0026] In some embodiments, the pharmaceutical composition or pharmaceutical preparation of the present invention may further comprise a pharmaceutically acceptable adjuvant, including but not limited to: a preservative, a solubilizer, a stabilizer, a wetting agent, an emulsifier, a sweetener, a colorant, a flavoring agent, a salt for regulating osmotic pressure, a buffer, a masking agent or an antioxidant. In addition, by comprising an ingredient that delays absorption, the pharmaceutical dosage form can be prolonged in absorption.

[0027] Those skilled in the art will appreciate that, although the pharmaceutical composition or pharmaceutical preparation mentioned above in the present invention may further contain pharmaceutically acceptable adjuvants and / or excipients, when harpagine or its pharmaceutically acceptable salt, and / or at least one of the other anti-radiation drugs are used as drugs for humans or animals, they may also be administered by themselves, that is, the present invention may be achieved without adding any of the above-mentioned pharmaceutically acceptable adjuvants and / or excipients.

[0028] When using the pharmaceutical composition or pharmaceutical preparation provided by the present invention, its administration regimen and dosage regimen can be selected according to a variety of factors, including the type, species, age, weight, sex and type of tumor / cancer treated by the subject; the severity of the tumor / cancer treated; the route of administration; the patient's renal and liver function; and the specific compound or salt thereof used. A dosing / dosage regimen can be used, for example, to prevent a disease, inhibit (completely or partially inhibit) a disease, or stop the development of the disease.

[0029] In some embodiments, the drugs, pharmaceutical compositions or pharmaceutical preparations provided herein can be administered in a variety of ways, including but not limited to: oral, subcutaneous, intravenous, intraarterial, intracoronary, intranasal, intrathecal, transdermal, mucosal, topical (e.g., gels, ointments, lotions, creams, etc.), intraperitoneal, intramuscular, intrapulmonary (e.g., using inhalable technology or pulmonary delivery systems), vaginal, parenteral, rectal or intraocular. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 The results of the safe concentration screening of harpagine are shown in Figure 1. A: zebrafish embryo survival rate; B: zebrafish embryo deformity rate;

[0031] Figure 2 A graph showing the results of the safe concentration screening of amifostine; A: zebrafish embryo survival rate; B: zebrafish embryo malformation rate;

[0032] Figure 3 The results of the screening of effective protective concentrations of harpagine are shown in Figure 1. A: zebrafish embryo survival rate; B: zebrafish embryo deformity rate;

[0033] Figure 4 The results of the screening of the effective protective concentration of amifostine are shown in the figure; A: zebrafish embryo survival rate; B: zebrafish embryo deformity rate;

[0034] Figure 5 The results of the effect of harpagine on the development of irradiated zebrafish embryos are shown in Figure 1, where A: developmental morphology and progress diagram; B: survival rate; C: ratio of each deformity type;

[0035] Figure 6 Showing the effects of harpagine on ionizing radiation-induced gene expression disorders and inflammation levels in zebrafish embryos; A: sox19a; B: p53; C: Wnt; D: TNF-α; E: IL-1β;

[0036] Figure 7The fluorescence intensity results of zebrafish hematopoietic damage induced by ionizing radiation are shown in the figure; A: fluorescence image of zebrafish tail; B: statistical data of fluorescence intensity of zebrafish tail at 24hpi; C: statistical data of fluorescence intensity of zebrafish tail at 48hpi; D: statistical data of fluorescence intensity of zebrafish tail at 72hpi;

[0037] Figure 8 The results of tail blood flow velocity showing ionizing radiation-induced hematopoietic damage in zebrafish, where A: fluorescent image of zebrafish tail; B: data statistics;

[0038] Fig. 9 The results of the effect of harpagside on the hematopoietic damage of zebrafish induced by ionizing radiation are shown in the figure; A: fluorescence image after harpagside and AMF treatment; B: statistical data of zebrafish fluorescence intensity; C: statistical data of blood flow velocity in the tail of zebrafish;

[0039] Fig.10 The results of O-Dianisidine staining to detect the effect of harpagine on the reduction of zebrafish directional hematopoietic erythroid cells induced by ionizing radiation are shown in the figure; A: hematopoietic erythroid cell staining picture; B: statistical data of the hematopoietic erythroid cell staining area;

[0040] Fig.11 The results of Sudan Black B staining to detect the effect of harpagine on the reduction of zebrafish directional hematopoietic myeloid cells induced by ionizing radiation; A: hematopoietic myeloid cell staining picture; B: statistical data of the total amount of hematopoietic myeloid cells;

[0041] Fig.12 The results of the effect of harpagoside on the expression levels of molecular markers of erythroid, myeloid and hematopoietic stem cells in irradiated zebrafish larvae are shown in Figure 3, where A: βe1; B: lyc; B: c-myb. DETAILED DESCRIPTION

[0042] The present invention will be further described in detail below in conjunction with the accompanying drawings and examples. The following examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the examples where specific conditions are not specified are usually carried out under conventional conditions, such as the conditions described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under the conditions recommended by the manufacturer.

[0043] Example Study on the protective effect of harpagine against ionizing radiation

[0044] Experimental Materials

[0045] (1) Harpagide (HPG): purchased from Shanghai Yuanye Biotechnology Co., Ltd., catalog number B20481.

[0046] (2) Amifostine (AMF): purchased from MedChemExpress, product number HY-B0639.

[0047] (3) O-dianisidine: purchased from Sigma-Aldrich, catalog number 119-90-4.

[0048] (4) Sudan Black B: purchased from Sigma-Aldrich, catalog number 199664.

[0049] (5) Real-time fluorescence quantitative PCR reagent: FastStart Universal SYBR Green Master (Rox), purchased from Roche, Germany, catalog number 4913914001.

[0050] (6) TRIZOL: TRIzol reagent for RNA extraction was purchased from TaKaRa, catalog number 9109.

[0051] (7) RNA reverse transcription reagents: Ⅱ1st Strand cDNASynthesis SuperMix for qPCR (gDNA digester plus) was purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., catalog number 11123ES60.

[0052] (8) ELISA: ELISA detection kits for inflammatory factors TNF-α (F69008-A) and IL-1β (F69010-A) were purchased from Shanghai Kexing Trading Co., Ltd.

[0053] (9) Wild-type AB zebrafish: AB zebrafish at the peak of reproduction age of 4 to 6 months old, purchased from the China Zebrafish Resource Center (CZRC).

[0054] (10) Fluorescently labeled transgenic zebrafish: Myeloid-specific green fluorescent labeled zebrafish, Tg(mpx:EGFP), were purchased from China Zebrafish Resource Center (CZRC).

[0055] (11) 137Csγ-ray irradiation source: purchased from Atomic Energy of Canada Limited, model is USD Autocell40, and the dose rate is 0.84Gy / min.

[0056] (12) Stereo fluorescence microscope: Nikon, model SMZ1270.

[0057] (13) Zebrafish micro-visual behavior analysis system: DanioScope, Noldus Information Technology.

[0058] (14)Image J software: 1.49X, NIH, http: / / rsb.info.nih.gov / ij / .

[0059] Experimental methods

[0060] (1) Screening of safe concentrations of harpagine (HPG) and amifostine (AMF)

[0061] Wild-type AB zebrafish were paired 1:1 and the embryos were collected. The HPG test experiment was grouped according to Ctrl, 0.02, 0.2, 2 and 20mM, and the AMF (this clinical ionizing radiation protection drug was selected as the positive control group) test experiment was grouped according to Ctrl, 0.02, 0.2 and 2mM, with 3 replicates in each group. Each group of embryos was cultured in a 24-well plate, and 20 embryos per well were immersed in 1mL Holt Buffer (5mmol / L NaCl, 0.17mmol / L KCl, 0.33mmol / L CaCl2 and 0.66mmol / L NaHCO3, pH7.2) and cultured in a 28-degree constant temperature incubator. At 3hpf (hours post-fertilization), the corresponding concentration of drugs was added to the 24-well plate for culture. Fresh HoltBuffer was replaced every day, and the corresponding concentration of HPG or AMF drugs were added. The survival rate of each group of embryos was observed and counted under a stereomicroscope at 3, 24, 48 and 72 hpf, and the deformity rate of each group of embryos was counted at 72 hpf. Based on this, the safe concentration range of HPG and AMF for zebrafish embryos was preliminarily screened.

[0062] (2) Screening of effective protective concentrations of HPG and amifostine (AMF)

[0063] Wild-type AB zebrafish were paired 1:1 and their embryos were collected. HPG and AMF screening experiments were divided into groups according to Ctrl, IR (6Gy), IR (6Gy) + 0.05mM HPG / AMF, IR (6Gy) + 0.1mM HPG / AMF and IR (6Gy) + 0.2mM HPG / AMF, with 3 replicates in each group. Embryos in each group were cultured in 24-well plates, with 20 embryos per well immersed in 1mL HoltBuffer and cultured in a constant temperature incubator at 28 degrees. At 3hpf (hours post-fertilization), two drugs of corresponding concentrations were added to the 24-well plates, and the group requiring ionizing radiation was irradiated with 6Gyγ-rays at 4hpf. Fresh Holt Buffer was replaced every day, and HPG or AMF drugs of corresponding concentrations were added. The survival rate of each group of embryos was observed and counted under a stereomicroscope at 3, 24, 48 and 72 hpf. The deformity rate of each group of embryos was counted at 72 hpf. Based on this, the optimal protective concentrations of HPG and AMF against γ-ray irradiated zebrafish embryos were preliminarily screened.

[0064] (3) Effects of HPG on the development of irradiated zebrafish embryos

[0065] Wild-type AB zebrafish were paired in a 1:1 ratio and their embryos were collected. They were grouped into Ctrl, IR (6Gy), IR (6Gy) + 0.1mM HPG and IR (6Gy) + 0.1mM AMF, with 3 replicates in each group. Embryos in each group were cultured in a 24-well plate, with 20 embryos per well immersed in 1mL Holt Buffer and cultured in a constant temperature incubator at 28 degrees. At 3hpf (hours post-fertilization), two drugs of corresponding concentrations were added to the 24-well plate, and the group requiring ionizing radiation was irradiated with 6Gy γ-rays at 4hpf. Fresh Holt Buffer was replaced every day, and HPG or AMF drugs of corresponding concentrations were added. The developmental process and morphology of the embryos in each group were observed under a stereomicroscope at 3, 24, 48 and 72 hpf, and photographed and recorded. The survival rate of the embryos in each group was calculated. The deformity rate of different types of embryos in each group was calculated at 72 hpf (including tail bending, pericardial edema, microphthalmia, yolk cyst and other combined deformities). Based on this, the effects of HPG on the developmental process, survival and developmental morphology of γ-ray irradiated zebrafish embryos were evaluated.

[0066] (4) Effects of HPG on ionizing radiation-induced gene expression disorders and inflammation levels in zebrafish embryonic development

[0067] Wild-type AB zebrafish were paired in a 1:1 ratio and their embryos were collected. They were grouped into Ctrl, IR (6Gy), IR (6Gy) + 0.1mM HPG and IR (6Gy) + 0.1mM AMF, with 3 replicates in each group. Embryos in each group were cultured in a 24-well plate, with 30 embryos per well immersed in 1mL Holt Buffer and cultured in a constant temperature incubator at 28 degrees. At 3hpf (hours post-fertilization), two drugs of corresponding concentrations were added to the 24-well plate, and the group requiring ionizing radiation was irradiated with 6Gyγ-rays at 4hpf. Fresh Holt Buffer was replaced every day, and HPG or AMF drugs of corresponding concentrations were added. Embryonic tissues of each group were collected at 72 hpf, and total RNA was extracted for real-time fluorescence quantitative PCR detection. The data were analyzed using the 2-ΔΔCT method to detect the expression level changes of development-related genes sox19a (forward: TGTCAACAGCCAACAACAGCA; reverse: GTTGTGCATTTTGGGGTTCT), p53 (forward: GGGCAATCAGCGAGCAAA; reverse: ACTGACCTTCCTGAGTCTCCA) and Wnt (forward: CACGGAGTCAGTCCAGAAGG; reverse: TGTGGCACCGTCGAATTTCT) in each group of embryos; or homogenized in PBS ice bath, and the expression levels of two inflammatory factors TNF-α and IL-1β in tissues were detected using ELISA commercial kits. Based on this, the effects of HPG on ionizing radiation-induced gene expression disorders and inflammation levels in zebrafish embryos were evaluated.

[0068] (5) Effects of HPG on ionizing radiation-induced hematopoietic damage in zebrafish

[0069] (a) Response of Tg(mpx:EGFP) fluorescently labeled transgenic zebrafish to γ-ray irradiation dose: The blood system fluorescently labeled transgenic zebrafish Tg(mpx:EGFP) were paired in a 1:1 ratio and the embryos were collected. They were cultured in Holt Buffer in a 28-degree constant temperature incubator, and fresh Holt Buffer was replaced every day. At 2 dpf (days post-fertilization), zebrafish larvae with good development and consistent fluorescence intensity were selected under a stereofluorescence microscope, and 0, 0.5, 1, 2 and 4 Gy γ-ray irradiation groups were set up, with 3 replicates in each group. Each group of larvae was cultured in a 24-well plate, and 20 larvae in each well were immersed in 1 mL Holt Buffer. Each group of larvae was irradiated with a corresponding dose of γ-rays once. Fresh Holt Buffer was replaced every day after irradiation. At 0, 24, 48 and 72 hpi (hours post-irradiation), the whole body fluorescence images of each group of zebrafish were taken under a stereo fluorescence microscope, and the tail blood flow velocity video was recorded at 72 hpf. The whole body fluorescence intensity of each group of zebrafish was counted using Image J software, and the blood flow velocity of each group of zebrafish was analyzed and counted using the zebrafish micro-visual behavior analysis system. The above experiments were used to evaluate the response of Tg (mpx: EGFP) fluorescently labeled transgenic zebrafish to γ-ray irradiation and screen the appropriate irradiation dose. (b) Effect of HPG on fluorescence intensity and blood flow velocity of radiation-damaged Tg (mpx: EGFP) zebrafish: Tg (mpx: EGFP) fluorescently labeled transgenic zebrafish were paired 1:1 between male and female, and the embryos produced were collected in Holt Buffer and cultured in a constant temperature incubator at 28 degrees, with fresh Holt Buffer replaced every day. At 2 dpf, zebrafish larvae with good development and consistent fluorescence intensity were selected under a stereofluorescence microscope. Ctrl, IR (final screening dose, 2 Gy), IR (2 Gy) + 0.1 mM HPG and IR (2 Gy) + 0.1 mM AMF groups were set up, with 3 replicates in each group. The larvae in each group were cultured in a 24-well plate, and each well contained 20 larvae immersed in 1 mL Holt Buffer. The larvae in the group requiring ionizing radiation were irradiated with a single 2 Gy of γ-rays. 1 h before irradiation, the IR (2 Gy) + 0.1 mM HPG and IR (2 Gy) + 0.1 mM AMF groups were treated with 0.1 mM HPG or 0.1 mM AMF, respectively. After irradiation, fresh Holt Buffer was replaced every day, and HPG or AMF of the corresponding concentration was supplemented. At 72 hpi, whole-body fluorescence photography of zebrafish in each group was performed under a stereofluorescence microscope, and videos of tail blood flow velocity were recorded. Image J software was used to count the whole-body fluorescence intensity of each group of zebrafish, and the zebrafish micro-vision behavior analysis system was used to analyze and count the blood flow velocity of each group of zebrafish.The above experiments were used to preliminarily evaluate the effects of HPG on ionizing radiation-induced hematopoietic damage in zebrafish.

[0070] (6) O-Dianisidine staining to detect the effect of HPG on ionizing radiation-induced hematopoietic erythroid cell reduction in zebrafish

[0071] Weigh 100 mg of O-Dianisidine powder and dissolve it in 70 mL of anhydrous ethanol. Store at 4°C away from light. Add 2 mL of ddH2O, 2 mL of O-Dianisidine solution, 500 mL of 0.1 M sodium acetate solution at pH 4.5, and 100 μL of 30% H2O2 to a 15 mL centrifuge tube in order, mix well and set aside. Pair male and female Tg (mpx: EGFP) fluorescently labeled transgenic zebrafish in a 1:1 ratio, collect the embryos produced in Holt Buffer, culture them in a 28-degree constant temperature incubator, and replace fresh Holt Buffer every day. At 2 dpf, zebrafish larvae with good development and consistent fluorescence intensity were selected under a stereofluorescence microscope. Ctrl, IR (2 Gy), IR (2 Gy) + 0.1 mM HPG and IR (2 Gy) + 0.1 mM AMF groups were set up, with 3 replicates in each group. The larvae in each group were cultured in a 24-well plate, and each well contained 20 larvae immersed in 1 mL Holt Buffer. The larvae in the ionizing radiation group were irradiated with 2 Gy of γ-rays once. 1 h before irradiation, the IR (2 Gy) + 0.1 mM HPG and IR (2 Gy) + 0.1 mM AMF groups were treated with 0.1 mM HPG or 0.1 mM AMF, respectively. After irradiation, fresh Holt Buffer was replaced every day, and HPG or AMF of the corresponding concentration was supplemented. At 3.5 dpf, the larvae in each group were collected, placed in a 1.5 mL EP tube, 500 μL of staining working solution was added, and the staining was carried out for 30 to 60 min on a shaker at room temperature in the dark. During this period, several fry can be taken out and placed under a microscope to observe the staining effect. After staining, remove the dye solution and wash with PBST three times, 10 minutes each time. Add 1mL 4% paraformaldehyde and fix for more than 2 hours. Wash with PBST three times, 10 minutes each time, and store in 100% glycerol. Collect images under a stereo microscope.

[0072] (7) Sudan Black B staining to detect the effect of amifostine on the reduction of committed hematopoietic myeloid cells induced by ionizing radiation in zebrafish

[0073] Tg(mpx:EGFP) fluorescently labeled transgenic zebrafish were paired in a 1:1 ratio, and the embryos were collected in Holt Buffer and cultured in a 28-degree constant temperature incubator, with fresh Holt Buffer replaced every day. At 2dpf, zebrafish larvae with good development and consistent fluorescence intensity were selected under a stereofluorescence microscope, and Ctrl, IR(2Gy), IR(2Gy)+0.1mM HPG and IR(2Gy)+0.1mM AMF groups were set up, with 3 replicates in each group. Each group of larvae was cultured in a 24-well plate, and each well contained 20 larvae immersed in 1mL Holt Buffer. The larvae in the group requiring ionizing radiation were irradiated with a single 2Gy γ-ray, and 1h before irradiation, the IR(2Gy)+0.1mM HPG and IR(2Gy)+0.1mM AMF groups were treated with 0.1mM HPG or 0.1mM AMF, respectively. After irradiation, fresh Holt Buffer was replaced every day, and HPG or AMF of corresponding concentration was supplemented. At 3.5 dpf (days post-fertilization), the fry of each group was collected, fixed with 4% paraformaldehyde, and shaken at 4°C overnight. Weigh 0.6 g Sudan Black B powder and dissolve it in 200 mL anhydrous ethanol, filter it with filter paper for later use. The fixed zebrafish fry of each group were rinsed with PBST 3 times, 5 min each time. Add 500 μL Sudan Black B dye solution to the 1.5 mL EP tube containing the embryos, and stain for 30 to 60 min at room temperature in a light-proof shaker. During this period, several fry can be taken out and placed under a microscope to observe the staining effect. After there is an obvious staining signal, rinse with 100% anhydrous ethanol until the signal is clearly visible. The fry of each group was placed in 100% glycerol for image acquisition.

[0074] (8) Effects of HPG on the expression levels of molecular markers of erythroid, myeloid and hematopoietic stem cells in irradiated zebrafish larvae

[0075] Tg(mpx:EGFP) fluorescently labeled transgenic zebrafish were paired in a 1:1 ratio, and the embryos were collected in Holt Buffer and cultured in a 28-degree constant temperature incubator, with fresh Holt Buffer replaced every day. At 2dpf, zebrafish larvae with good development and consistent fluorescence intensity were selected under a stereofluorescence microscope, and Ctrl, IR(2Gy), IR(2Gy)+0.1mM HPG and IR(2Gy)+0.1mM AMF groups were set up, with 3 replicates in each group. Each group of larvae was cultured in a 24-well plate, and each well contained 20 larvae immersed in 1mL Holt Buffer. The larvae in the group requiring ionizing radiation were irradiated with a single 2Gy γ-ray, and 1h before irradiation, the IR(2Gy)+0.1mM HPG and IR(2Gy)+0.1mM AMF groups were treated with 0.1mM HPG or 0.1mM AMF, respectively. After irradiation, fresh Holt Buffer was replaced every day, and HPG or AMF of corresponding concentration was supplemented. Drug treatment lasted for 3 days. At 5 dpf (days post-fertilization), the juvenile fishes of each group were collected, and RNA was extracted by TRIzol lysis method. cDNA was obtained by reverse transcription, and the mRNA expression levels of directional hematopoietic erythroid molecular marker βe1 (forward: GCAAGGTGTCTCATCGTGT; reverse: GTCAAGCAATCAGCCAAAA), directional hematopoietic myeloid molecular marker lyc (forward: GATACGGGGAAGGACTACGG; reverse: CAGCCCGTCCATTTTCACAA), and hematopoietic stem cell molecular marker c-myb (forward: GGAAAGTGGAGCAAGAAGGTTA; reverse: TCGCTGTAGTGTCTCTGGATAG) were detected by real-time fluorescence quantitative PCR.

[0076] Experimental Results

[0077] (1) Screening of safe concentrations of harpagine (HPG) and amifostine (AMF)

[0078] After screening, 2mM HPG, 20mM HPG and 2mM AMF can cause a significant decrease in the survival rate of zebrafish embryos and a significant increase in the deformity rate. HPG and AMF at concentrations of 0.2mM and below did not cause significant changes in embryo survival rate and deformity rate. Therefore, the safe concentrations of HPG and AMF on zebrafish embryos are 0-0.2mM ( Figure 1 and 2 ).

[0079] (2) Screening of effective protective concentrations of HPG and amifostine (AMF)

[0080] After screening, 0.1mM HPG and AMF can reverse the decreased survival rate and increased deformity rate of irradiated zebrafish embryos to the greatest extent. Therefore, the optimal protective concentration of HPG and AMF on zebrafish embryos is 0.1mM ( Figure 3 and 4 ).

[0081] (3) Effects of HPG on the development of irradiated zebrafish

[0082] γ-ray irradiation can cause developmental retardation, decreased survival rate, and the appearance of various types of deformities in zebrafish embryos, while both HPG and AMF treatments can reverse this trend to varying degrees, with AMF having a relatively better reversal effect ( Figure 5 ).

[0083] (4) Effects of HPG on ionizing radiation-induced gene expression disorders and inflammation levels in zebrafish embryonic development

[0084] γ-ray irradiation can cause expression disorders of development-related genes in zebrafish embryonic tissues (sox19a and p53 mRNA levels are upregulated, Wnt mRNA levels are downregulated) and increased inflammation levels (inflammatory factors TNF-α and IL-1β protein levels are upregulated), while HPG and AMF treatments can reverse this trend to varying degrees, and the reversal effect of AMF treatment is more significant ( Figure 6 ).

[0085] (5) Effects of HPG on ionizing radiation-induced hematopoietic damage in zebrafish

[0086] The fluorescence intensity of Tg(mpx:EGFP) fluorescently labeled transgenic zebrafish gradually weakened with the increase of γ-ray irradiation dose, especially in the 2Gy and 4Gy irradiation groups, and the weakening effect was more obvious with the extension of time after irradiation ( Figure 7 ). 72 hours after irradiation, the blood flow velocity in the tail gradually slowed down with the increase of γ-ray irradiation dose, especially in the 2Gy and 4Gy irradiation groups ( Figure 8 ). 2Gy γ-ray irradiation can weaken the fluorescence intensity of Tg(mpx:EGFP) zebrafish, while HPG and AMF treatment can reverse this trend to a certain extent. The blood flow velocity shows a similar trend 72h after irradiation ( Fig. 9 ).

[0087] (6) O-Dianisidine staining to detect the effect of HPG on ionizing radiation-induced hematopoietic erythroid cell reduction in zebrafish

[0088] 2Gy γ-ray irradiation can reduce the number of directional hematopoietic erythroid cells in Tg(mpx:EGFP) zebrafish (most obvious in the heart), while HPG and AMF treatment can reverse this trend to a certain extent ( Fig.10 ).

[0089] (7) Sudan Black B staining to detect the effect of amifostine on the reduction of committed hematopoietic myeloid cells induced by ionizing radiation in zebrafish

[0090] 2Gy γ-ray irradiation can reduce the number of hematopoietic myeloid cells in Tg(mpx:EGFP) zebrafish (most obvious in the tail), while HPG and AMF treatment can reverse this trend to some extent ( Fig.11 ).

[0091] (8) Effect of HPG on the expression levels of molecular markers of erythroid, myeloid and hematopoietic stem cells in irradiated zebrafish larvae.

[0092] 2Gy γ-ray irradiation can reduce the mRNA expression levels of βe1, a molecular marker of hematopoietic erythroid cells, lyc, a molecular marker of myeloid cells, and c-myb, a molecular marker of hematopoietic stem cells, in Tg(mpx:EGFP) zebrafish, while HPG and AMF treatment can reverse this trend to some extent ( Fig.12 ).

[0093] Although the specific embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that various modifications and changes may be made to the details according to all the teachings that have been published, and these changes are within the scope of protection of the present invention. The entire invention is given by the attached claims and any equivalents thereof.

Claims

1. A pharmaceutical composition for preventing or treating ionizing radiation damage, characterized in that: The pharmaceutical composition comprises a preventive or therapeutically effective amount of harpagine or a pharmaceutically acceptable salt thereof.

2. A pharmaceutical preparation for preventing or treating ionizing radiation damage, characterized in that: The pharmaceutical preparation comprises the pharmaceutical composition according to claim 1.

3. The pharmaceutical preparation according to claim 2, characterized in that The dosage form of the pharmaceutical preparation includes an oral dosage form, a parenteral dosage form and / or a topical dosage form; Preferably, the dosage form of the pharmaceutical preparation includes solutions, sustained-release preparations, suspensions, granules, tablets, capsules, powders, effervescent preparations, emulsions, syrups, drops and / or chewable preparations.

4. Use of harpagine or its pharmaceutically acceptable salt in the preparation of a medicament for preventing or treating ionizing radiation damage.

5. The use according to claim 4, characterized in that The ionizing radiation damage includes ionizing radiation-induced embryonic development retardation, ionizing radiation-induced inflammation enhancement, ionizing radiation-induced hematopoietic damage, ionizing radiation-induced hematopoietic erythroid cell reduction, and ionizing radiation-induced hematopoietic myeloid cell reduction.

6. The use according to claim 4, characterized in that The medicament further comprises pharmaceutically acceptable adjuvants and / or excipients.

7. The use according to claim 4, characterized in that The dosage form of the drug includes an oral dosage form, a parenteral dosage form and / or a topical dosage form.

8. The use according to claim 7, characterized in that The dosage form of the drug includes solution, sustained release, suspension, granule, tablet, capsule, powder, effervescent, emulsion, syrup, drop and / or chewable.

9. The use according to claim 4, characterized in that: The safe concentration of harpagoside in the drug is 0 to 0.2 mM; Preferably, the protective concentration of harpagoside in the drug is 0.1 mM.

10. The use according to claim 4, characterized in that The ionizing radiation is gamma-rays; Preferably, the ionizing radiation is 2 Gy-6 Gy; Preferably, the ionizing radiation is 2 Gy, 4 Gy, 6 Gy.

Images