Application of composition in preparation of medicine for treating intestinal microbiota disorder

Abstract

The invention discloses application of a composition in preparation of a medicine for treating intestinal microbiota disorder. The composition disclosed by the invention comprises egg yolk oil, radish seed oil, perilla seed oil and the like, and the composition disclosed by the invention can be used for remarkably relieving the symptom of intestinal microbiota disorder, especially the phenomenon of intestinal microbiota disorder caused by drugs.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to use of a composition in preparing a medicine for treating intestinal microbial flora disorders. Background Art

[0002] Intestinal microbiota disorder, also known as intestinal dysbiosis, refers to the phenomenon that the balance of microorganisms in the intestine is broken, resulting in an increase in harmful bacteria and a decrease in "good" bacteria. This imbalance not only affects intestinal health, but may also further cause a variety of diseases, such as digestive system diseases, metabolic diseases, cardiovascular diseases, immune system diseases, etc. There are many causes of intestinal microbiota disorder, such as the use of drugs or antibiotics, poor eating habits, stress, environmental toxins, infection, etc. Current methods for treating intestinal microbiota disorders include adjusting diet, using probiotics and prebiotics, or improving lifestyle. However, these methods have limited therapeutic effects on some intestinal microbiota disorders induced by drugs or antibiotics.

[0003] Therefore, there is an urgent need in the art to find a new method for treating intestinal microbial flora disorders. Summary of the invention

[0004] The object of the present invention is to provide a use of a composition.

[0005] Another object of the present invention is to provide a method for preventing and / or treating intestinal microbial flora disorders.

[0006] In order to solve the above technical problems, the first aspect of the present invention provides a use of a composition, the composition comprising egg yolk oil, radish seed oil and perilla seed oil; the composition is used for:

[0007] (i) preventing and / or treating intestinal microbiota disturbances; and / or

[0008] (ii) preparing a medicament for preventing and / or treating intestinal microbiota disorders.

[0009] In some preferred embodiments, the intestinal microbiota disorder is an intestinal microbiota disorder caused by chemical substances.

[0010] In some preferred embodiments, the composition is a pharmaceutical composition.

[0011] In some preferred embodiments, the composition is a health care product composition.

[0012] In some preferred embodiments, the chemical substance is selected from at least one of scopolamine, trihexyphenidyl, and atropine.

[0013] In some preferred embodiments, the chemical substance is scopolamine.

[0014] In some preferred embodiments, the intestinal microbiota disorder caused by the chemical substances includes: an increase in the microbiota associated with purine metabolism induced by scopolamine, and / or a decrease in the microbiota associated with nitrogen metabolism induced by scopolamine; and / or a decrease in the microbiota associated with sulfur metabolism induced by scopolamine.

[0015] In some preferred embodiments, the composition can inhibit the increase of microorganisms related to purine metabolism induced by scopolamine; and / or inhibit the decrease of microorganisms related to nitrogen metabolism induced by scopolamine; and / or inhibit the decrease of microorganisms related to sulfur metabolism induced by scopolamine.

[0016] In some preferred embodiments, the composition can alleviate and / or eliminate the impairment of intestinal pantothenic acid and coenzyme A biosynthesis caused by scopolamine.

[0017] In some preferred embodiments, the composition can alleviate and / or eliminate intestinal inflammation caused by scopolamine.

[0018] In some preferred embodiments, the composition can down-regulate the expression of inflammatory markers in intestinal cells caused by scopolamine; preferably, the inflammatory markers are Calprotectin, Tnf-α and IL-1β.

[0019] In some preferred embodiments, the composition further comprises Noni pulp and cinnamon oil.

[0020] In some preferred embodiments, the composition consists of egg yolk oil, perilla seed oil, radish seed oil, noni pulp and cinnamon oil.

[0021] In some preferred embodiments, in the composition, the mass of the egg yolk oil accounts for 55-70% of the total mass of the composition.

[0022] In some preferred embodiments, in the composition, the mass proportion of the egg yolk oil is more than 50%.

[0023] In some preferred embodiments, in the composition, the mass of the perilla seed oil accounts for 15-25% of the total mass of the composition.

[0024] In some preferred embodiments, in the composition, the mass of the radish seed oil accounts for 15-25% of the total mass of the composition.

[0025] In some preferred embodiments, in the composition, the mass of the Noni pulp accounts for 3-7% of the total mass of the composition.

[0026] In some preferred embodiments, in the composition, the mass of the cinnamon oil accounts for 0.1-5% of the total mass of the composition.

[0027] In some preferred embodiments, the composition comprises:

[0028] 55-70 parts by weight of egg yolk oil; and

[0029] Perilla seed oil 15-25 parts by weight.

[0030] In some preferred embodiments, the composition comprises the following:

[0031] 55-60 parts by weight of egg yolk oil; and

[0032] Perilla seed oil 15-20 parts by weight.

[0033] In some preferred embodiments, the composition comprises the following:

[0034] 55-70 parts by weight of egg yolk oil;

[0035] Perilla seed oil 15-25 parts by weight;

[0036] 15-25 parts by weight of radish seed oil;

[0037] 3-7 parts by weight of Noni pulp; and

[0038] 0.1-5 parts by weight of cinnamon oil.

[0039] In some preferred embodiments, the composition comprises the following:

[0040] 55-60 parts by weight of egg yolk oil;

[0041] Perilla seed oil 15-20 parts by weight;

[0042] 15-20 parts by weight of radish seed oil;

[0043] 3-5 parts by weight of Noni pulp; and

[0044] 0.1-3 parts by weight of cinnamon oil.

[0045] A second aspect of the present invention provides a method for preventing and / or treating intestinal microbial flora disorders, the method comprising the steps of:

[0046] A therapeutically effective amount of the composition as described in the first aspect of the present invention is administered to the subject.

[0047] In some preferred embodiments, the composition is administered by intragastric administration or oral administration, preferably oral administration.

[0048] In some preferred embodiments, the intestinal microbiota disorder is an intestinal microbiota disorder caused by chemical substances.

[0049] In some preferred embodiments, the chemical substance is selected from at least one of scopolamine, trihexyphenidyl, and atropine.

[0050] In some preferred embodiments, the chemical substance is scopolamine.

[0051] The third aspect of the present invention provides a use of a health care product composition, wherein the health care product composition comprises an active ingredient and an excipient acceptable to health care products, wherein the active ingredient comprises the composition as described in the first aspect of the present invention; the health care product composition is used to: improve the disorder of intestinal microbiome in the body.

[0052] In some preferred embodiments, the intestinal microbiota disorder is intestinal microbiota disorder caused by chemical substances.

[0053] In some preferred embodiments, the chemical substance is selected from at least one of scopolamine, trihexyphenidyl, and atropine.

[0054] In some preferred embodiments, the chemical substance is scopolamine.

[0055] Compared with the prior art, the present invention has at least the following advantages:

[0056] (1) The composition of the present invention can significantly alleviate the symptoms of intestinal microbial flora disorders, regulate intestinal microbial flora and restore intestinal immune homeostasis, reshape intestinal microbial flora, inhibit intestinal metabolic disorders, and especially improve intestinal flora disorders caused by drugs.

[0057] (2) The composition of the present invention can relieve intestinal inflammation, enhance CoA biosynthesis, and activate and activate the cholinergic anti-inflammatory pathway.

[0058] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] One or more embodiments are exemplarily described by the pictures in the corresponding drawings, and these exemplary descriptions do not constitute limitations on the embodiments.

[0060] Figure 1 This is the experimental design diagram in the embodiment of the present invention, Oa: oral administration; Ip: intraperitoneal injection;

[0061] Figure 2PRCN regulates the intestinal microbiota of scopolamine-induced mice in an embodiment of the present invention, wherein (A) Shannon-Wiener curve of 16S rRNA sequencing. (BC) OPLS-DA and NMDS analysis of Vco, Sco, Don and EPRCN groups. (D) The top 50 most abundant genera in feces of the four mouse groups. Species composition analysis at the phylum (E) and genus (F) levels. (G) Six OTUs that were significantly different between the four groups. Data are expressed as mean ± standard error, and each hollow point represents a sample. *p<0.05; **p<0.01; ***p<0.001, ns, no significant difference.

[0062] Figure 3 The main intestinal microbiota in the four groups. (A) Evolutionary branch diagram of LEfSe analysis. (B) LDA distribution histogram of LEfSe analysis.

[0063] Figure 4 Functional prediction analysis of gut microbiota in Vco, Sco, and EPRCN groups based on KEGG homologs. (A) Intergroup comparison of purine metabolism in Vco, Sco, and EPRCN groups by Tukeyramer multiple comparison test. (B) Intergroup comparison of sulfur metabolism in Vco, Sco, and EPRCN groups by Tukeyramer multiple comparison test. (C) Intergroup comparison of nitrogen metabolism in Vco, Sco, and EPRCN groups by Tukeyramer multiple comparison test. (D) Intergroup comparison of pantothenate and CoA biosynthesis in Vco, Sco, and EPRCN groups by Tukeyramer multiple comparison test.

[0064] Figure 5 Effects of EPRCN on scopolamine-induced intestinal inflammation and cholinergic anti-inflammatory effects in mice. (A) Representative images of the colon of mice in each group. qPCR analysis shows the levels of (B) Calprotectin, (C) Tnf-α, and (D) IL-1β in the colon of the indicated groups of mice (n=3 per group, each sample repeated three times). (E) Ach levels in the colon of the indicated groups of mice (n=6 per group). (F) α7nAchR levels in the colon of the indicated groups of mice (n=3 per group, each sample repeated twice). Data are expressed as mean ± standard error, and each open point represents one sample. *p<0.05, ns, no significant difference.

[0065] Figure 6 Spearman correlation analysis between the index improved by EPRCN (Ach activity in the colon) and the top 50 abundant gut microbiota. Data are from mice in the Vco, Sco, and EPRCN groups. *: p<0.05, **: p<0.01, ***: p<0.001. DETAILED DESCRIPTION

[0066] In the present invention, we developed a pharmaceutical composition EPRCN prescription consisting of five safe ingredients, which can improve the intestinal microbial community disorder induced by scopolamine in mice and restore intestinal immune homeostasis, reshape the intestinal microbial community, and inhibit intestinal metabolic disorders. The components in the pharmaceutical composition of the present invention cooperate synergistically, and the therapeutic effect is significantly better than that of a single component.

[0067] the term

[0068] As used in this article, the terms "egg yolk oil", "egg yolk oil", "chicken oil" and "egg butter" can be used interchangeably to refer to the oil extracted from the yolk of eggs. Egg yolk oil has the effects of clearing heat and detoxifying, astringing, stopping bleeding and relieving pain. It is mostly used for burns, eczema, ear pus, sores and the like.

[0069] As used herein, the term "radish seed oil" refers to the oil separated from radish seeds, which are the dried mature seeds of the plant radish (RaphanussativusL) of the genus Raphanus (RaphanusL) of the cruciferous family. The plants are harvested in summer when the fruits are ripe, dried, the seeds are rubbed out, and the impurities are removed and then dried again. Radish seeds belong to the lung, spleen, and stomach meridians, are flat in nature, and have a pungent and sweet taste. They have the functions of descending qi and resolving phlegm, digesting food and removing bloating. They are mainly used to treat food stagnation, constipation, abdominal distension and pain, phlegm-blocked cough and wheezing, and stagnation and diarrhea.

[0070] As used herein, the term "perilla seed oil" refers to a natural oil obtained from the mature seeds of the medicinal plant Perilla frutesccns of the Labiatae family, which is a highly unsaturated oil. Perilla is mainly used to treat colds, fever, cough, asthma, chest and abdominal distension, and fetal movement disorder.

[0071] As used herein, the terms "cinnamon oil" and "cassia bark oil" are used interchangeably and refer to a clear liquid that is yellow or yellow-brown; it has the distinctive aroma of cinnamon and tastes sweet and spicy. Cinnamon oil is an aromatic oil obtained by distilling the bark, branches and leaves of the cinnamon plant of the Lauraceae family. It is mainly used to treat spleen and stomach yang deficiency, cold limbs and weak pulse, cold accumulation in the abdomen, abdominal pain and diarrhea, cold hernia and running pigs; it is used externally to treat rheumatism and skin itching.

[0072] As used herein, the term "Noni pulp" refers to the pulp extracted from Noni fruit, which is the fruit of Morinda officinalis, and has the effects of dispelling wind evil, strengthening yang and kidney, and strengthening tendons and bones.

[0073] To make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are usually based on conventional conditions or the conditions recommended by the manufacturer. Unless otherwise specified, percentages and parts are weight percentages and weight parts. The experimental materials and reagents used in the following examples can be obtained from commercial channels unless otherwise specified.

[0074] Unless otherwise specified, the technical and scientific terms used herein have the same meaning as commonly understood by ordinary technicians in the technical field to which the application belongs. It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments of the present application.

[0075] Unless otherwise indicated, the term "or" means and is used interchangeably with the term "and / or".

[0076] As used herein, including the appended claims, singular forms of words such as "a," "an," and "the" include their corresponding plural referents unless the context clearly dictates otherwise.

[0077] 1. Materials and Methods

[0078] 1.1. Drug preparation

[0079] The composition (EPRCN) of the present invention is a mixture of the following ingredients: 0.29 g of egg yolk oil (G. gallus domesticus) (58.0%), 0.094 g of perilla seed oil (P. frutescens) (18.8%), 0.094 g of radish seed oil (R. Sativus) (18.8%), 0.02 g of noni pulp (M. citrifolia) (4.0%) and 0.002 g of cinnamon oil (C. spp.) (0.4%).

[0080] The composition of the present invention is encapsulated in 0.5 gram capsules to prepare capsules.

[0081] According to the "3R" principle of animal experiment ethics, the dose of EPRCN was calculated using the equivalent dose ratio of 20 mg / kg, resulting in a daily intake of 0.36 to 0.52 mg for mice.

[0082] 1.2 Animal models and dosage regimens for intestinal flora disturbance

[0083] 36 SPF-grade eight-week-old male ICR mice, weighing 18-26 g, were housed at 22±2°C and maintained in a 12-h light-dark cycle. All mice were provided by SLAC Laboratory Animal Co., Ltd., Shanghai, China (license number SCXK(Hu)2022-0004). This study has been approved by the Experimental Animal Ethics Committee of Shanghai Institute of Biomedical Technology (protocol code 2023-30, approval date March 28, 2023). EPRCN and donepezil (product number D332795, Aladdin) were dissolved in 0.5% CMC-Na (product number HY-Y0703, MedChemExpress) and administered orally. Scopolamine (product number S302239, Aladdin) was dissolved in normal saline and administered by intraperitoneal injection. The control group mice were orally administered with an equal volume of 0.5% CMC-Na and intraperitoneally injected with an equal volume of normal saline. The dosage of scopolamine (3 mg / kg / d) and donepezil (3 mg / kg / d) was based on previous studies. All mice were randomly divided into the following four groups: control group (Vco group) (normal saline 5 ml / kg / d + 0.5% CMC-Na 5 ml / kg / d, n = 9), scopolamine (Sco) group (scopolamine 3 mg / kg / d + 0.5% CMC-Na 5 ml / kg / d, n = 9), donepezil (Don) group (scopolamine 3 mg / kg / d + donepezil 3 mg / kg / d, n = 9) and EPRCN (EPRCN) group (scopolamine 3 mg / kg / d + EPRCN 20 mg / kg / d, n = 9). Mice were orally administered 0.5% CMC-Na, donepezil or EPRCN once a day for 24 days. The body weight of mice was measured every 7 days to adjust the dosage. Figure 1 Behavioral testing lasted for 10 days, and drug administration was performed simultaneously during the testing period.

[0084] 1.3. Mouse sacrifice and sample collection

[0085] Mice were killed by cervical dislocation. The colon tissue of 32 mice was quickly divided into two parts. One part was placed in 4% paraformaldehyde for hematoxylin and eosin (H&E) staining, and the other part was frozen in liquid nitrogen and placed at -80°C for qRT-PCR. Feces were collected before decapitation, frozen in liquid nitrogen and placed at -80°C for 16S rRNA gene sequencing.

[0086] 1.4. Colon Histological Analysis

[0087] Histological analysis of the colon was performed using H&E staining. After fixation in 4% paraformaldehyde solution for 24 h, colon samples were dehydrated in ethanol; then, the tissues were dehydrated in ethanol / xylene and embedded in paraffin blocks. The paraffin blocks were cut into 4-μm-thick sections using a microtome. The sections were stained with H&E (Cat. No. G1076, Servicebio), and pathological sections were observed under a Nikon confocal microscope (Nikon, USA).

[0088] 1.5.16S rRNA gene sequencing

[0089] Genomic DNA was extracted from fecal samples using a bacterial genomic DNA kit (Cat. No. CW0552, CWBIO). 16S rRNA sequencing was performed using the Illumina system (Illumina, CA, USA) with primer 338F_806R, F-terminal sequence ACTCCTACGGGAGGCAGCAG and R-terminal sequence GGACTACHVGGGTWTCTAAT, and the minimum data size for a single sample was 30,000. Sequencing and bioinformatics analysis were performed by Shanghai Meiji Biotechnology Co., Ltd. Chimeric sequences were filtered using USEARCH software (https: / / www.drive5.com / usearch), and sequences with a similarity of more than 97% were considered to be the same operational taxonomic units (OTUs). Microbial diversity was assessed by OPLS-DA and nonmetric multidimensional scaling (NMDS) analysis. Linear discriminant analysis (LDA) effect size (LEfSe) analysis was performed to assess differential species abundance between groups.

[0090] 1.6 Western blot analysis

[0091] Total protein of brain samples was extracted using RIPA lysis buffer (Cat. No. G2002, Servicebio) supplemented with 1 mM phenylmethylsulfonyl fluoride (PMSF, Cat. No. G2008, Servicebio). Protein concentration was determined using a BCA protein assay kit (Cat. No. G2026, Servicebio). After separation in 10% SDS-PAGE gel electrophoresis (Cat. No. G2043, Servicebio), proteins of each sample were transferred to a polyvinylidene fluoride (PVDF, Cat. No. G6015-0.45, Servicebio) membrane. After blocking with 5% skim milk powder for 30 minutes, the membrane was incubated with BDNF primary antibody (Cat. No. PA5-85730, Thermofisher) at 4°C for 18 hours. After washing with Tris-buffered saline Tween (TBST) buffer, it was incubated with horseradish peroxidase (HRP)-labeled rabbit IgG secondary antibody (1:2000 dilution, Bioss, China) for 1 to 2 hours. The intensity of each band in different samples was measured using Image J software and normalized with the expression level of GAPDH. This experiment was performed three times.

[0092] 1.7 Biochemical analysis

[0093] The activities of choline acetyltransferase (ChAT), acetylcholinesterase (AChE), and acetylcholine (ACh) were detected using kits (Cat. No. A079, A024, and A105-1, Nanjing Jiancheng Biotechnology Institute). The cortex of each group of mice was pretreated with 1× PBS (Cat. No. G4202, Servicebio). The homogenate was centrifuged at 5000×g for 10 min at 4°C. The supernatant was stored in an Eppendorf tube, and the levels and activities of ChAT, AChE, and ACh were detected using a universal microplate spectrophotometer (Bio-Rad, Hercules, USA) according to the manufacturer's instructions.

[0094] 1.8 Statistical analysis

[0095] Statistical analysis was performed using GraphPad Prism version 9.5 (GraphPad Software, La Jolla, CA, USA). Correlation coefficient analysis was performed using the R software package, using the Spearman correlation algorithm, and the significant correlation parameters were set as follows: R>0.35 or <-0.35 and p<0.05. Data are expressed as mean ± standard error, and each hollow point on the bar graph represents the measurement of one sample. One-way or two-way ANOVA was used for comparison between groups, and Tukey correction was used for multiple comparisons when necessary. # and * indicate p<0.05, which was considered statistically significant.

[0096] 2. Results

[0097] 2.1EPRCN regulates the structure of the intestinal microbiota in mice induced by scopolamine

[0098] Scopolamine induces an imbalance in the intestinal microbiota. The Shannon-Wiener curve of the 16S rRNA gene sequence remains almost unchanged after a rapid increase ( Figure 2 A). According to β-diversity analysis, OTUs of Vco, Sco, Don, and EPRCN groups were different, and according to ANOSIM analysis (p = 0.001), there were significant differences among the groups ( Figure 2 BC). Figure 2 D shows the 50 most abundant genera. In mice with gut microbiota disturbances supplemented with EPRCN, the probiotic-associated Bacteroidetes, Enterorhabdus, and Ruminococcus were restored. At the phylum level, the OTUs identified in mouse feces were mainly composed of Bacteroidota and Firmicutes ( Figure 2 E). However, at the genus level, Muribaculaceae_unclassified was the dominant genus in most samples ( Figure 2 F). EPRCN treatment restored the relative abundance of Lachnospiraceae_NK4A136_group but suppressed the increase of Desulfovibrionaceae_unclassified in mice with disturbed gut microbiota. In addition, six OTUs were significantly different between the four groups ( Figure 2 G). The abundance of three OTUs belonging to Muribaculaceae decreased in the Sco group but approached that of the Vco group after treatment with EPRCN. The other three OTUs increased significantly in the Model group but were suppressed in the EPRCN group. Two of the OTUs belonged to Clostridia and one to Desulfovibrionaceae. LEfSe analysis was further performed to estimate the relative abundance of bacteria in the four groups ( Figure 3 A). Desulfobacterota, Desulfovibrionia, Desulfovibrionales, Desulfovibrionaceae, and Desulfovibrionaceae_unclassified functioned in the Sco group and were distinct from the other groups ( Figure 3B). This means that Desulfovibrionaceae, which was highly abundant in gut microbiota-disturbed mice, was closely associated with scopolamine-induced gut microbiota disturbance. In the EPRCN group, short-chain fatty acid (SCFA)-producing bacteria Lachnospirales, Lachnospiraceae, and Lachnospiraceae_NK4A136_group may play a role, which is different from the other groups.

[0099] 2.2EPRCN inhibits scopolamine-induced intestinal metabolic disorders in mice and promotes coenzyme A biosynthesis

[0100] To further investigate whether EPRCN affects the gut microbiota of mice induced by scopolamine, we compared the Vco, Sco, and EPRCN groups. The functions of the mouse gut microbiota predicted by alternative pathways based on KEGG homologs after EPRCN treatment were similar to those of the Vco group, associated with three metabolic pathways and one biosynthetic process ( Figure 4 AD). Compared with the Vco group, the proportion of microbiota associated with purine metabolism was significantly increased, while the microbiota associated with nitrogen metabolism and sulfur metabolism was significantly decreased in scopolamine-induced mice. EPRCN treatment significantly inhibited this change. In addition, compared with the Vco group, the intestinal pantothenate and coenzyme A biosynthesis of mice after scopolamine intervention was impaired, but this impairment was reversed in the EPRCN group.

[0101] 2.3EPRCN rescues scopolamine-induced intestinal inflammation in mice and activates the cholinergic anti-inflammatory pathway

[0102] HE staining was performed on colon tissues of the four mouse groups. In the Vco group, the structure of colon mucosal epithelial cells remained intact, with no obvious damage or inflammation ( Figure 5 A), a small amount of local inflammatory cell infiltration was found in the Sco group. Although the Don group showed signs of inflammation and cell infiltration, there was a significant improvement in the Don group compared with the Sco group. On the other hand, the EPRCN group showed more intact crypt and mucosal structures, with minimal signs of inflammation and cell infiltration ( Figure 5 BD). In addition, the mRNA expression of inflammatory markers was downregulated in mice with intestinal microbiota disturbance treated with EPRCN or donepezil, indicating that EPRCN has an anti-intestinal inflammatory effect. Specifically, it has an inhibitory effect on the expression of calprotectin, Tnf-α, and IL-1β, and the inhibitory effect is greater than donepezil. We further explored the effect of EPRCN on the cholinergic anti-inflammatory pathway. The results showed that scopolamine significantly reduced the levels of Ach and α7nAchR in the colon compared with the Vco group ( Figure 5EF). After EPRCN and donepezil treatment, the levels of intestinal Ach and α7nAchR were significantly increased in scopolamine-induced mice.

[0103] 2.4 Correlation analysis between intestinal microbiota and indicators improved after EPRCN treatment

[0104] Spearman correlation analysis was performed to elucidate the correlation between the intestinal microbiota and the indicators improved after EPRCN treatment, including the level of ACh in the colon. The results showed that the relative abundance of 10 genera was significantly correlated with the level of ACh in the colon, such as Lachnospiraceae_NK4A136_group (r=0.6461, p=0.0014), Ligilactobacillus (r=0.6261, p=0.04396), Oscillibacter (r=0.6362, p=0.0108), etc.

[0105] 3. Conclusion

[0106] The present study showed that EPRCN supplementation was able to modulate intestinal microbiota and restore intestinal immune homeostasis in scopolamine-induced mice. EPRCN could reshape the intestinal microbiota, suppress intestinal metabolic disorders, and promote CoA biosynthesis in scopolamine-induced mice. Enhanced CoA biosynthesis after EPRCN treatment may explain the increase in intestinal Ach levels to activate the cholinergic anti-inflammatory pathway.

[0107] Those skilled in the art will appreciate that the above-mentioned embodiments are specific examples for implementing the present invention, and in actual applications, various changes may be made thereto in form and detail without departing from the spirit and scope of the present invention.

Claims

1. A use of a composition, characterized in that: The composition comprises egg yolk oil, perilla seed oil and radish seed oil; the composition is used for: (i) preventing and / or treating intestinal microbiota disturbances; and / or (ii) preparing a medicament for preventing and / or treating intestinal microbiota disorders.

2. The use according to claim 1, characterized in that The composition consists of egg yolk oil, perilla seed oil, radish seed oil, noni pulp and cinnamon oil.

3. The use according to claim 1, characterized in that The composition comprises: 55-70 parts by weight of egg yolk oil; 15-25 parts by weight of perilla seed oil; and 15-25 parts by weight of radish seed oil.

4. The use according to claim 1, characterized in that The composition of the composition is as follows: 55-70 parts by weight of egg yolk oil; Perilla seed oil 15-25 parts by weight; 15-25 parts by weight of radish seed oil; 3-7 parts by weight of Noni pulp; and 1-5 parts by weight of cinnamon oil.

5. The use according to any one of claims 1 to 4, characterized in that The composition is a pharmaceutical composition or a health care product composition.

6. The use according to any one of claims 1 to 4, characterized in that The intestinal microbiota disorder is the intestinal microbiota disorder caused by chemical substances.

7. The use according to claim 6, characterized in that The chemical substance is selected from at least one of scopolamine, trihexyphenidyl and atropine.

8. The use according to claim 6, characterized in that The intestinal microbiota disorder caused by the chemical substances includes: an increase in microbiota related to purine metabolism induced by scopolamine, and / or a decrease in microbiota related to nitrogen metabolism induced by scopolamine; and / or a decrease in microbiota related to sulfur metabolism induced by scopolamine.

9. The use according to claim 6, characterized in that The composition can inhibit the increase of microorganisms related to purine metabolism induced by scopolamine; and / or inhibit the decrease of microorganisms related to nitrogen metabolism induced by scopolamine; and / or inhibit the decrease of microorganisms related to sulfur metabolism induced by scopolamine.

10. A method for preventing and / or treating intestinal microbial flora disorders, characterized in that: The method comprises the steps of: A therapeutically effective amount of a composition comprising egg yolk oil and perilla seed oil is administered to a subject.

Images