Application of reagent for promoting MARCH2 gene expression in preparation of medicine for treating aortic aneurysm / dissection

Abstract

The invention discloses an application of a reagent for promoting MARCH2 gene expression in preparation of a medicine for treating aortic aneurysm / dissection, and provides a novel medical application of the MARCH2 gene, the disease progress of the aortic aneurysm / dissection can be slowed down and the prognosis of a patient can be improved by exogenous administration of MARCH2; the invention also provides a reagent for detecting MARCH2 gene expression in preparation of a reagent or a kit for detecting aortic aneurysm / dissection, and also provides a pharmaceutical composition for treating aortic aneurysm / dissection, the pharmaceutical composition comprises a pharmaceutically acceptable carrier and an effective amount of active ingredients, and the active ingredients comprise the reagent for promoting MARCH2 gene expression. The invention reveals that MARCH2 can improve aortic aneurysm / dissection vascular injury for the first time, provides a new drug action target for diagnosis and treatment of aortic aneurysm / dissection, and has important clinical value.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to the use of a reagent for promoting MARCH2 gene expression in the preparation of a drug for treating aortic aneurysm / dissection. Background Art

[0002] Aortic aneurysm / dissection is a common degenerative cardiovascular disease, with pathological characteristics of chronic aortic wall inflammation, degradation of extracellular matrix proteins, and dysfunction of vascular smooth muscle cells. The early symptoms of patients are hidden, and aortic rupture may occur in the middle and late stages, leading to hemorrhagic death. The disease has an acute onset, rapid progression, and a high mortality rate. It requires timely surgical treatment. Misdiagnosis or delayed treatment can cause permanent damage or death. However, imaging diagnosis is difficult to popularize, existing biomarkers have low specificity, and there is no effective drug treatment. Therefore, further clarifying the pathogenesis of aortic aneurysm / dissection and using this as a target to find drugs and treatments with potential clinical application value will significantly enhance the clinical benefits of aortic aneurysm / dissection and improve patient prognosis, which is of great clinical significance.

[0003] Membrane-associated zinc finger protein 2 (MARCH2) is an E3 ubiquitin ligase. As an important regulator of the innate immune system and inflammatory response, MARCH2 is involved in antiviral defense, bacterial infection, and T cell development. Under the stimulation of LPS, MARCH2 gene knockout causes a large amount of proinflammatory cytokines (IL-6, CXCL10, TNF-α, and IL-1β), indicating that MARCH2 has the function of inhibiting inflammatory response. Summary of the invention

[0004] The purpose of the present invention is to provide an agent for promoting the expression of the MARCH2 gene for use in the preparation of a drug for treating aortic aneurysm / dissection, and to propose a new medical use of the MARCH2 gene. Exogenous administration of MARCH2 can slow down the disease progression of aortic aneurysm / dissection and improve the patient's prognosis, thereby providing a new target for the treatment of aortic aneurysm / dissection in clinical medicine.

[0005] To achieve the above object, the present invention adopts the following technical solution:

[0006] The present invention provides application of a reagent for promoting MARCH2 gene expression in preparing a medicine for treating aortic aneurysm / dissection.

[0007] Preferably, the agent for promoting the expression of the MARCH2 gene comprises an adeno-associated virus vector for promoting the expression of the MARCH2 gene.

[0008] Preferably, the adeno-associated virus vector is a recombinant adeno-associated virus AAV9-SM22α-MARCH2.

[0009] Preferably, the virus titer of the recombinant adeno-associated virus AAV9-SM22α-MARCH2 is 1.7×10 12 (Vg) / mL.

[0010] Preferably, the drug further comprises a pharmaceutically acceptable excipient.

[0011] More preferably, the pharmaceutically acceptable excipient is selected from one or more of a buffer, an encapsulating agent, a filler, a binder, a transdermal absorbent, a wetting agent, a disintegrant, an absorption promoter, a surfactant, a colorant, a flavoring agent and an adsorption carrier.

[0012] The present invention also provides the use of a reagent for detecting MARCH2 gene expression in preparing a reagent or a kit for detecting aortic aneurysm / dissection.

[0013] Preferably, the reagent for detecting MARCH2 gene expression comprises a MARCH2 antibody.

[0014] Preferably, the method further comprises a primer pair having sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0015] The present invention also provides a pharmaceutical composition for treating aortic aneurysm / dissection, comprising a pharmaceutically acceptable carrier and an effective amount of active ingredients, wherein the active ingredients include an agent that promotes the expression of the MARCH2 gene.

[0016] Preferably, the agent for promoting the expression of the MARCH2 gene comprises an adeno-associated virus vector for promoting the expression of the MARCH2 gene.

[0017] Preferably, the adeno-associated virus vector comprises recombinant adeno-associated virus AAV9-SM22α-MARCH2.

[0018] More preferably, the virus titer of the recombinant adeno-associated virus AAV9-SM22α-MARCH2 is 1.7×10 12 (Vg) / mL.

[0019] The present invention has proved through animal experiments that MARCH2 is specifically overexpressed in mouse aortic smooth muscle cells using AAV9-SM22α-MARCH2, and found that MARCH2 can significantly improve BAPN-induced aortic dilatation, reduce BAPN-induced vascular pathological changes and destruction of elastin arrangement, and improve apoptosis of vascular smooth muscle cells caused by aortic aneurysm / dissection. The present invention reveals for the first time that MARCH2 can improve aortic aneurysm / dissection vascular damage, providing a new drug target for the diagnosis and treatment of aortic aneurysm / dissection, and has important clinical value. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is an immunofluorescence image of the successful overexpression of MARCH2 in mouse vascular smooth muscle in the example.

[0021] Figure 2 These are the gross images and survival rate results related to MARCH2 overexpression improving BAPN-induced aortic aneurysm / dissection vascular injury in mice in the example.

[0022] Figure 3 The vascular ultrasound detection and maximum aortic diameter statistical results of MARCH2 overexpression alleviating BAPN-induced aortic dilatation in the example.

[0023] Figure 4 HE staining and EVG staining results of MARCH2 overexpression in the example to alleviate BAPN-induced aortic aneurysm / dissection in mice vascular pathological changes and elastin arrangement disruption.

[0024] Figure 5 The results of Western blot and TUNEL staining show that MARCH2 overexpression alleviates BAPN-induced aortic aneurysm / dissection in mice during aortic dissection. DETAILED DESCRIPTION

[0025] In order to more fully understand and demonstrate the technical solutions, purposes and advantages of the present invention, the technical effects produced by the present invention are further described in detail and completely in conjunction with the accompanying drawings and specific embodiments. Obviously, the described embodiments are only part of the embodiments of the present invention, not all. It should be pointed out that for ordinary technicians in this field, other embodiments obtained without departing from the concept of the present invention all belong to the protection scope of the present invention.

[0026] The following examples provide the use of overexpressing the MARCH2 gene in preventing and treating aortic aneurysm / dissection.

[0027] Example 1

[0028] 1. Experimental methods

[0029] 1.1 Establishment of mouse aortic aneurysm / dissection model, the specific steps include:

[0030] Forty male 4-week-old C57BL / 6J mice were randomly divided into two groups: a control group and a BAPN experimental group, with 20 mice in each group. The experimental group was given BAPN (1 g / kg / day) in water to establish the AAD model of mice, while the control group was given normal drinking water. Vascular ultrasound was performed on the 28th day and CO was used to evaluate the blood vessels. 2The rats were anesthetized to death, and their aorta was isolated to observe and judge the formation and severity of AAD in the experimental group.

[0031] 1.2 Vascular ultrasound assessment of aortic dilatation in mice

[0032] Mice were anesthetized with 2% isoflurane and fixed on an ultrasound table in a supine position with their head facing forward. An electrocardiogram was connected to maintain a heart rate of 400-500 beats / min. Transthoracic micro-ultrasound imaging (MUI) was performed on mice using a Vevo 2100 Doppler ultrasound instrument to evaluate the morphological characteristics of aortic aneurysms / dissections in vivo. MUI images were acquired in B mode according to the manufacturer's instructions, and the aortic diameter was measured three times by a blinded experimenter to confirm the maximum aortic dilation.

[0033] 1.3 TUNEL staining assay

[0034] The TUNEL apoptosis detection kit of Shanghai Biyuntian Company was used to evaluate the apoptosis level of vascular smooth muscle cells in aortic tissue. The specific steps are as follows: treat tissue sections with fixative and fix at room temperature for 30 minutes; aspirate the fixative, add punching solution and incubate at room temperature for 15 minutes; aspirate the punching solution, add 5% BSA to block at room temperature for 1 hour; add 50μL TUNEL detection solution and incubate at 37℃ in the dark for 60 minutes; aspirate the blocking solution, add the prepared primary antibody to the tissue, ensure that the primary antibody covers the tissue sufficiently for each sample, place the slide in a humid box and place it at 4℃ overnight; aspirate the primary antibody, add the secondary antibody after washing, incubate at room temperature in the dark for 1 hour; aspirate the secondary antibody and wash 3 times; seal the slide with DAPI anti-quenching sealing agent, ensure that the coverslip is tight to the tissue patch and there are no bubbles, and take pictures with a confocal microscope.

[0035] 1.4 Construction of adeno-associated virus AAV9-SM22α-MARCH2

[0036] Adeno-associated virus AAV9-SM22α-MARCH2 was commissioned to Hanheng Biotechnology Co., Ltd. to construct, and PCR amplification primers were designed based on the sequence of the MARCH2 gene. The primer sequences are as follows:

[0037] AAV9-m-MARCH2-F: AGGGCTCAGAGGTAGTAGACA (SEQ ID NO: 1);

[0038] AAV9-m-MARCH2-R: AAATATGTTCACACGGGATCACA (SEQ ID NO: 2);

[0039] This example does not have strict requirements on the source of AAV9-SM22α-MARCH2. The conventional plasmid construction method is used to insert the fragment expressing the MARCH2 gene into the adeno-associated virus vector SM22α promoter to obtain the recombinant adeno-associated virus AAV9-SM22α-MARCH2. The obtained virus titer is 1.7×10 12 (Vg) / mL.

[0040] 1.5 Three weeks after the C57BL / 6 mice were injected with adeno-associated virus AAV9-SM22α-MARCH2 (120 μL / mouse) and AAV9-SM22α-vector (negative adeno-associated virus control, injection dose 120 μL / mouse) through the tail vein, the C57BL / 6 mice were divided into four groups, the control group (AAV9-SM22α-vector) and the overexpression group (AAV9-SM22α-MARCH2), and the BAPN-induced aortic aneurysm / dissection model was reconstructed.

[0041] After BAPN was continuously fed with water for 28 days, vascular ultrasound was used to detect the maximum aortic diameter of the mice, HE staining and EVG staining were used to detect vascular pathological changes and elastin arrangement, immunofluorescence experiments were used to detect MARCH2 gene overexpression, and Western blot and TUNEL staining were used to detect the apoptosis of vascular smooth muscle cells in mice in different treatment groups.

[0042] 2. Experimental results

[0043] (1) Mice with vascular smooth muscle-specific overexpression of MARCH2 were constructed by injecting AAV9-SM22α-MARCH2 and AAV9-SM22α-vector. Immunofluorescence experiments showed that the overexpression was successful. Figure 1 shown.

[0044] (2) The results of the gross images of the mouse aorta and the survival rate showed that MARCH2 overexpression could improve the formation of aortic aneurysm / dissection induced by BAPN, such as Figure 2 shown.

[0045] (3) The results of mouse vascular ultrasound examination showed that MARCH2 overexpression could alleviate BAPN-induced aortic dilatation. Figure 3 shown.

[0046] (4) HE and EVG staining results showed that MARCH2 overexpression significantly alleviated BAPN-induced aortic aneurysm / dissection in mice with vascular pathological changes and elastin disorder. Figure 4 shown.

[0047] (5) WB and TUNEL staining results showed that MARCH2 overexpression significantly reduced BAPN-induced aortic aneurysm / dissection in mice with vascular smooth muscle cell apoptosis. Figure 5 shown.

[0048] The above are only preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. Application of reagents that promote the expression of the MARCH2 gene in the preparation of drugs for the treatment of aortic aneurysm / dissection.

2. The use according to claim 1, characterized in that: The reagent for promoting the expression of MARCH2 gene includes an adeno-associated virus vector for promoting the expression of MARCH2 gene.

3. The use according to claim 2, characterized in that: The adeno-associated virus vector that promotes the expression of the MARCH2 gene is a recombinant adeno-associated virus AAV9-SM22α-MARCH2.

4. The use according to claim 3, characterized in that: The virus titer of the recombinant adeno-associated virus AAV9-SM22α-MARCH2 was 1.7×10 12 (Vg) / mL.

5. The use according to claim 1, characterized in that: The drug also includes pharmaceutically acceptable excipients selected from one or more of buffers, encapsulating agents, fillers, adhesives, transdermal absorbents, wetting agents, disintegrants, absorption promoters, surfactants, colorants, flavoring agents and adsorption carriers.

6. Use of a reagent for detecting MARCH2 gene expression in the preparation of a reagent or kit for detecting aortic aneurysm / dissection.

7. The use according to claim 6, characterized in that: The reagent for detecting the expression of the MARCH2 gene includes a MARCH2 antibody and a primer pair having sequences as shown in SEQ ID NO:1 and SEQ ID NO:

2.

8. A pharmaceutical composition for treating aortic aneurysm / dissection, characterized in that: The invention comprises a pharmaceutically acceptable carrier and an effective amount of active ingredients, wherein the active ingredients include an agent for promoting the expression of MARCH2 gene.

9. The use according to claim 8, characterized in that: The reagent for promoting the expression of MARCH2 gene includes an adeno-associated virus vector for promoting the expression of MARCH2 gene.

10. The use according to claim 9, characterized in that: The adeno-associated virus vector for promoting the expression of MARCH2 gene is a recombinant adeno-associated virus AAV9-SM22α-MARCH2, and the virus titer is 1.7×10 12 (Vg) / mL.

Images