Application of LRP1-beta chain 2AAAA oligopeptide in treatment of insulin resistance and diabetes

Abstract

The invention discloses an application of an LRP1-beta chain 2AAAA oligopeptide accelerant in a medicine for preventing and / or treating insulin resistance or diabetes mellitus. The invention finds that the liver overexpression improved LRP1-beta chain 2AAAA oligopeptide can treat insulin resistance and type 2 diabetes induced by high fat diet, and has a better treatment effect than the LRP1-beta chain oligopeptide found by previous researches, thereby providing a new target and a treatment strategy for the treatment of insulin resistance and type 2 diabetes. The invention verifies that the LRP1-beta chain 2AAAA oligopeptide reduces hepatic gluconeogenesis and improves glycometabolism of high-fat induced hepatic insulin resistance mice and db / db diabetic mice by inhibiting expression of glucose-6-phosphatase (G6PC) down-regulated by a FoxO1 / G6PC axis, and can quickly reduce fasting blood sugar level of the mice in a short time, so that glycometabolism of the mice is recovered to be normal, and the LRP1-beta chain 2AAAA oligopeptide can be used for preventing and treating hepatic ischemia. And no obvious adverse reaction or side effect is found.

Description

Technical Field

[0001] In the field of molecular biology and biomedical technology, the present invention relates to LRP1-β chain 2AAAA Application of short peptides in the treatment of insulin resistance and diabetes. Background Art

[0002] Insulin is a protein hormone secreted by pancreatic β cells. Its main physiological effects are: promoting the uptake and utilization of glucose by tissue cells, increasing glycogen synthesis, inhibiting hepatic gluconeogenesis, and lowering blood sugar levels; promoting fatty acid synthesis and fat storage, reducing fat decomposition; promoting the entry of amino acids into cells and protein synthesis. Insulin is the only hormone in the body that can lower blood sugar, and it is also the only hormone that promotes the synthesis of glycogen, fat, and protein at the same time, maintaining the stability of postprandial blood sugar levels. Long-term excessive intake of high-carbohydrate and high-fat foods will lead to reduced sensitivity of insulin target tissues to it, resulting in "insulin resistance" (IR) and abnormally high blood sugar levels. Insulin resistance is considered to be the pathophysiological basis for the occurrence and development of many metabolic diseases, including type 2 diabetes. At present, there is still a lack of effective means for the clinical treatment of type 2 diabetes. Drug treatment is prone to adverse reactions and drug tolerance problems. Non-drug treatments include diet conditioning, exercise, weight control, and blood lipid control, but their long-term effectiveness and safety have yet to be evaluated.

[0003] Adeno-associated virus (AAV) belongs to the parvoviridae family, a single-stranded DNA virus. AAV virus particles have no envelope and are regular dodecahedrons with a diameter of about 20 nm. In 1965, AAV was discovered from adenovirus preparations and got its name from this. AAV is the simplest type of single-stranded DNA defective virus discovered so far. It usually requires the assistance of helper viruses (such as adenovirus, herpes simplex virus, etc.) to produce virulent infection and generate progeny AAV. Recombinant adeno-associated virus vectors (rAAV) were further modified on the basis of non-pathogenic wild-type AAV. They have the characteristics of high safety, low immunogenicity, wide host range, and the ability to mediate long-term stable expression of genes in animals. They are an important viral tool for carrying exogenous genes and one of the important gene therapy vectors. They have been widely used in gene expression, gene manipulation and gene therapy at the animal level. The AAV genome is combined with different capsid proteins to produce hybrid viral vectors with different tissue infection tropisms, thereby showing a certain organ targeting specificity. Among them, AAV 8. Targeted to the liver. rAAV has been widely used in research fields such as neurology, metabolism, and gene therapy, mainly for in vivo research, and is regarded as one of the most promising gene research and gene therapy vectors. According to statistics, there are currently more than 250 AAV gene therapy clinical projects being carried out worldwide. To date, the US FDA has approved two AAV gene therapy methods: the first is Luxturna, which was approved in 2017 for the treatment of Leber congenital amaurosis, an inherited retinal disease; the second is Zolgensma, which was approved in 2019 for the treatment of spinal muscular atrophy in children. In the foreseeable future, with the rapid development of rAAV vectors and gene therapy, more and more AAV-based gene therapies will enter clinical trials and be widely used.

[0004] Low-density lipoprotein receptor-related protein 1 (LRP1) is a cell surface glycoprotein that is processed from a 600kDa precursor protein into a 515kDa α chain and an 85kDa β chain, which remain associated through non-covalent interactions. LRP1 is involved in many pathophysiological processes including lipid metabolism, maintaining the integrity of blood vessels and the blood-brain barrier, and cell differentiation processes. In addition, LRP1 is also an endocytic receptor that can bind and internalize multiple ligands with different structures and functions, including activated 2-macroglobulin, Pseudomonas exotoxin A, lipoprotein lipase, apolipoprotein E-enriched lipoprotein, urokinase, etc. It has been reported that LRP1 can promote intracellular signal transduction and mediate the proliferation, migration and differentiation of different types of cells downstream. The β chain of LRP1 has two NPxY motifs. The distal NPxY motif can bind to different adaptor proteins and thus affect downstream signal transduction, which is an important molecular mechanism for LRP1 to mediate various physiological effects of cells. LRP1-β chain 2AAAA The short peptide is a novel short peptide constructed by mutating all four amino acids (N-asparagine; P-proline; V-valine; Y-tyrosine) of the distal NPxY motif of the β-chain short peptide of LRP1 to A-alanine (AAAA).

[0005] The prior art does not include LRP1-β chain 2AAAA There are reports on the application of short peptides in improving insulin resistance and diabetes. However, the commonly used diabetes treatment drugs currently have problems such as drug tolerance and side effects, or the long-term effectiveness and safety of non-drug treatment measures need to be evaluated. Further research on the pathogenesis of insulin resistance and diabetes and actively searching for new therapeutic targets are of great significance to the clinical treatment outcome and prognosis improvement of patients with insulin resistance and diabetes. Summary of the invention

[0006] The inventors constructed a liver-specific overexpression mouse wild-type LRP1-β chain 2AAAA Adeno-associated virus expressing a short peptide was used to study the overexpression of LRP1-β chain in the liver 2AAAA The effect of short peptides on glucose metabolism in high-fat-induced insulin resistance mice and db / db diabetic mice further confirmed that LRP1-β chain 2AAAA The short peptide improved glucose metabolism disorders in diabetic mice by significantly inhibiting hepatic gluconeogenesis. In addition, the LRP1-β chain was compared 2AAAA The difference between the short peptide and the previously developed LRP1-β chain short peptide in improving the glucose metabolism of mice. Based on this, the present invention provides the following technical solutions:

[0007] LRP1-β chain 2AAAA Short peptide or LRP1-β chain 2AAAA Application of short peptide promoter in preparing medicine for preventing and / or treating insulin resistance or diabetes.

[0008] In the above-mentioned application technology solution, the insulin resistance is hepatic insulin resistance, and the diabetes is type 2 diabetes.

[0009] In the above-mentioned application technology solution, the LRP1-β chain 2AAAA The amino acid sequence of the short peptide is shown in SEQ ID NO.6.

[0010] In the above-mentioned application technology solution, the LRP1-β chain 2AAAA Short peptide promoter for specific overexpression of LRP1-β chain 2AAAA Viral overexpression vectors for short peptides.

[0011] In the above-mentioned application technology solution, the LRP1-β chain 2AAAA The short peptide promoter is an adeno-associated virus (AAV) vector.

[0012] In the above-mentioned application technology scheme, the adeno-associated virus vector is targeted to overexpress LRP1-β chain in the liver 2AAAA Recombinant adeno-associated virus expressing short peptides.

[0013] Preferably, the AAV vector is AAV8 and the AAV vector is a recombinant AAV (rAAV) vector.

[0014] In the above-mentioned application technology scheme, the recombinant adeno-associated virus vector is a signal peptide coding sequence as shown in SEQ ID NO.5 and a LRP1-β chain as shown in SEQ ID NO.6. 2AAAA The coding gene sequence of the short peptide is inserted into the AAV8 virus. Among them, the signal peptide plays a role in the LRP1-β chain 2AAAA When the short peptide is overexpressed, it guides the short peptide to localize on the cell membrane.

[0015] In the above-mentioned application technology scheme, the recombinant adeno-associated virus vector is obtained by inserting the nucleotide sequence shown in SEQ ID NO.4 into the AAV8 virus.

[0016] In the above-mentioned application technology solution, the LRP1-β chain 2AAAA The gene coding sequence of the short peptide is based on the application of LRP1-β chain short peptide in the treatment of insulin resistance and diabetes (CN 116672435 A) published by the inventor in the previous patent. The distal NPxY motif coding sequence of the LRP1-β chain short peptide is mutated into an AAAA coding sequence to obtain a new LRP1-β chain with better functional activity. 2AAAA Short peptides.

[0017] In the above-mentioned application technology scheme, LRP1-β chain 2AAAAThe short peptide downregulates the expression of the hepatocyte gluconeogenesis gene glucose-6-phosphatase (G6PC) by inhibiting the FoxO1 / G6PC axis, thereby reducing hepatic gluconeogenesis and improving glucose metabolism in patients with insulin resistance and / or diabetes.

[0018] In the above-mentioned application technology scheme, LRP1-β chain 2AAAA Short peptide blocks the inhibitory effect of palmitic acid on insulin signaling in hepatocytes, LRP1-β chain 2AAAA Short peptide reverses the inhibitory effect of palmitic acid on phosphorylation and acetylation of upstream nuclear transcription factor FoxO1 of hepatocyte gluconeogenesis-related genes, LRP1-β chain 2AAAA Short peptide reversed the upregulation of G6PC expression by palmitic acid.

[0019] In the above-mentioned application technology scheme, LRP1-β chain 2AAAA The short peptide has better effects than the LRP1-β chain short peptide disclosed earlier by the inventor in blocking palmitic acid from inhibiting insulin signal transduction, reversing palmitic acid from inhibiting phosphorylation and acetylation of upstream nuclear transcription factor FoxO1 of hepatocyte gluconeogenesis-related genes, and reversing palmitic acid from upregulating the expression of gluconeogenesis gene G6PC, so as to improve insulin resistance and diabetes.

[0020] The present invention constructs rAAV8-LRP1β chain targeting the liver 2AAAA Adeno-associated virus overexpressing LRP1-β chain in the liver 2AAAA The effects of short peptides on glucose metabolism in high-fat-induced insulin resistance mice and db / db diabetes mice have been confirmed by experiments:

[0021] 1. Overexpression of LRP1-β chain in liver 2AAAA The short peptide improved glucose metabolism in high-fat-induced insulin-resistant mice, and its effect was superior to that of LRP1-β chain short peptide.

[0022] 2. Overexpression of LRP1-β chain in liver 2AAAA The short peptide improved glucose metabolism in db / db diabetic mice, and its effect was superior to that of LRP1-β chain short peptide.

[0023] 3. Overexpression of LRP1-β chain in liver 2AAAA The short peptide enhanced insulin signal transduction in the liver of high-fat-induced insulin-resistant mice and db / db mice, and its effect was superior to that of LRP1-β chain short peptide.

[0024] 4. Overexpression of LRP1-β chain 2AAAA The short peptide blocked the inhibitory effect of palmitic acid on insulin signal transduction in hepatocytes, and its effect was superior to that of LRP1-β chain short peptide.

[0025] 5. Overexpression of LRP1-β chain 2AAAAThe short peptide reversed the inhibitory effect of palmitic acid on the phosphorylation and acetylation of the upstream nuclear transcription factor FoxO1 of hepatocyte gluconeogenesis-related genes, and its effect was superior to that of the LRP1-β chain short peptide.

[0026] 6. Overexpression of LRP1-β chain 2AAAA The short peptide inhibited the up-regulation of the expression of the gluconeogenesis gene glucose-6-phosphate (G6PC) in hepatocytes by palmitic acid, and its effect was superior to that of the LRP1-β chain short peptide.

[0027] The beneficial effects of the present invention are: the present invention is the first to discover that the liver overexpresses LRP1-β chain 2AAAA The short peptide can be used to treat high-fat-induced hepatic insulin resistance and type 2 diabetes, providing a new target and therapeutic strategy for the treatment of insulin resistance and type 2 diabetes. 2AAAA The short peptide down-regulates G6PC expression by inhibiting the FoxO1 / G6PC axis, thereby reducing hepatic gluconeogenesis and improving glucose metabolism in high-fat diet-induced hepatic insulin-resistant mice and db / db diabetic mice. It can quickly reduce the blood glucose level of mice in a short period of time, improve the glucose metabolism of mice and restore it to normal, and no obvious adverse reactions or side effects were found. 2AAAA Short peptides have significant advantages in the treatment of insulin resistance and diabetes: First, the LRP1-β chain 2AAAA The short peptide is derived from the NPxY motif mutation of the β-chain distal end of the organism's own protein LRP1, which is consistent with the structure and immunogenicity of the organism's own protein fragment, reduces the possibility of physiological rejection and allergic reactions, and has good tolerance; secondly, the liver overexpresses LRP1-β chain 2AAAA No obvious abnormal side effects were observed in mice given the short peptide; the third LRP1-β chain 2AAAA The liver overexpression effect of short peptides is long-lasting and has good results.

[0028] The present invention develops a method for targeting the liver to overexpress LRP1-β chain. 2AAAA The adeno-associated virus of a short peptide was used to confirm that it has a significant improvement effect on insulin resistance and diabetes using diabetic model mice. Based on this, molecular biological methods can be used to increase the LRP1-β chain 2AAAA Expression of short peptides in liver cells or preparation of LRP1-β chain by genetic engineering 2AAAA The short peptide is then used to prepare therapeutic drugs for human type 2 diabetes-related diseases. The research of the present invention provides new ideas for the clinical treatment of insulin resistance and diabetes, and improves the prognosis of diabetic patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 This is the pAAV-TBG-MCS-3xFLAG plasmid map.

[0030] Figure 2 The recombinant plasmid pAAV-TBG-mLRP1β chain 2AAAA -3xFLAG-WPRE map.

[0031] Figure 3 pAAV-TBG-mLRP1β chain 2AAAA -3xFLAG-WPRE plasmid restriction enzyme digestion (A) and sequencing identification (B) results.

[0032] Figure 4 Comparison of blood glucose concentrations in three groups of AAV-injected high-fat-fed mice after 6 hours (A) and 18 hours of fasting (B).

[0033] Figure 5 Comparison of glucose tolerance (A) and area under the curve (B) in three groups of AAV-injected high-fat-fed mice.

[0034] Figure 6 Insulin sensitivity test (A) and area under the curve comparison (B) of three groups of AAV-injected high-fat-fed mice.

[0035] Figure 7 Pyruvate tolerance test (A) and comparison of the area under the curve (B) of three groups of AAV-injected high-fat-fed mice.

[0036] Figure 8 Comparison of hepatic insulin signaling in three groups of AAV-injected high-fat-fed mice.

[0037] Fig. 9 This is a comparison of the expression levels of FoxO1, G6PC and PCK1 proteins in the liver of three groups of AAV-injected high-fat-fed mice.

[0038] Fig.10 The β-chain and β-chain of LRP1 in the liver of three groups of AAV-injected high-fat-fed mice 2AAAA Protein expression level detection.

[0039] Fig.11 Comparison of blood glucose levels in three groups of AAV-injected db / db mice after 6 hours (A) and 18 hours of fasting (B).

[0040] Fig.12 Comparison of glucose tolerance test (A) and area under the curve (B) of three groups of AAV-injected db / db mice.

[0041] Fig.13 Comparison of insulin sensitivity test (A) and area under the curve (B) in three groups of AAV-injected db / db mice.

[0042] Fig.14Comparison of pyruvate tolerance test (A) and area under the curve (B) in three groups of AAV-injected db / db mice.

[0043] Fig.15 Comparison of insulin signaling in the liver of three groups of AAV-injected db / db mice.

[0044] Fig.16 Comparison of FoxO1, G6PC and PCK1 expression levels in the liver of three groups of AAV-injected db / db mice.

[0045] Fig.17 The recombinant plasmid pcDNA3.1(+)-hLRP1-β chain 2AAAA -3xFlag map.

[0046] Fig.18 The recombinant plasmid pcDNA3.1(+)-hLRP1-β chain 2AAAA -3xFlag sequencing results.

[0047] Fig.19 Human LRP1-β chain 2AAAA The experimental results of expression of short peptide-Flag and LRP1-β chain short peptide fusion proteins in MIHA cells.

[0048] Fig. 20 Overexpression of human LRP1-β chain 2AAAA Effects of short peptides and LRP1-β chain short peptide fusion protein on its insulin signal transduction.

[0049] Fig.21 Overexpression of human LRP1-β chain 2AAAA The experimental results of short peptides and LRP1-β chain short peptides reversing the down-regulation of FoxO1 acetylation and phosphorylation levels by palmitic acid.

[0050] Fig. 22 Overexpression of human LRP1-β chain 2AAAA Experimental results of short peptides and LRP1-β chain short peptides blocking the upregulation of G6PC expression in MIHA hepatocytes induced by palmitic acid. DETAILED DESCRIPTION

[0051] The present invention will be further described below in conjunction with embodiments, but the present invention is not limited thereto.

[0052] The experimental methods in the following examples are all conventional methods unless otherwise specified; the chemical and biological reagents used are all conventional reagents in the art and can be commercially obtained unless otherwise specified.

[0053] Main reagent sources:

[0054] NheI, BamHI, MluI and EcoRI restriction enzymes were provided by New England Biolabs.

[0055] rAAV2 / 8-mLRP1-β chain 2AAAA The short peptide adeno-associated virus, rAAV2 / 8-GFP control adeno-associated virus and rAAV2 / 8-mLRP1-β chain short peptide adenovirus were all prepared by Heyuan Biotechnology (Shanghai) Co., Ltd. The adeno-associated virus packaging uses the pAAV-TBG-MCS-3x FLAG expression vector as a shuttle plasmid, which contains the hepatocyte-specific TBG promoter and 3xFlag tag, which is responsible for encoding the target gene to be expressed and the two terminal inverted repeat sequences ITR, which play a decisive role in the replication and packaging of the virus (its plasmid map is shown in Figure 1 The auxiliary plasmid pAAV-RC plasmid carries genes encoding viral capsid proteins and involved in viral replication, and the pHelper plasmid carries adenovirus genes required for AAV replication.

[0056] pcDNA3.1(+)-3×Flag plasmid (#182494) was provided by Addgene.

[0057] Low-fat diet (D12102C) and high-fat diet (D12492) were purchased from Research Diets.

[0058] The source information of the antibodies used in the examples is as follows:

[0059] All data in the examples were expressed as mean ± standard error (mean ± SEM), and Graphpad Prism 8.0 software was used to plot and perform statistical analysis. The differences between the two groups were tested by independent sample t-test, and the differences between multiple groups were tested by two-way analysis of variance. The differences were considered statistically significant when P value < 0.05 (*, P < 0.05; **, P < 0.01).

[0060] Example 1. Preparation of AAV8 adeno-associated virus.

[0061] Preparation of mouse LRP1-β chain overexpression 2AAAA - rAAV2 / 8-mLRP1-β chain of short peptide 2AAAA -adeno-associated virus, and rAAV2 / 8-mLRP1-β chain and rAAV2 / 8-GFP adeno-associated viruses of mouse LRP1-β chain short peptide were prepared as controls.

[0062] (1) Synthesize the target gene fragment.

[0063] First, a synthetic sequence containing NheI restriction site, Kozak sequence, signal peptide coding sequence, multi-site linker, mouse LRP1-β chain, etc., was prepared. 2AAAA The gene fragment of the short peptide cDNA coding sequence and the BamHI restriction site, the synthetic gene fragment sequence is shown as follows (SEQ ID NO.1):

[0064]

[0065] In the above SEQ ID NO.1 sequence, the bold bases at the 5' and 3' ends are restriction sites, the bold italic letters near the 5' end are the signal peptide coding sequence (SEQ ID NO.2, which has a start codon atg at the 5' end), and the underlined part is the mouse LRP1-β chain 2AAAA Short peptide cDNA coding sequence.

[0066] The mouse LRP1-β chain in the SEQ ID NO.1 sequence used for synthesis in this example 2AAAA The short peptide cDNA coding sequence is selected from the partial extracellular fragment + transmembrane segment + intracellular segment of the mouse LRP1-β chain short peptide, and its partial gene sequence ACCAACTTCACCAACCCAGTGTATGCCACGCTC The nucleotide sequence of the selected sequence corresponds to PubMed gene number NM_008512.2: 13047-14096, and the amino acid sequence encoded after the mutation is mutated from the distal NPVY to AAAA, and the sequence is shown in SEQ ID NO.3.

[0067] (2) Double digestion of target gene fragment

[0068] The synthesized gene fragment was double-digested with NheI and BamHI endonucleases, and the digestion reaction system was:

[0069] Incubate in a 37°C water bath for more than 2 hours. Perform agarose gel electrophoresis on the digestion products and use a gel recovery kit (TaKaRaMin iBES TAgarose GelDNAExtraction KitVer.3.0) to recover the digestion products.

[0070] (3) Preparation of linearized expression vector

[0071] The pAAV-TBG-MCS-3x FLAG expression vector was digested with NheI and BamHI endonucleases. The digestion reaction system was as follows:

[0072] Incubate in a 37°C water bath for more than 2 hours. Perform agarose gel electrophoresis on the digestion product to detect the digestion effect, and use a gel recovery kit (TaKaRaMiniBEST Agarose Gel DNAExtraction KitVer.3.0) to recover the target vector band.

[0073] (4) Carrier connection.

[0074] Mouse LRP1-β chain 2AAAA The short peptide cDNA fragment was constructed into a linearized expression vector. The mouse LRP1-β chain obtained in step (2) 2AAAA The short peptide fragment cDNA fragment and the linearized vector obtained in step (3) were added to a centrifuge tube at a molar ratio of 3:1 for ligation reaction. The reaction system was as follows:

[0075] After mixing, connect at 16°C overnight to obtain the recombinant plasmid pAAV-TBG-mLRP1-β chain 2AAAA -3xFLAG-WPRE (plasmid map as Figure 2 Take 1 μl of the reaction liquid and transform it into competent cells.

[0076] (5) Competent cell transformation

[0077] 1) Take out competent cells (DH5α) from -80℃ refrigerator and place on ice for 5 minutes to thaw naturally;

[0078] 2) Slowly transfer the recombinant plasmid pAAV-TBG-mLRP1-β chain 2AAAA - Add 1 μl of 3xFLAG-WPRE (concentration>10 ng / μl) to 50 μl of competent cells, mix gently, and place on ice for 20 min;

[0079] 3) Place the sample in a 42°C water bath for 45 seconds and immediately transfer to ice for 2 minutes;

[0080] 4) Add 700 μl of LB medium without antibiotics into the clean bench, culture in a constant temperature oscillator at 37°C and 220 rpm for 60 min, and centrifuge at 5000 rpm for 1 min at room temperature;

[0081] 5) Discard 600 μl of the supernatant in the clean bench, and after the remaining 100 μl of the resuspended precipitate, use a coating rod to evenly apply it on the LB solid culture plate containing ampicillin under the sterilization effect of an alcohol lamp, invert the plate and culture it in a 37°C incubator overnight (14-16 hours);

[0082] 6) Pick a single clone plaque and add 4 ml of LB medium containing ampicillin and shake culture in a 37°C incubator for 12-14 hours. Take a small amount of bacterial solution and send it to a sequencing company for sequencing verification;

[0083] 7) The remaining bacterial solution is used to extract plasmid using a plasmid extraction kit;

[0084] 8) The extracted plasmid was identified by double digestion with BamHI / MluI and gel electrophoresis. Figure 3 As shown in A;

[0085] The mark 1 in the figure is the electrophoresis of the plasmid without enzyme digestion, and the mark 2 in the figure is the electrophoresis of the product after BamHI / MluI double digestion of the plasmid. It can be seen that the digestion products are two fragments of 4148bp and 1854bp. The sequence of the plasmid was confirmed by sequencing ( Figure 3 B).

[0086] (6) Adeno-associated virus packaging

[0087] 1) Extract the constructed viral vector pHelper and pAAV-RC plasmid extraction kit.

[0088] 2) AAV-293 cell culture and transfection.

[0089] a) Take out the AAV-293 cell cryopreservation tube from the liquid nitrogen tank, and immediately gently shake the cells in a 37°C water bath to revive and culture the cells for passage;

[0090] b) Inoculate AAV-293 cells in a 10 cm dish and perform transfection when the cell density reaches 70-80%;

[0091] c) 1 h before transfection, remove the cell culture plate and replace with 10 ml of Opti-MEM medium;

[0092] d) Dissolve 32 μg of the viral vector plasmid to be transfected (pHelper: pAAV-RC: shuttle plasmid = 1:1:1) in Opti-MEM medium to a total volume of 500 μl, mix gently, and let stand for 5 minutes;

[0093] e) Dissolve Obio transfection reagent in Opti-DMEM medium to a total volume of 500 μl, mix gently and let stand for 5 minutes;

[0094] f) Add the Obio transfection reagent dilution dropwise to the plasmid dilution, gently mix while adding, and leave at room temperature for 20 minutes to allow the DNA and Obio transfection reagent to fully combine to form a stable transfection complex;

[0095] g) Take out the cell dish and add the prepared DNA transfection reagent complex into the cell culture plate;

[0096] h) After 6 hours, the culture medium was aspirated, the cells were washed once with PBS, and 10 ml of fresh complete culture medium was added for culture.

[0097] 3) Virus harvesting and purification

[0098] a) 60 hours after transfection, the cells were scraped and collected into a centrifuge tube;

[0099] b) Centrifuge at 1500 g for 5 min at 4°C. Resuspend the cell pellet in 7 ml of 10 mM Tris-HCl buffer;

[0100] c) Take the cell lysate and freeze-thaw it repeatedly in a dry ice / ethanol bath and a 37°C water bath for 8 times;

[0101] d) Use 10mM Tris-HCl to adjust the volume of the lysate to 21ml;

[0102] e) Ultrasonication for 7 minutes; add 2 ml DNase I (3 mg / ml) and incubate at 37°C for 30 minutes; ultrasonication again for 7 minutes;

[0103] f) Add 2.5 ml of 10% sodium deoxycholate and 2.1 ml of 0.25% trypsin-EDTA, mix well, incubate at 37°C for 30 min, and place on ice for 20 min;

[0104] g) Add 16.9 g CsCl. Mix well and incubate at 37°C for 20 min. Shake in between until the CsCl is completely dissolved.

[0105] h) Centrifuge at 3000 g for 30 min at 4°C and transfer the cell lysate to an ultracentrifuge tube (about 5 ml / tube);

[0106] i) Centrifuge at 53,000 rpm for 30 h at 4°C and collect the viral layer using a homemade needle;

[0107] j) Dialyze at 4°C, changing the dialysate every 12-16 hours, using 4 L of buffer each time.

[0108] At this point, rAAV2 / 8-mLRP1-β chain was obtained 2AAAA , rAAV2 / 8-mLRP1-β and rAAV2 / 8-GFP adeno-associated viruses.

[0109] Example 2: HFD mouse experiment

[0110] Twenty-four 8-week-old male C57BL / 6J mice were selected and fed with a high-fat diet (HFD) for 16 weeks to induce an insulin resistance model. They were randomly divided into AAV8-control, AAV8-β-chain short peptide, and AAV8-LRP1β-chain 2AAAAThere were three groups of short peptides, 8 mice in each group. The mice were injected with rAAV2 / 8-GFP, rAAV2 / 8-mLRP1-β chain and rAAV2 / 8-mLRP1-β chain through the tail vein at a dose of 2×1011vg / mouse. 2AAAA Adeno-associated virus, continue to be fed with HFD until the end of the experiment. All mice were housed in temperature and humidity controlled ventilated cages, at 22 ° C room temperature, 12 h light / dark cycle and ad libitum food (drinking water). All animal experimental procedures were approved by the Ethics Review Committee of Chongqing Medical University, and all animal experimental operations were in accordance with the animal ethics protection agreement.

[0111] Three weeks after virus injection, blood was collected from the tail of the mice and the blood glucose level was measured by blood glucose meter after fasting for 6h and 18h. Figure 4 A shows the blood glucose level of mice fasting for 6 hours 3 weeks after virus injection, AAV8-β chain 2AAAA The short peptide group and AAV8-β chain short peptide group were significantly lower than the AAV8-control group (**P<0.01, *★*P<0.001, compared with the control group), and the AAV8-β chain 2AAAA The short peptide group had a more significant blood sugar lowering effect than the AAV8-β chain short peptide (#P<0.05, compared with the AAV8-β chain short peptide group); Figure 4 As shown in B, blood glucose levels of mice fasting for 18 hours 3 weeks after virus injection, AAV8-β chain 2AAAA The short peptide group and the AAV8-β chain short peptide group were also significantly lower than the AAV8-control group (**P<0.01, *★*P<0.001, compared with the control group), and the AAV8-β chain 2AAAA The blood glucose level in the short peptide group was more significantly lower than that in the AAV8-β chain short peptide group (#P<0.05, compared with the AAV8-β chain short peptide group).

[0112] Six weeks after the mice were injected with the virus, the glucose tolerance of the three groups of mice was compared. After fasting overnight, the mice were intraperitoneally injected with glucose solution at a dose of 1g glucose / kg body weight. Blood was collected from the tail of the mice at 0, 30, 60, 90, and 120 minutes after the injection and the blood glucose level of the mice was tested using a blood glucose meter. The results are shown in the figure below. Figure 5 As shown: Figure 5 A shows the comparison of the glucose tolerance test among the three groups of mice. It can be seen that AAV8-β chain 2AAAA The blood glucose levels of mice in the short peptide group and AAV8-β chain short peptide group were significantly lower than those in the AAV8-control group (*P<0.05, **P<0.01, *★*P<0.001, compared with the AAV8-control group at the same time point); 2AAAAThe blood glucose level in the short peptide group was lower than that in the AAV8-β chain short peptide group (#P<0.05, compared with the AAV8-β chain short peptide group at the same time point). Figure 5 B Comparison of the area under the glucose tolerance curve of the three groups of mice, AAV8-β chain 2AAAA The number of mice in the short peptide group and AAV8-β chain short peptide group was significantly lower than that in the AAV8-control group (*P<0.05, **P<0.01, compared with the AAV8-control group), and the number of mice in the AAV8-β chain 2AAAA The area under the curve of the short peptide group was smaller than that of the AAV8-β chain short peptide group (#P<0.05, compared with the AAV8-β chain short peptide group). The results showed that the liver overexpressed LRP1β chain 2AAAA After the administration of short peptides and LRP1β-chain short peptides, glucose tolerance of HFD-fed mice was significantly improved, and the overexpression of LRP1β-chain 2AAAA Short peptides have a more obvious effect on improving glucose tolerance.

[0113] Seven weeks after the mice were injected with the virus, the insulin sensitivity of the two groups of mice was compared. After fasting for 5 hours, the mice were intraperitoneally injected with insulin at a dose of 0.75 IU / kg body weight. Blood was collected from the tail of the mice at 0, 30, 60, 90, and 120 minutes after the injection, and the blood glucose level of the mice was tested by a blood glucose meter. The blood glucose value at time 0 was 100%, and the blood glucose values ​​at other time points were compared with it to obtain the relative glucose concentration value. The results are shown in Figure 6 As shown: Figure 6 A shows the comparison of insulin sensitivity among the three groups of mice. It can be seen that 30, 60, 90, and 120 minutes after insulin injection, AAV8-β chain 2AAAA The blood glucose levels of mice in the short peptide group and AAV8-β chain short peptide group were significantly lower than those in the AAV8-control group (**P<0.01, *★*P<0.001, compared with the AAV8-control group at the same time point); 2AAAA The blood glucose level in the short peptide group was lower than that in the AAV8-β chain short peptide group (#P<0.05, compared with the AAV8-β chain short peptide group at the same time point); Figure 6 B Comparison of the area under the insulin sensitivity curve between the two groups of mice, AAV8-β chain 2AAAA The short peptide group and the AAV8-β chain short peptide group were significantly lower than the AAV8-control group (*★*P<0.001, *★★*P<0.0001, compared with the AAV8-control group), and the AAV8-β chain 2AAAA The area under the curve of the short peptide group was smaller than that of the AAV8-β chain short peptide group (##P<0.01, compared with the AAV8-β chain short peptide group). The results showed that the liver overexpressed the β chain of LRP1 2AAAA After exposure to short peptides and LRP1 β-chain short peptides, the insulin sensitivity of mice was significantly enhanced. 2AAAAShort peptides had a better effect on increasing insulin sensitivity in mice.

[0114] Eight weeks after the mice were injected with the virus, the pyruvate tolerance of the three groups of mice was compared. After fasting overnight, the mice were intraperitoneally injected with sodium pyruvate solution at a dose of 1g sodium pyruvate / kg body weight. Blood was collected from the tail of the mice and the blood glucose level of the mice was tested using a blood glucose meter at 0, 30, 60, 90, and 120 minutes after the injection. The results are shown in the figure. Figure 7 As shown: Figure 7 A shows the AAV8-β chain at 0, 30, 60, 90, and 120 min after injection. 2AAAA The blood glucose levels of mice in the short peptide group and AAV8-β chain short peptide group were significantly lower than those in the AAV8-control group (**P<0.01, *★*P<0.001 compared with the AAV8-control group at the same time point). 2AAAA The blood glucose level of mice in the short peptide group decreased more significantly than that in the AAV8-β chain short peptide group (#P<0.05, ##P<0.01, compared with the AAV8-β chain short peptide group at the same time point); Figure 7 B Comparison of the area under the pyruvate tolerance curve between the two groups of mice, AAV8-β chain 2AAAA The number of mice in the short peptide and AAV8-β chain short peptide groups was significantly lower than that in the AAV8-control group (**P<0.01, *★*P<0.001, compared with the AAV8-control group). 2AAAA The area under the curve of the short peptide group was lower than that of the AAV8-β chain short peptide group (#P<0.05, compared with the AAV8-β chain short peptide group). The above results show that the liver overexpresses AAV8-β chain 2AAAA After the short peptide was added, the pyruvate tolerance of mice was significantly improved and the level of gluconeogenesis in the liver was inhibited. 2AAAA The short peptide had a better effect on pyruvate tolerance in mice than the AAV8-β chain short peptide.

[0115] Ten weeks after the mice were injected with the virus, 5 mice were randomly selected from each group and injected with saline after overnight fasting under anesthesia, and the other 5 mice were injected with insulin at 1I / kg body weight. The mice were killed 30 minutes later, and the liver tissue was taken to extract total protein and detect insulin signal transduction. The Western blot (WB) method was used to compare the expression of the key enzymes of gluconeogenesis G6PC and PCK1 in the liver of the three groups of fasting mice, as well as the total protein, phosphorylated FoxO1 and acetylated FoxO1 levels of the regulatory factor of gluconeogenesis genes; Figure 8 A shows the comparison of phosphorylated Akt and phosphorylated GSK3β levels in mouse liver tissue under insulin stimulation. 2AAAA The short peptide and AAV8-β chain short peptide group were significantly higher than the AAV8-control group, and the AAV8-β chain 2AAAAThe short peptide group was significantly higher than the AAV8-β chain short peptide group. This result shows that the liver overexpresses AAV8-β chain 2AAAA The short peptide and AAV8-β chain short peptide enhanced the insulin signaling in the mouse liver, and the AAV8-β chain 2AAAA The short peptide can enhance the transmission of hepatic insulin signaling more than the AAV8-β chain short peptide. Figure 8 B, the display is Figure 8 The experiment shown in A was repeated three times and the results were subjected to statistical analysis (**P<0.01, *★*P<0.001, #P<0.05).

[0116] Fig. 9 Α showed that under fasting conditions, compared with the liver tissue of AAV8-control mice, although AAV8-β chain 2AAAA The total protein expression level of FoxO1 in the liver tissue of mice in the short peptide and AAV8-β chain short peptide groups remained unchanged, but the levels of phosphorylated FoxO1 and acetylated FoxO1 in both groups increased significantly, and the AAV8-β chain 2AAAA The increase of phosphorylated FoxO1 and acetylated FoxO1 in the short peptide group was more obvious than that in the AAV8-β chain short peptide group. In addition, although the PCK1 protein levels in the three groups were consistent, the AAV8-β chain 2AAAA The level of G6PC, another key enzyme in hepatic gluconeogenesis, was significantly reduced in the short peptide and AAV8-β chain short peptide groups, and the AAV8-β chain 2AAAA The G6PC protein level decreased more significantly in the short peptide group than in the AAV8-β chain short peptide group. These results indicate that the liver overexpresses LRP1β chain 2AAAA After the addition of a short peptide and a β-chain short peptide of LRP1, the phosphorylation and acetylation modification levels of FoxO1 in hepatocytes were enhanced, which promoted the transfer of FoxO1 from the nucleus to the cytoplasm of hepatocytes, reduced the transcriptional activity, and led to the downregulation of the expression of downstream G6PC, thereby reducing the level of hepatic gluconeogenesis and promoting the reduction of blood glucose levels in HFD-fed mice. 2AAAA The short peptide has a more significant effect on reducing G6PC than the previously reported AAV8-β chain short peptide, and thus has a more significant effect on lowering blood sugar in mice. Fig. 9 B, the display is Fig. 9 The results obtained from the experiment shown in A were subjected to statistical analysis (*P<0.05, **P<0.01, *★*P<0.001, #P<0.05, ns means no statistical difference).

[0117] After the experiment, the mice were killed under anesthesia, and liver tissue homogenate was immediately extracted. The Flag-labeled LRP1β chain was detected by WB method and anti-Flag antibody. 2AAAA Short peptides and LRP1-β chain short peptides in liver tissue ( Fig.10 The results showed that LRP1-β chain2AAAA The short peptide-Flag fusion protein and LRP1-β chain short peptide-Flag fusion protein were highly expressed in the liver tissue of mice in the AAV8-β chain short peptide group. 2AAAA Short peptides and LRP1-β chain short peptides can maintain stable high-level expression for a long time.

[0118] Example 3, db / db mouse experiment

[0119] Eighteen 6-week-old male db / db mice (type 2 diabetes mouse model) were randomly divided into AAV8-control group and AAV8-β chain short peptide and AAV8-β chain 2AAAA There were three short peptide groups, with 6 mice in each group. The mice were injected with rAAV2 / 8-GFP, rAAV2 / 8-mLRP1-β and rAAV2 / 8-mLRP1-β via the tail vein at a dose of 2x1011vg / mouse. 2AAAA The mice were fed with a low-fat diet (NCD) and blood was collected from the tail of the mice 3 weeks after virus injection and the blood glucose level was measured by blood glucose meter after fasting for 6h and 18h. Fig.11 As shown, AAV8-β chain 2AAAA The blood glucose levels of mice in the short peptide group and AAV8-β chain short peptide group after fasting for 6h (A) and 18h ​​(B) were significantly reduced (*P<0.05, **P<0.01, *★*P<0.001, compared with the AAV8-control group). 2AAAA The short peptide group had lower fasting blood glucose than the AAV8-β chain short peptide group (#P<0.05, ##P<0.01, compared with the AAV8-β chain short peptide group). This result indicates that the liver overexpresses LRP1β chain 2AAAA The short peptide and LRP1 β-chain short peptide can significantly reduce the fasting blood glucose level of db / db mice, and overexpression of LRP1 β-chain 2AAAA Short peptides have better blood sugar lowering effects.

[0120] Four weeks after virus injection, the glucose tolerance of the two groups of db / db mice was compared. After overnight fasting, the mice were intraperitoneally injected with glucose solution at a dose of 1 g glucose / kg body weight, and blood glucose levels were measured by blood glucose meter at 0, 30, 60, 90, and 120 minutes after injection using tail blood samples. Fig.12 Compared with the AAV8-control group, AAV8-β chain 2AAAA The blood glucose levels of the short peptide group and the AAV8-β chain short peptide group were significantly reduced at 0, 60, 90, and 120 min (*P<0.05, **P<0.01, *★*P<0.001, compared with the AAV8-control group at the same time point); and the AAV8-β chain 2AAAAThe fasting blood glucose in the short peptide group was lower than that in the AAV8-β chain short peptide group (#P<0.05, compared with the AAV8-β chain short peptide group at the same time point); Fig.12 B shows that AAV8-β chain 2AAAA The areas under the glucose tolerance curve of the short peptide group and the AAV8-β chain short peptide group were significantly reduced (*P<0.05, **P<0.01, *★*P<0.001, compared with the AAV8-control group); and the AAV8-β chain 2AAAA The area under the curve of the short peptide group decreased more significantly (#P<0.05, compared with the AAV8-β chain short peptide group). This result indicates that the liver overexpresses LRP1β chain 2AAAA Short peptide and LRP1β chain short peptide can improve glucose tolerance in db / db mice, and LRP1β chain 2AAAA Short peptides have better improvement effects.

[0121] The insulin sensitivity of the two groups of mice was compared 5 weeks after virus injection. After fasting for 5 hours, the mice were injected with insulin at a dose of 1 IU / kg body weight via intraperitoneal injection. Blood was collected from the tail of the mice at 0, 30, 60, 90, and 120 minutes after injection and the blood glucose level was tested by blood glucose meter. The blood glucose value at time 0 was 100%, and the blood glucose values ​​at other time points were compared with it to obtain the relative value of blood glucose concentration. Fig.13 Compared with the AAV8-control group, AAV8-β chain 2AAAA The blood glucose of db / db mice in the short peptide and AAV8-β chain short peptide groups was significantly reduced at 30, 60, 90, and 120 min (**P<0.01, *★*P<0.001, compared with the AAV8-control group at the same time point); and the AAV8-β chain 2AAAA The fasting blood glucose in the short peptide group was lower than that in the AAV8-β chain short peptide group (#P<0.05, compared with the AAV8-β chain short peptide group at the same time point); Fig.13 B shows that AAV8-β chain 2AAAA The area under the insulin sensitivity curve of the short peptide and AAV8-β chain short peptide groups was significantly reduced (**P<0.01, *★*P<0.001, compared with the AAV8-control group); and the AAV8-β chain 2AAAA The area under the curve of the short peptide group decreased more significantly (#P<0.05, compared with the AAV8-β chain short peptide group). This result indicates that the liver overexpresses LRP1β chain 2AAAA The short peptide and LRP1β chain short peptide can significantly enhance the insulin sensitivity of db / db mice, and the LRP1β chain 2AAAA Short peptides have a better effect in enhancing insulin sensitivity.

[0122] The pyruvate tolerance of the two groups of mice was compared 6 weeks after virus injection. After overnight fasting, the mice were intraperitoneally injected with sodium pyruvate solution at a dose of 1 g sodium pyruvate / kg body weight, and blood glucose levels were measured by blood glucose meter at 0, 30, 60, 90, and 120 minutes after injection. Fig.14 Α shows that AAV8-β chain 2AAAA The blood glucose levels of db / db mice in the short peptide and AAV8-β chain short peptide groups were significantly lower than those of db / db mice in the AAV8-control group at all time points (*P<0.05, **P<0.01 compared with the AAV8-control group at the same time point); and the blood glucose levels of db / db mice in the AAV8-β chain short peptide group were significantly lower than those in the AAV8-control group at all time points (*P<0.05, **P<0.01 compared with the AAV8-control group at the same time point). 2AAAA The fasting blood glucose in the short peptide group was lower than that in the AAV8-β chain short peptide group (#P<0.05, compared with the AAV8-β chain short peptide group at the same time point); Fig.14 B shows that AAV8-β chain 2AAAA The area under the pyruvate tolerance curve of the short peptide and AAV8-β chain short peptide groups was significantly reduced (*P<0.05, **P<0.01, compared with the AAV8-control group); and the AAV8-β chain 2AAAA The area under the curve of the short peptide group decreased more significantly (#P<0.05, compared with the AAV8-β chain short peptide group). The results showed that the liver overexpressed LRP1β chain 2AAAA Short peptide and LRP1β chain Short peptide can significantly enhance pyruvate tolerance in db / db mice, LRP1β chain 2AAAA The short peptide had a more obvious effect on enhancing the pyruvate tolerance of db / db mice.

[0123] Seven weeks after virus injection, three mice were randomly selected from each group and injected with normal saline after overnight fasting, and the other three mice were injected with insulin at 1 IU / kg body weight. The mice were killed 30 minutes later to extract total protein from liver tissue, and insulin signal transduction was detected by WB. Fig.15 It was shown that under insulin stimulation, AAV8-β chain 2AAAA The levels of phosphorylated Akt and phosphorylated GSK3β in the liver tissues of mice in the short peptide and AAV8-β chain short peptide groups were significantly higher than those in the liver tissues of mice in the AAV8-control group, and the levels of phosphorylated Akt and phosphorylated GSK3β in the liver tissues of mice in the AAV8-β chain 2AAAA The levels of phosphorylated Akt and phosphorylated GSK3β in the short peptide group were higher than those in the AAV8-β chain short peptide group. This result indicates that the liver overexpresses LRP1β chain 2AAAA The short peptide and AAV8-β chain short peptide significantly enhanced the hepatic insulin signaling in db / db mice, and the AAV8-β chain 2AAAA The short peptide enhanced insulin signaling in mouse liver more than the AAV8-β chain short peptide. Fig.15 B, the display is Fig.15The experiment shown in A was repeated three times and the results were statistically analyzed (**P<0.01, *★*P<0.001, #P<0.05, ns means no statistical difference).

[0124] Fig.16 A shows that under fasting conditions, AAV8-β chain 2AAAA The levels of acetylated FoxO1 in liver tissue of the short peptide and AAV8-β chain short peptide groups were significantly higher than those in the AAV8-control group, while the expression of G6PC was significantly lower than that in the AAV8-control group. 2AAAA Compared with AAV8-β chain short peptide, acetylated FoxO1 increased more significantly and G6PC expression decreased more significantly. 2AAAA There was no difference in the expression levels of FOXO1, phosphorylated FoxO1, and PCK1 in the liver tissue of mice between the short peptide group and the AAV8-β chain short peptide group and the AAV8-control group. The above results indicate that overexpression of LRP1β chain in the liver 2AAAA The short peptide and LRP1β chain short peptide can enhance the acetylation of FoxO1 in the liver tissue of db / db mice, thereby reducing the transcriptional activity of FoxO1 and the expression of G6PC, inhibiting hepatic gluconeogenesis and lowering blood glucose levels, improving glucose metabolism in db / db mice, and LRP1β chain 2AAAA The short peptide can enhance the acetylation of FoxO1 in the liver tissue of db / db mice more than the LRP1β chain short peptide, thereby reducing the transcriptional activity of FoxO1 and the expression of G6PC, thereby inhibiting hepatic gluconeogenesis and lowering blood glucose levels. Fig.16 B, the display is Fig.16 The results obtained from the experiment shown in A were statistically analyzed (*P<0.05, **P<0.01, #P<0.05, ns means no statistical difference).

[0125] Example 4: Construction of overexpressed human pcDNA-hLRP1-β chain 2AAAA Short peptide-3xFlag plasmid.

[0126] The DNA sequence was synthesized by Shanghai Sangon Biotech Co., Ltd. and contains a BamHI restriction site, a Kozak sequence, a signal peptide coding sequence, a multisite linker, and a human LRP1-β chain arranged in sequence from the 5' end to the 3' end. 2AAAA The gene fragment of the short peptide cDNA coding sequence and the EcoRI restriction site, the synthetic gene fragment sequence is shown as follows (SEQ ID NO.4):

[0127] In the above SEQ ID NO.4 sequence, the bold bases at the 5' and 3' ends are restriction sites, the bold italic letters near the 5' end are the signal peptide coding sequence (SEQ ID NO.5, which has a start codon atg at the 5' end), and the underlined part is the human LRP1-β chain 2AAAA Short peptide cDNA coding sequence.

[0128] The human LRP1-β chain in SEQ ID NO.4 selected for synthesis in this example 2AAAA The short peptide cDNA coding sequence is the partial extracellular fragment + transmembrane segment + intracellular segment gene sequence of human LRP1-β chain, and its partial gene sequence ACCAACTTCACCAACCCCGTGTATGCCACACTC The mutation is ACCAACTTCACCGCCGCGGCGGCTGCCACACTC. The nucleotide sequence of the selected sequence corresponds to the sequence of PubMed gene number NM_002332.3:13065-14114, and the amino acid sequence encoded after the mutation is mutated from the distal NPVY to AAAA, and the sequence is shown in SEQ ID NO.6.

[0129] The pcDNA3.1(+)3×Flag plasmid was used as a vector. The gene fragment synthesized above was double-digested with BamHI and EcoRI, and then inserted into the vector using the BamHI and EcoRI restriction sites to construct the pcDNA3.1(+)-hLRP1-β2AAAA-3xFlag plasmid (plasmid map as shown in Fig.17 The experimental steps are also divided into double restriction digestion of target gene fragments, preparation of linearized expression vectors, vector ligation, competent cell transformation, and small-scale plasmid extraction. For specific methods and steps, see the construction of pAAV-TBG-mLRP1-β2AAAA-3×FLAG WPRE plasmid in Example 1. The recombinant plasmid was sequenced and confirmed to be correct for subsequent experiments. The sequencing results are shown in Fig.18 Shown: The sequencing identification is correct.

[0130] MIHA cells of normal human liver cell line were passaged to 12-well plates, and the medium was changed after the cell density grew to 70-80%. At the same time, the cells were transfected with pcDNA3.1(+)-hLRP1-β2AAAA-3xFlag, pcDNA3.1(+)-hLRP1-β-3xFlag plasmid or empty plasmid for 24 hours and then starved for 12 hours. Each group of cells was treated with 0.5% BSA and 250um PA for 24 hours, and each group of cells was harvested after being treated with 100nM insulin for 5 minutes. The total cell protein was obtained using RIPA lysis buffer containing protease and phosphatase inhibitors, and the levels of human LRP1-β chain 2AAAA short peptide-Flag and LRP1-β chain short peptide-Flag fusion proteins, phosphorylated Akt, Akt, phosphorylated GSK3β and GSK3β were detected by WB technology, and β-actin was used as an internal reference control. At the same time, the expression levels of phosphorylated FoxO1, acetylated FoxO1, FoxO1, G6PC and PCK1 proteins were detected in the absence of insulin treatment. Fig.19 MIHA cells were transfected with pcDNA3.1(+)-hLRP1-β 2AAAA -3xFlag and pcDNA3.1(+)-hLRP1-β-3xFlag plasmids, human LRP1β chain can be detected by anti-Flag antibody 2AAAA The short peptide Flag and LRP1-β chain short peptide-Flag fusion protein were highly expressed, while no expression was detected in MIHA cells that were not transfected or transfected with empty plasmid.

[0131] Fig. 20 A shows that palmitic acid treatment significantly reduced the levels of phosphorylated Akt and phosphorylated GSK3β in MIHA cells under insulin stimulation, leading to the formation of insulin resistance. 2AAAA The short peptide and LRP1-β chain short peptide can significantly reverse the down-regulation of phosphorylated Akt and phosphorylated GSK3β levels under the action of insulin by palmitic acid, enhance insulin signal transduction, and LRP1β chain 2AAAA The short peptide enhanced insulin signaling more than the LRP1-β chain short peptide; Fig. 20 B shows Fig. 20 The experiment shown in A was repeated three times and the results were analyzed statistically.

[0132] Fig.21 The results showed that although palmitic acid treatment did not affect the total protein level of FoxO1 in MIHA cells, it significantly reduced the phosphorylation and acetylation levels of FoxO1; MIHA cells overexpressing LRP1β chain 2AAAA The short peptide and LRP1-β chain short peptide can significantly reverse the inhibitory effect of palmitic acid on the phosphorylation and acetylation of FoxO1.2AAAA The inhibitory effect of short peptide on reversing the phosphorylation and acetylation of FoxO1 by palmitic acid was more obvious.

[0133] Fig. 22 The results showed that palmitic acid treatment significantly increased the expression level of G6PC in MIHA cells, but did not affect the expression of PCK1; MIHA cells overexpressed human LRP1β chain 2AAAA The short peptide and LRP1-β chain short peptide could significantly block the upregulation of G6PC expression by palmitic acid, but did not affect the expression of PCK1. 2AAAA The short peptide blocked the up-regulation of G6PC expression by palmitic acid more significantly than the LRP1-β chain short peptide.

[0134] The present invention verifies through cell experiments that saturated fatty acid palmitic acid treatment simulates a high-fat environment and induces insulin resistance in human liver cell line MIHA cells. It can be seen that the phosphorylation levels of Akt and GSK3β under insulin stimulation are significantly reduced, which further causes the phosphorylation and acetylation levels of the downstream nuclear transcription factor FoxO1 to decrease, resulting in the accumulation of FoxO1 in the liver cell nucleus and continuous activation of the gene transcription of the downstream gluconeogenesis key enzyme G6PC, thereby enhancing liver gluconeogenesis. Overexpression of LRP1β chain 2AAAA The short peptide can reverse the inhibition of insulin signaling by palmitic acid, enhance the phosphorylation of AKT and GSK3β, upregulate the phosphorylation and acetylation levels of FoxO1, reduce the accumulation of FoxO1 in the nucleus of hepatocytes and downregulate the gene transcription of G6PC, thereby reducing the level of hepatic gluconeogenesis.

[0135] A large amount of experimental evidence shows that high expression and abnormal activation of G6PC in liver tissue lead to continuous increase in hepatic glucose production, which is an important cause of hepatic insulin resistance and systemic insulin resistance. 2AAAA Overexpression of short peptides can activate insulin signaling in mouse liver tissue, promote phosphorylation and acetylation of FoxO1, inhibit the expression of G6PC, reduce hepatic gluconeogenesis, and lower blood glucose levels, thereby improving glucose metabolism in high-fat-induced hepatic insulin-resistant mice and db / db diabetic mice. We also experimentally confirmed that LRP1β chain 2AAAA The short peptide has better therapeutic effect in improving glucose metabolism in insulin-resistant mice than the LRP1-β chain short peptide previously published by the inventors.

Claims

1. LRP1-β chain 2AAAA Short peptide or LRP1-β chain 2AAAA Application of short peptide promoter in the preparation of medicine for preventing and / or treating insulin resistance diabetes.

2. The use according to claim 1, characterized in that: The insulin resistance is hepatic insulin resistance, and the diabetes is type 2 diabetes.

3. The use according to claim 1, characterized in that: The LRP1-β chain 2AAAA The amino acid sequence of the short peptide is shown in SEQ ID NO.

6.

4. The use according to claim 1, characterized in that: The LRP1-β chain 2AAAA Short peptide promoter for specific overexpression of LRP1-β chain 2AAAA Viral overexpression vectors for short peptides.

5. The use according to claim 4, characterized in that: The LRP1-β chain 2AAAA The short peptide promoter is an adeno-associated virus (AAV) vector.

6. The use according to claim 5, characterized in that: The adeno-associated viral vector is targeted to overexpress LRP1-β chain in the liver 2AAAA Preferably, the AAV vector is AAV8, and the AAV vector is a recombinant AAV (rAAV) vector.

7. The use according to claim 6, characterized in that: The recombinant adeno-associated virus vector is a signal peptide coding sequence as shown in SEQ ID NO.5 and a LRP1-β chain as shown in SEQ ID NO.

6. 2AAAA The coding gene sequence of the short peptide is inserted into the AAV8 virus.

8. The use according to claim 7, characterized in that: The recombinant adeno-associated virus vector is obtained by inserting the nucleotide sequence shown in SEQ ID NO.4 into the AAV8 virus.

9. The use according to claim 1, characterized in that LR P1-β strand 2AAAA The short peptide downregulates the expression of the hepatocyte gluconeogenesis gene glucose-6-phosphatase (G6PC) by inhibiting the FoxO1 / G6PC axis, thereby reducing hepatic gluconeogenesis and improving glucose metabolism in patients with insulin resistance and / or diabetes.

10. The use according to claim 9, characterized in that: LRP1-β chain 2AAAA The short peptide has better effects than the LRP1-β chain short peptide previously announced by the inventor in blocking the inhibition of palmitic acid on liver insulin signal transduction, reversing the inhibition of palmitic acid on the phosphorylation and acetylation of FoxO1, an upstream regulatory factor of hepatocyte gluconeogenesis-related genes, reversing the upregulation of gluconeogenesis gene G6PC expression by palmitic acid, and improving insulin resistance and diabetes.

Images