Application of cilengitide and derivatives thereof in preparation of medicine for preventing or treating pericardial calcification
By using cilengite and its derivatives to inhibit the binding of asparagine endopeptidase and integrin, and prevent the differentiation of pericardial osteogenic precursor cells, the problem of lack of effective drugs in the prior art to treat pericardial calcification is solved, and effective prevention and treatment of pericardial calcification caused by natural aging and tumor diseases is achieved, reducing the risk of surgery.
Patent Information
- Application Number
- CN202510113055.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-24
- Publication Date
- 2025-03-28
AI Technical Summary
The prior art lacks effective drugs for the treatment of pericardial calcification, especially among pericardial calcification caused by natural aging and tumor diseases. Surgical resection is the only treatment method, but there are high risks and complications.
Cirenjitide and its derivatives are used to prevent or treat pericardial calcification by inhibiting the binding of asparagine endopeptidase and integrin and preventing the differentiation of osteoblast precursor cells.
Cirenjite and its derivatives can effectively inhibit the occurrence of pericardial calcification, reduce the risk of impaired cardiac diastolic function, and prolong the patient's survival time, providing a safer treatment plan than surgery.
Smart Images
Figure SMS_1 
Figure FDA0005257132810000011 
Figure FDA0005257132810000012
Abstract
Description
Technical Field
[0001] The present invention relates to the field of medicines, and in particular to the application of cilengitide and its derivatives in the preparation of medicines for preventing or treating pericardial calcification. Background Art
[0003] Pericardial calcification is mainly concerned in aging and its metabolic diseases, but pericardial calcification in cancer patients is often overlooked. Pericardial calcification can lead to limited cardiac diastolic function and venous blood return, increasing the risk of death from cardiovascular complications. Pericardiectomy is currently the only means of treating pericardial calcification. A summary report shows that pericardiectomy takes an average of more than 120 minutes, and patients need to be observed in the ICU for 3 to 7 days. Although the average age of patients is less than 50 years old, 87.5% of patients develop low cardiac output syndrome after surgery, and 12.5% of patients die of heart failure in the perioperative period. Cancer patients are in poor physical condition and are even less suitable for pericardiectomy. Summary of the invention
[0004] The purpose of the present invention is to provide a drug prevention or treatment scheme for pericardial calcification caused by natural aging and tumor diseases. The main mechanism is that cilengitide and its derivatives inhibit the binding of asparagine endopeptidase (AEP) to integrin, thereby inhibiting the differentiation of osteoblast precursor cells that migrate to the pericardium, thereby preventing or treating pericardial calcification. The cilengitide and its derivatives provided by the present invention can be used as drugs for preparing drugs that inhibit pericardial calcification caused by natural aging and pericardial calcification induced by tumor diseases or anti-pericardial calcification drugs for aging and heart disease research.
[0005] To achieve the above object, the present invention adopts the following technical solution:
[0006] Application of cilengitide and its derivatives in the preparation of drugs for preventing or treating pericardial calcification.
[0007] Preferably, the pericardial calcification includes pericardial calcification occurring due to natural aging and pericardial calcification induced by tumor disease.
[0008] Preferably, cilengitide trifluoroacetate is used to prepare a pharmaceutical composition containing cilengitide trifluoroacetate and a pharmaceutically acceptable carrier.
[0009] Preferably, cilengitide and its derivatives are used to prepare a pharmaceutical composition containing cilengitide and its derivatives and a pharmaceutically acceptable carrier.
[0010] Preferably, the pharmaceutical composition contains 0.01%-99.99% of cilengitide and its derivatives, and the rest is a pharmaceutical carrier.
[0011] Preferably, the Cilengitide and its derivatives include: Cilengitide, Cilengitide trifluoroacetate (Cilengitide TFA), the structural formula of which is shown in the following table:
[0012]
[0013] The advantages of the present invention are:
[0014] When the inventors retrospectively analyzed the clinical data of breast tumors, they found that more than 80% of breast cancer patients with lung metastasis had pericardial calcification, and pericardial calcification also occurred in patients with other cancers. Among breast cancer patients, the incidence of pericardial calcification was highest in patients with lung metastasis, followed by patients with metastasis to other organs, and then patients without metastasis. The rate of pericardial calcification caused by benign breast lesions was the lowest. The above pericardial calcification is related to the progression of breast disease and has nothing to do with age. Pericardial calcification can also be seen in patients with other cancers. Breast cancer patients and breast cancer model mice with pericardial calcification have a worse prognosis.
[0015] Pericardial calcification limits cardiac relaxation and impairs cardiac function. In addition, the inventors have also found that factors released during the calcification process can form tumor-promoting feedback. Therefore, pericardial calcification has an adverse effect on patient prognosis from two aspects: impairing cardiac function and promoting tumor progression. At present, in addition to surgical resection of the calcified pericardium, there is a lack of corresponding drugs for the treatment of pericardial calcification. The drug cilengitide and its derivatives provided by the present invention are used in the preparation of drugs for the prevention or treatment of pericardial calcification. Although cilengitide failed to change tumor progression in a Phase III clinical trial of glioblastoma, cilengitide showed good safety in Phase I and Phase II clinical trials of glioblastoma.
[0016] Clinically, Cilengitide inhibits integrin-mediated signal transduction by blocking the binding of integrins to the extracellular matrix, blocking cell proliferation, survival and migration, and inducing endothelial cell apoptosis, thus having anti-tumor potential. The present invention is characterized in that a new use of Cilengitide in preventing and treating pericardial calcification occurring in natural aging and tumor-related pericardial calcification has been discovered, thus expanding the scope of application of Cilengitide. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 :The occurrence of pericardial calcification in breast cancer patients and breast cancer mouse models.
[0018] (A) The inventors retrospectively analyzed chest CT reports of breast cancer patients. The left image shows no pericardial calcification, and the right image shows pericardial calcification.
[0019] (B) The inventors retrospectively analyzed the correlation coefficients between age, tumor factors and pericardial calcification (PC).
[0020] (C) The inventors retrospectively analyzed the incidence of pericardial calcification in breast cancer patients under 40 years old, 41-50 years old, 51-60 years old, 61-70 years old, and over 71 years old.
[0021] (D) The inventors retrospectively analyzed the incidence of pericardial calcification in patients with lung metastatic breast cancer, breast cancer with metastasis to other organs, breast cancer without metastasis, and patients with benign breast lesions.
[0022] (E) The inventors used Balbc mice transplanted with 4T1 breast cancer cells, and took pictures of picric acid staining of lung metastases and typical pericardial calcification.
[0023] (F) The inventors used the Von Kossa method to detect calcium deposition signals (black) in the pericardial tissue area.
[0024] (G) The inventors used Balbc mice to transplant different numbers of 4T1 breast cancer cells and then counted the incidence of pericardial calcification at the same time.
[0025] Figure 2 :Pericardial calcification and breast cancer prognosis. Among them:
[0026] (A) The inventors retrospectively analyzed the medical records of breast cancer patients and counted the distant disease free survival (DDFS) of patients with and without pericardial calcification in all collected breast cancer case information.
[0027] (B) The inventors retrospectively analyzed the medical records of breast cancer patients and counted the distant disease free survival (DDFS) of patients with and without pericardial calcification in breast cancer cases with and without lung metastasis.
[0028] (C) The inventors retrospectively analyzed the medical records of breast cancer patients and counted the distant disease free survival (DDFS) of patients with and without pericardial calcification in the cases of breast cancer with and without metastasis to other organs.
[0029] (D) The inventors used Balbc mice transplanted with 4T1 breast cancer cells to compare the survival of mice without pericardial calcification (Non PC) and with pericardial calcification (PC).
[0030] (E) The inventors used hydrocortisone acetate to induce pericardial calcification in Balbc mice, and then transplanted 4T1 breast cancer cells.
[0031] The survival time of mice without pre-induced pericardial calcification (4T1) and mice with pre-induced pericardial calcification (HYDRPC+4T1) by hydrocortisone acetate.
[0032] (F) The inventors used the TCGA database to analyze the relationship between the calcification and osteogenic differentiation marker gene SPP1 and the prognosis of breast cancer patients.
[0033] Figure 3 : The gene expression characteristics of breast cancer-related pericardial calcification and natural aging pericardial calcification tissue are similar. Among them:
[0034] (A) The inventors collected non-tumor pericardial tissue with natural aging and calcification (NPC), and used healthy pericardial tissue without calcification as control (naive), and drew a volcano map based on the gene expression measured by transcriptome.
[0035] (B) The inventors used Balbc mice to transplant 4T1 breast cancer cells through the tail vein to construct a breast cancer lung metastasis model. The pericardial tissue of healthy mice without pericardial calcification was used as the control (naive). Volcano plots were drawn based on the gene expression measured by transcriptome analysis to evaluate the gene expression characteristics of pericardial tissue of mice with breast cancer-related pericardial calcification (CPC).
[0036] (C) The inventors used Balbc mice to construct a breast cancer lung metastasis model by transplanting 4T1 breast cancer cells through the tail vein. Based on the gene expression determined by transcriptome analysis, the expression of the osteogenic differentiation marker Rux2 gene in the pericardial tissue of healthy mice (naive), naturally calcified mice (NPC) and tumor-associated pericardial calcification mice (CPC) was plotted.
[0037] (D) The inventors constructed a breast cancer lung metastasis model by transplanting 4T1 breast cancer cells into the tail vein of Balbc mice, and mapped the expression of the osteogenic differentiation marker Alpl gene in the pericardial tissue of healthy mice (naive), naturally calcified mice (NPC), and tumor-associated pericardial calcification mice (CPC) based on the gene expression determined by transcriptome analysis.
[0038] (E) The inventors used Balbc mice to transplant 4T1 breast cancer cells through the tail vein to construct a breast cancer lung metastasis model, and mapped the expression of the osteogenic differentiation marker Spp1 gene in the pericardial tissue of healthy mice (naive), naturally calcified mice (NPC) and tumor-associated pericardial calcification mice (CPC) based on the gene expression determined by transcriptome analysis.
[0039] (F) The inventors used Balbc mice to construct a breast cancer lung metastasis model by transplanting 4T1 breast cancer cells through the tail vein. Based on the gene expression determined by transcriptome, the expression of the osteogenic differentiation marker Col1a1 gene in the pericardial tissue of healthy mice (naive), naturally calcified mice (NPC) and tumor-associated pericardial calcification mice (CPC) was plotted.
[0040] (G) The inventors constructed a breast cancer lung metastasis model by transplanting 4T1 breast cancer cells into the tail vein of Balbc mice, and mapped the expression of the osteogenic differentiation marker Col1a2 gene in the pericardial tissue of healthy mice (naive), naturally calcified mice (NPC) and tumor-associated pericardial calcification mice (CPC) based on the gene expression determined by transcriptome analysis.
[0041] (H) The inventors constructed a breast cancer lung metastasis model by transplanting 4T1 breast cancer cells into Balbc mice via the tail vein, and mapped the expression of the osteogenic differentiation marker Sparc gene in the pericardial tissue of healthy mice (naive), naturally calcified mice (NPC), and tumor-associated pericardial calcification mice (CPC) based on the gene expression determined by transcriptome analysis.
[0042] Figure 4 :Macrophages and osteoblast precursor cells are involved in breast cancer-related pericardial calcification. Among them:
[0043] (A) The inventors used Balbc mice to establish a breast cancer lung metastasis model by transplanting 4T1 breast cancer cells through the tail vein. The whole-tissue staining technique was used to analyze the distribution of F4 / 80-positive macrophages (green) in normal pericardium and calcified pericardium, and DAPI was used to stain the cell nucleus (blue).
[0044] (B) The inventors used Balbc mice to establish a breast cancer lung metastasis model by transplanting 4T1 breast cancer cells through the tail vein. The pathological morphology of normal pericardium and calcified pericardium was analyzed by H&E method, and the expression of osteoblast precursor cell marker Twist2 in pericardial tissue was detected by immunohistochemistry (IHC).
[0045] (C) The inventors used Balbc mice to transplant 4T1 breast cancer cells through the tail vein to construct a breast cancer lung metastasis model, and mapped the expression of the osteoblast precursor cell marker Cd44 gene in the pericardial tissue of healthy mice (naive) and mice with tumor-associated pericardial calcification (CPC) based on the gene expression determined by transcriptome analysis.
[0046] (D) The inventors used Balbc mice to transplant 4T1 breast cancer cells through the tail vein to construct a breast cancer lung metastasis model, and mapped the expression of the osteoblast precursor cell marker Pdgfra gene in the pericardial tissue of healthy mice (naive) and mice with tumor-associated pericardial calcification (CPC) based on the gene expression determined by transcriptome analysis.
[0047] (E) The inventors used Balbc mice to transplant 4T1 breast cancer cells through the tail vein to construct a breast cancer lung metastasis model. Based on the gene expression determined by transcriptome analysis, the expression of the osteoblast precursor cell marker Ly6a gene in the pericardial tissue of healthy mice (naive) and mice with tumor-associated pericardial calcification (CPC) was plotted.
[0048] (F) The inventors searched the BioGPS website and used a bar graph to plot the expression of Twist2 in various tissues and cells. Its expression level was significantly upregulated during osteogenic differentiation and it is one of the markers of osteogenic precursor cells. Figure 5 :Asparagine endopeptidase and integrin are involved in breast cancer-related pericardial calcification and tumor-promoting feedback. Among them:
[0049] (A) The inventors used the TCGA database combined with literature reports to analyze genes encoding secretory proteins related to osteogenesis, genes related to innate immunity, genes related to glucose and energy metabolism, and genes related to hormone metabolism, and the asparagine endopeptidase encoding gene Lgmn with common correlation was enriched.
[0050] (B) The inventors used Balbc mice to construct a breast cancer lung metastasis model by transplanting 4T1 breast cancer cells through the tail vein. Based on the gene expression determined by transcriptome analysis, the expression of the asparagine endopeptidase encoding gene Lgmn in the pericardial tissue of healthy mice (naive), naturally calcified mice (NPC) and tumor-associated pericardial calcification mice (CPC) was plotted.
[0051] (C) The inventors used MMTV-PyVT mice to mate with Twist-driven Lgmn knockout mice, and finally obtained MMTV-PyVT mice with homozygous knockout or no knockout of Lgmn in Twist2-positive cells, and took pictures of female mice developing breast cancer.
[0052] (D) The inventors used MMTV-PyVT mice to mate with Twist-driven Lgmn knockout mice, and finally obtained MMTV-PyVT mice with homozygous knockout or non-knockout of Lgmn in Twist2-positive cells. The total weight of breast tumors in single female mice when breast cancer occurred was counted.
[0053] (E) The inventors used Balbc mice to construct a breast cancer lung metastasis model by transplanting 4T1 breast cancer cells through the tail vein. Based on the gene expression determined by the transcriptome, a heat map was used to plot the expression of integrin family genes in the pericardial tissue of healthy mice (naive) and mice with tumor-associated pericardial calcification (CPC).
[0054] (F) The inventors used Balbc mice to transplant breast cancer cells through the tail vein to establish a breast cancer lung metastasis model.
[0055] Fluorescence quantitative PCR was used to detect the expression of integrin family genes in wild-type mice (WT) and mice with asparagine endopeptidase encoding gene Lgmn knockout (Lgmn - / - ) Expression in osteoblastic progenitor cells isolated from the pericardium.
[0056] (G) The inventors used Balbc mice to transplant 4T1 breast cancer cells through the tail vein to establish a breast cancer lung metastasis model, and mapped the gene expression of the integrin family gene Itga5 in healthy mice (naive) based on the gene expression determined by transcriptome analysis.
[0057] And the expression in pericardial tissue of mice with tumor-associated pericardial calcification (CPC).
[0058] (H) The inventors used Balbc mice to transplant 4T1 breast cancer cells through the tail vein to establish a breast cancer lung metastasis model, and mapped the gene expression of the integrin family gene Itgav in healthy mice (naive) based on the gene expression determined by transcriptome analysis.
[0059] And the expression in pericardial tissue of mice with tumor-associated pericardial calcification (CPC).
[0060] (I) The inventors used Balbc mice to transplant 4T1 breast cancer cells through the tail vein to construct a breast cancer lung metastasis model, and mapped the gene expression of the integrin family gene Itgb1 in healthy mice (naive) based on the gene expression determined by transcriptome analysis.
[0061] And the expression in pericardial tissue of mice with tumor-associated pericardial calcification (CPC).
[0062] (J) The inventors used Balbc mice to transplant 4T1 breast cancer cells through the tail vein to establish a breast cancer lung metastasis model, and mapped the gene expression of the integrin family gene Itgb5 in healthy mice (naive) based on the gene expression determined by transcriptome analysis.
[0063] And the expression in pericardial tissue of mice with tumor-associated pericardial calcification (CPC).
[0064] Figure 6 :Cilengitide TFA inhibits pericardial calcification promoted by asparagine endopeptidase and prolongs survival time. Among them:
[0065] (A) The inventors induced osteoblastic precursor cell differentiation using osteogenic differentiation medium, supplemented with exogenous asparagine endopeptidase (AEP), and integrin inhibitor ATN161 or Cilengitide TFA.
[0066] (B) The inventors used Balbc mice to establish a breast cancer lung metastasis model by transplanting 4T1 breast cancer cells through the tail vein. The mice were treated with Cilengitide TFA and the solvent group was used as the control. Photos of pericardial calcification were taken.
[0067] (C) The inventors used Balbc mice to establish a breast cancer lung metastasis model by transplanting 4T1 breast cancer cells through the tail vein. The mice were treated with Cilengitide TFA and the solvent group was used as the control. The incidence of pericardial calcification was statistically analyzed.
[0068] (D) The inventors used Balbc mice to establish a breast cancer lung metastasis model by transplanting 4T1 breast cancer cells through the tail vein. The mice were treated with Cilengitide TFA. The solvent group was used as the control, and the area of pericardial calcification was counted.
[0069] (E) The inventors used Balbc mice to establish a breast cancer lung metastasis model by transplanting 4T1 breast cancer cells through the tail vein, and gave them ATN161 and Cilengitide TFA treatment respectively. Mice were used as control, and cardiac diastolic function was evaluated by cardiac ultrasound.
[0070] (F) The inventors used Balbc mice to establish a breast cancer lung metastasis model by transplanting 4T1 breast cancer cells through the tail vein. The mice were treated with Cilengitide TFA. The solvent group was used as a control. The pericardial tissue morphology and calcification signals were detected by H&E and Von Kossa staining.
[0071] (G) The inventors used Balbc mice to establish a breast cancer lung metastasis model by transplanting 4T1 breast cancer cells through the tail vein. The mice were treated with Cilengitide TFA and Cilengitide, respectively, and the solvent group was used as the control. The survival time of the mice was counted. DETAILED DESCRIPTION
[0072] In order to make the above features and advantages of the present invention more clearly understood, the following embodiments are given for detailed description. The methods of the present invention are all conventional methods in the art unless otherwise specified.
[0073] Example 1 The occurrence of pericardial calcification in breast cancer patients and breast cancer mouse models.
[0074] For retrospective analysis of clinical data, after ethical review, the chest CT results of breast cancer patients were analyzed, focusing on pericardial calcification and pericardial effusion ( Figure 1 A). Breast cancer patients were divided by age, and the correlation coefficients between age and pericardial calcification, and between tumor and pericardial calcification were analyzed using the correlation function ( Figure 1 The incidence of pericardial calcification in breast cancer patients aged under 40, 41-50, 51-60, 61-70, and over 71 years old was analyzed ( Figure 1 The incidence of pericardial calcification in patients with lung metastatic breast cancer, breast cancer with metastasis to other organs, breast cancer without metastasis, and benign breast lesions was retrospectively analyzed. Figure 1 (middle D).
[0075] For the breast cancer lung metastasis mouse model, Balbc mice were injected with 1×10 5 The experimental lung metastasis model was constructed by using 4T1 breast cancer cells, and picric acid staining photos of lung metastases were taken ( Figure 1 Middle E). The mice were euthanized on the 15th day, and the lungs and corresponding hearts were collected. The pericardial calcification incidence was counted and photographed. The calcium deposition in the pericardial tissue was detected using the VonKossa method ( Figure 1 (E and F) For the experiment on the correlation between breast cancer progression and pericardial calcification incidence, 0 and 0.25×10 5 pcs, 1×10 5 pcs, 5×10 5 pcs, 10×10 5 The degree of breast cancer progression was different in the way of 4T1 cells. The mice were euthanized at the same time point after modeling, and the lungs and corresponding hearts of the mice were collected to calculate the incidence of pericardial calcification ( Figure 1 Middle G).
[0076] Example 2 Pericardial calcification and breast cancer prognosis.
[0077] For the clinical data retrospective pericardial calcification and breast cancer prognosis, after ethical review, the chest CT results of breast cancer patients were analyzed, and the patients were divided into calcified patients and non-calcified patients according to the occurrence of pericardial calcification. The patient medical records were reviewed and the progression-free time was calculated. SPSS software was used to compare and analyze the progression-free time of all breast cancer cases, breast cancer cases with lung metastasis, breast cancer cases with metastasis to other organs, and breast cancer cases without metastasis ( Figure 2 A, B and C). For the correlation analysis between breast cancer in situ tissue calcification and prognosis in the clinical database, the TCGA database was used to analyze the relationship between calcification and osteogenic differentiation marker gene SPP1 and the prognosis of breast cancer patients ( Figure 2 Middle F).
[0078] For the breast cancer mouse animal model, pericardial calcification and breast cancer prognosis, Balbc mice were injected with 1×10 5 The experimental lung metastasis model was constructed by using 4T1 breast cancer cells. The occurrence of pericardial calcification at the time of mouse death was recorded. The model mice were divided into calcified mice and non-calcified mice according to the occurrence of pericardial calcification. The survival time of pericardial calcified mice and non-calcified mice was statistically analyzed. Figure 2 D) For the model of hormone-induced pericardial calcification in mice and breast cancer prognosis, pericardial calcification was induced in Balbc mice using hydrocortisone acetate. The non-induced group was used as the control and 1×10 5 The experimental lung metastasis model was constructed by using 4T1 breast cancer cells and the survival time of mice was calculated. Figure 2 Middle E).
[0079] Example 3 The gene expression characteristics of breast cancer-related pericardial calcification and natural aging pericardial calcification are similar.
[0080] For the induction of pericardial calcification in the breast cancer mouse model, Balbc mice were injected with 1×10 5 An experimental lung metastasis model was constructed by using 4T1 breast cancer cells. Healthy mice without pericardial calcification were used as controls. The mouse pericardial tissues were collected for transcriptome sequencing. A volcano map was drawn based on the gene expression determined by the transcriptome. The pericardial tissues of tumor mice, non-tumor naturally aged calcified pericardial tissues and healthy mice pericardial tissues were compared ( Figure 3 A and B). From the transcriptome sequencing data, the expression of genes encoding osteoblastic and calcification markers Runx2, Alpl, Spp1, Col1a1, Col1a2, and Sparc was analyzed ( Figure 3 C to H).
[0081] Example 4 Macrophages and osteoblast precursor cells are involved in breast cancer-related pericardial calcification.
[0082] For the analysis of pericardial calcification-induced macrophage infiltration in breast cancer mice, Balbc mice were injected with 1×10 5 The experimental lung metastasis model was constructed by using 4T1 breast cancer cells. Healthy mice without pericardial calcification were used as controls. The pericardial tissues of mice were collected for whole-tissue immunofluorescence staining. The expression of macrophages in pericardial tissues was detected using FITC-labeled F4 / 80 antibody. The cell nuclei were stained with DAPI, and the photos were taken using a laser confocal microscope ( Figure 4 (A).
[0083] For the detection and analysis of Twist2-positive osteoblast precursor cells induced by pericardial calcification in breast cancer mice, Balbc mice were injected with 1×10 5 The experimental lung metastasis model was constructed by using 4T1 breast cancer cells. The healthy mice without pericardial calcification were used as controls. The mouse pericardial tissues were collected. On the one hand, the pathological morphology of normal pericardium and calcified pericardium and the expression of osteoblast precursor cell marker Twist2 in pericardial tissue were analyzed by H&E and immunohistochemistry techniques. Figure 4 On the other hand, transcriptome sequencing was performed on pericardial tissue to analyze the expression of other marker genes Cd44, Pdgfra and Ly6a of Twist2-positive osteoblast precursor cells ( Figure 4 C, D and E). According to the expression of Twist2 gene in cells of multiple organs of mice queried on the BioGPS website (http: / / biogps.org), the ability of Twist2 signal to track osteoblast precursor cells was determined ( Figure 4 Middle F).
[0084] Example 5 Asparagine endopeptidase and integrin are involved in breast cancer-related pericardial calcification and tumor-promoting feedback.
[0085] For the enrichment analysis of asparagine endopeptidase, based on the TCGA database and literature reports, the expression of secretory protein encoding genes related to osteogenesis (93), natural immunity related genes (2021), glucose and energy metabolism related genes (307) and hormone metabolism related genes (194) were analyzed, and the common related genes were found by intersection. The asparagine endopeptidase encoding gene Lgmn was enriched ( Figure 5 In addition, based on the transcriptome sequencing results of the pericardial tissues, the expression of the asparagine endopeptidase encoding gene Lgmn in the pericardial tissues of healthy mice (naive), naturally calcified mice (NPC) and tumor-related pericardial calcification mice (CPC) was compared and analyzed ( Figure 5 (middle B).
[0086] In order to study the effect of osteoblastic differentiation and calcification on tumor promotion, the inventors used MMTV-PyVT mice to mate with Twist-driven Lgmn knockout mice, and finally obtained MMTV-PyVT mice with homozygous knockout or non-knockout of Lgmn in Twist2-positive cells, and compared the incidence of breast cancer in female mice ( Figure 5 C), and the total weight of breast tumor in a single mouse was counted ( Figure 5 (middle D).
[0087] For the analysis of integrin family genes, the inventors used Balbc mice to transplant 4T1 breast cancer cells through the tail vein to construct a breast cancer lung metastasis model. Based on the gene expression determined by mRNA sequencing technology, a heat map was used to plot the expression of integrin family genes in the pericardial tissue of healthy mice (naive) and tumor-associated pericardial calcification mice (CPC) ( Figure 5 In addition, total RNA from pericardial tissue was extracted using Trizol and then reverse transcribed into cDNA. The following primers and fluorescence quantitative PCR were used to determine the transcriptional expression of integrin family genes ( Figure 5 Middle F). For the integrin family genes with high expression, the transcriptome data is searched and displayed in a bar graph ( Figure 5 G to J).
[0088] mActb-F GGCTGTATTCCCCTCCATCG;
[0089] mActb-R CCAGTTGGTAACAATGCCATGT;
[0090] mITGA1-F CCTTCCCTCGGATGTGAGTCA;
[0091] mITGA1-R AAGTTCTCCCCGTATGGTAAGA;
[0092] mITGA2-FTGTCTGGCGTATAATGTTGGC;
[0093] mITGA2-R CTTGTGGGTTCGTAAGCTGCT;
[0094] mITGA3-F CCTCTTCGGCTACTCGGTC;
[0095] mITGA3-R CCGGTTGGTATAGTCATCACCC;
[0096] mITGA4-FGATGCTGTTGTTGTACTTCGGG;
[0097] mITGA4-R ACCACTGAGGCATTAGAGAGC;
[0098] mITGA5-F CTTCTCCGTGGAGTTTTACCG;
[0099] mITGA5-R GCTGTCAAATTGAATGGTGGTG;
[0100] mITGA6-F TGCAGAGGGCGAACAGAAC;
[0101] mITGA6-R GCACACGTCACCACTTTGC;
[0102] mITGA7-F CTGCTGTGGAAGCTGGGATTC;
[0103] mITGA7-R CTCCTCCTTGAACTGCTGTCG;
[0104] mITGA8-F TGGCTGGGATTCCAAGAGGA;
[0105] mITGA8-R GTGCCCCGACCAATATGTCA;
[0106] mITGA9-F AAGTGTCGTGTCCATACCAAC;
[0107] mITGA9-R GGTCTGCTTCGTAGTAGATGTTC;
[0108] mITGA10-F TCCGGTCTTCCAGACTGGG;
[0109] mITGA10-R GAGCTGTGTTATCTTGAAGGGTC;
[0110] mITGA11-F TGCCCCAATGGAAACCAATG;
[0111] mITGA11-R CACTCGTGCGACCAGAGAG;
[0112] mITGAM1-F GGCTCCGGTAGCATCAACAA;
[0113] mITGAM1-RATCTTGGGCTAGGGTTTCTCT;
[0114] mITGAM2-F ATGGACGCTGATGGCAATACC;
[0115] mITGAM2-R TCCCCATTCACGTCTCCCA;
[0116] mITGAD-F GTCCGTGGAGTTGTGATCCTC;
[0117] mITGAD-RGTTAGACCCATGACAGGAAGC;
[0118] mITGAE1-F CCTGTGCAGCATGTAAAAGAATG;
[0119] mITGAE1-R CAAGGATCGGCAGTTCAGATAC;
[0120] mITGAE2-F AAGTGGCTCTTCCATACCCTT;
[0121] mITGAE2-R CTGGCTGGCAAGCAATTTCA;
[0122] mITGAL-F CCAGACTTTTGCTACTGGGAC;
[0123] mITGAL-R GCTTGTTCGGCAGTGATAGAG;
[0124] mITGAV-F CCGTGGACTTCTTCGAGCC;
[0125] mITGAV-R CTGTTGAATCAAACTCAATGGGC;
[0126] mITGA2B-F TTCTTGGGTCCTAGTGCTGTT;
[0127] mITGA2B-R CGCTTCCATGTTTGTCCTTATGA;
[0128] mITGAX-F CTGGATAGCCTTTCTTCTGCTG;
[0129] mITGAX-RGCACACTGTGTCCGAACTCA;
[0130] mITGB1-F ATGCCAAATCTTGCGGAGAAT;
[0131] mITGB1-R TTTGCTGCGATTGGTGACATT;
[0132] mITGB2-F CAGGAATGCACCAAGTACAAAGT;
[0133] mITGB2-R CCTGGTCCAGTGAAGTTCAGC;
[0134] mITGB3-F CCACACGAGGCGTGAACTC;
[0135] mITGB3-R CTTCAGGTTACATCGGGGTGA;
[0136] mITGB4-F GCAGACGAAGTTCCGACAG;
[0137] mITGB4-RGGCCACCTTCAGTTCATGGA;
[0138] mITGB5-FGAAGTGCCACCTCGTGTGAA;
[0139] mITGB5-RGGACCGTGGATTGCCAAAGT;
[0140] mITGB6-F CAACTATCGGCCAACTCATTGA;
[0141] mITGB6-R GCAGTTCTTCATAAGCGGAGAT;
[0142] mITGB7-FACCTGAGCTACTCAATGAAGGA;
[0143] mITGB7-R CACCGTTTTGTCCACGAAGG;
[0144] mITGB8-F AGTGAACACAATAGATGTGGCTC;
[0145] mITGB8-RTTCCTGATCCACCTGAAACAAAA.
[0146] Example 6 Cilengitide TFA inhibits pericardial calcification promoted by asparagine endopeptidase and prolongs survival time.
[0147] For in vitro osteogenic differentiation experiments, osteogenic differentiation induction medium was used, exogenous asparagine endopeptidase (AEP) and integrin inhibitor ATN161 or Cilengitide TFA were added, and osteogenic differentiation induction medium was changed every 3 days. Alizarin red staining was performed on the 9th day ( Figure 6 (A).
[0148] For the induction of pericardial calcification in the breast cancer mouse model, Balbc mice were injected with 1×10 5 An experimental lung metastasis model was constructed by using 4T1 breast cancer cells, treated with Cilengitide TFA, and the solvent treatment was used as a control. Heart images were taken ( Figure 6 Middle B), statistical incidence of pericardial calcification ( Figure 6 C), and pericardial calcification area ( Figure 6 (D). Cardiac ultrasound was used to analyze the improvement of cardiac function by Cilengitide TFA and other drugs, and to evaluate the cardiac diastolic function of mice ( Figure 6 E), H&E and Von Kossa staining were used to detect the pericardial tissue morphology and calcification signals ( Figure 6 (F) Comparison of the effects of Cilengitide TFA and Cilengitide on the survival of mice with pericardial calcification ( Figure 6 Middle G).
[0149] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.
Claims
1. Use of cilengitide and its derivatives in the preparation of drugs for preventing or treating pericardial calcification; characterized in that: The structural formula of Cilengitide is: The cilengitide derivative is cilengitide trifluoroacetate, and its structural formula is:
2. The use according to claim 1, characterized in that: The pericardial calcification includes pericardial calcification caused by natural aging and pericardial calcification induced by tumor diseases.
3. The use according to any one of claims 1-2, characterized in that: The drug for preventing or treating pericardial calcification specifically includes a pharmaceutical composition containing cilengitide and its derivatives and a pharmaceutical carrier.
4. The use according to claim 3, characterized in that: The pharmaceutical composition contains 0.01%-99.99% by mass of cilengitide and its derivatives, and the rest is a pharmaceutical carrier.