Adeno-associated virus mutant and application thereof

Abstract

The invention belongs to the technical field of biological medicine, and discloses an adeno-associated virus mutant and application thereof. The amino acid sequence of the adeno-associated virus capsid protein mutant disclosed by the invention comprises a sequence as shown in any one of SEQ ID No.2. The adeno-associated virus capsid protein mutant, the expression vector thereof, the host cell and the recombinant adeno-associated virus are applied to preparation of drug delivery tools for preventing and / or treating muscle or heart diseases. The adeno-associated virus capsid protein mutant disclosed by the invention has muscle or heart targeting, the muscle targeting is improved by about 258 times at most, the liver tropism is also nearly hundreds of times lower than that of a control group, and the specificity is good. According to the invention, the large-scale and socialized application of the AAV-based gene therapy method can be promoted.

Description

[0001] This invention patent application is a divisional application based on Chinese patent application No. 2024108238929, filed on June 25, 2024, with the invention name “Adeno-associated virus mutants and their applications”. Technical Field

[0002] The present invention relates to the field of biomedicine technology, and in particular to an adeno-associated virus mutant and application thereof. Background Art

[0003] Adeno-associated virus (AAV) is a small non-enveloped virus that encapsulates a linear single-stranded DNA genome. It belongs to the genus Dependovirus of the family Parvoviridae and requires a helper virus (usually adenovirus) to participate in replication. The AAV genome is a single-stranded DNA fragment contained in a non-enveloped viral capsid and can be divided into three functional regions: two open reading frames (Rep gene, Cap gene) and inverted terminal repeats (ITR). Recombinant adeno-associated virus vectors (rAAV) are derived from non-pathogenic wild-type adeno-associated viruses. Due to its advantages such as wide host range, non-pathogenicity, low immunogenicity, long-term stable expression of foreign genes, good diffusion performance and stable physical properties, it is widely used as a gene transfer vector in gene therapy and vaccine research. In medical research, rAAV has been used in the study of gene therapy for a variety of diseases (including in vivo and in vitro experiments), such as gene function research, construction of disease models, and preparation of gene knockout mice.

[0004] In recent years, gene therapy has become a new method for treating muscle diseases, among which AAV has been widely used as an effective gene vector. Take Duchenne muscular dystrophy (DMD) as an example. It is a rare and fatal neuromuscular genetic disease that occurs in one in every 3,500-5,000 men worldwide. DMD is caused by changes or mutations in the gene encoding dystrophin. Symptoms of DMD usually appear in infants and young children, and affected patients may experience developmental delays, such as difficulty walking, climbing stairs, or standing up from a sitting position. Elevidys (trade name), whose generic name is delandistrogene moxeparvovec and early name is SRP-9001, is a gene therapy delivered by AAVrh74 vector and uses MHCK7 promoter to express truncated DMD gene (mini protein gene micro-dystrophin) in DMD patients. It has been launched in the United States in June 2023 for DMD people aged 4-5 who can walk independently (disabled for people with deletion mutations in exons 8 and / or 9). On June 20, 2024, the U.S. Food and Drug Administration (FDA) fully approved ELEVIDYS for DMD patients aged 4 years and above who can walk independently, and accelerated the approval (conditional marketing) of the drug for DMD patients aged 4 years and above who cannot walk independently. In addition, there are some other AAV treatment cases or clinical studies underway. However, AAV treatment also has some potential risks. For example, excessive doses may cause a response from the immune system, leading to side effects. In addition, high doses also mean greater production difficulty and higher costs.

[0005] In addition, although the current AAV screening strategy based on directed evolution can obtain some effective mutants in large-scale screening, the screening process is cumbersome and expensive, especially the failure of targeting ability caused by species differences and the huge cost of screening in monkeys. This not only increases the threshold for researchers to participate, but the high development costs are ultimately fed back into the cost of medication.

[0006] Therefore, the main purpose of AAV serotype modification is to develop serotypes with better therapeutic effects, lower therapeutic doses, reduced side effects and usage costs, in order to obtain drugs with higher targeting and thus reduce drug doses, or to make drugs with better specificity and thus avoid adverse reactions. Summary of the invention

[0007] The purpose of the present invention is to overcome the shortcomings of the prior art and provide an adeno-associated virus mutant with muscle or heart targeting and its application.

[0008] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0009] In a first aspect, the present invention provides an adeno-associated virus capsid protein mutant, the amino acid sequence of which includes a sequence as shown in any one of SEQ ID No. 1 to 4.

[0010] The adeno-associated virus capsid protein mutant of the present invention has muscle or heart targeting, especially good targeting to different muscle tissues (quadriceps, biceps and abdominal muscles, etc.). Compared with the control group AAV9, the muscle targeting is increased by up to about 258 times, and the liver tropism is also nearly 100 times lower than that of the control group, with good specificity.

[0011] As a preferred embodiment of the adeno-associated virus capsid protein mutant of the present invention, a targeting peptide is inserted into the amino acid sequence; the amino acid sequence of the targeting peptide is a sequence as shown in any one of SEQ ID No. 5 to 8.

[0012] In a second aspect, the present invention provides a nucleic acid encoding the adeno-associated virus capsid protein mutant.

[0013] As a preferred embodiment of the nucleic acid of the present invention, its nucleotide sequence comprises the nucleotide sequences shown in SEQ ID No.9-12.

[0014] In a third aspect, the present invention provides an expression vector comprising the nucleic acid.

[0015] In a fourth aspect, the present invention provides a host cell comprising the expression vector.

[0016] In a fifth aspect, the present invention provides a host cell that expresses the adeno-associated virus capsid protein mutant.

[0017] In a sixth aspect, the present invention provides a recombinant adeno-associated virus, comprising the adeno-associated virus capsid protein mutant.

[0018] As a preferred embodiment of the recombinant adeno-associated virus of the present invention, it also includes a heterologous target gene.

[0019] As a further preferred embodiment of the recombinant adeno-associated virus of the present invention, the heterologous target gene encodes any gene product of interfering RNA, aptamer, endonuclease, and guide RNA.

[0020] In a seventh aspect, the present invention provides a method for preparing a recombinant adeno-associated virus, comprising introducing at least the following components into a host cell: 1) the nucleic acid or the expression vector, 2) an adenovirus helper plasmid, and 3) a plasmid containing two terminal inverted repeat sequences.

[0021] In an eighth aspect, the present invention provides rAAV prepared by the method described above.

[0022] In a ninth aspect, the present invention provides a pharmaceutical composition comprising the recombinant adeno-associated virus or the rAAV, and a pharmaceutically acceptable carrier.

[0023] In the tenth aspect, the present invention uses the adeno-associated virus capsid protein mutant, the expression vector, the host cell, the recombinant adeno-associated virus, and the rAAV in the preparation of a drug or preparation for delivering a gene product to cells or tissues of a subject.

[0024] As a preferred embodiment of the application of the present invention, the cells are muscle cells or heart cells; the tissues are muscle tissues or heart tissues.

[0025] In the eleventh aspect, the present invention uses the adeno-associated virus capsid protein mutant, the expression vector, the host cell, the recombinant adeno-associated virus, and the rAAV in the preparation of a drug delivery tool for preventing and / or treating muscle or heart diseases.

[0026] As a preferred embodiment of the application described in the present invention, the muscle diseases include but are not limited to any one of Duchenne muscular dystrophy, Becker muscular dystrophy, X-linked myotubular myopathy, limb-girdle muscular dystrophy, myotonic dystrophy, and facioscapulohumeral muscular dystrophy; the heart diseases include but are not limited to any one of arrhythmic cardiomyopathy, ischemic cardiomyopathy, hypertrophic cardiomyopathy, dilated disease, angina pectoris, coronary heart disease, myocardial infarction, and heart failure.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] The present invention connects the RGD peptide segment to a low liver tropism skeleton, and the obtained adeno-associated virus capsid protein mutant has muscle or heart targeting, especially good targeting to different muscle tissues (quadriceps, biceps and abdominal muscles, etc.). Compared with the control group AAV9, the muscle targeting is increased by about 258 times at most, and the liver tropism is also nearly 100 times lower than that of the control group, with good specificity, good safety and a wide range of applications. The present invention develops a new AAV gene therapy product with lower dosage requirements and costs to meet the needs of more different patients, and promotes AAV-based gene therapy methods towards large-scale and socialized applications. This will be of great significance in the future for improving the benefits of gene therapy and serving a large number of patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 The results of in vivo imaging of Balb / c mice infected with different serotypes; Figure 1 In the figure, A shows mice infected for 14 days, and B shows mice infected for 21 days.

[0030] Figure 2 Analysis of the targeting of different serotypes to the muscle (biceps brachii) of Balb / c mice (21 days); Figure 2 In the figure, A is the relative expression level of mRNA and B is the protein expression level.

[0031] Figure 3 Analysis of the targeting of different serotypes to the muscle (triceps brachii) of Balb / c mice (21 days); Figure 3 In the figure, A is the relative expression level of mRNA, and B is the protein expression level.

[0032] Figure 4 Analysis of the targeting of different serotypes to the muscle (quadriceps femoris) of Balb / c mice (21 days); Figure 4 In the figure, A is the relative expression level of mRNA, and B is the protein expression level.

[0033] Figure 5 Analysis of the targeting of different serotypes to the muscle (abdominal muscle) of Balb / c mice (21 days); Figure 5 In the figure, A is the relative expression level of mRNA, and B is the protein expression level.

[0034] Figure 6 Analysis of the targeting of different serotypes to the muscle (gastrocnemius) of Balb / c mice (21 days); Figure 6 In the figure, A is the relative expression level of mRNA, and B is the protein expression level.

[0035] Figure 7 Analysis of cardiac targeting of different serotypes in Balb / c mice (21 days); Figure 7 In the figure, A is the relative expression level of mRNA, and B is the protein expression level.

[0036] Figure 8 Analysis of liver targeting of different serotypes in Balb / c mice (21 days); Figure 8 In the figure, A is the relative expression level of mRNA, and B is the protein expression level.

[0037] Fig. 9 For the targeting analysis of different serotypes on other organs of Balb / c mice (21 days, relative mRNA expression levels); Fig. 9 In the figure, A represents the lungs, B represents the kidneys, and C represents the brain.

[0038] Fig.10 To analyze the muscle targeting and liver tropism of different serotypes in cynomolgus monkeys for NGS testing; Fig.10 In the figure, A is the puncture at 14 days, and B is the puncture at 28 days. DETAILED DESCRIPTION

[0039] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art.

[0040] Unless the context clearly indicates otherwise, the term "or" refers to a single element of the listed alternative elements and the term "and / or" refers to any one, any two, any three, any more or all of the listed alternative elements.

[0041] The term "comprising" or "including" means including the stated elements, integers or steps, but does not exclude any other elements, integers or steps. In the text, when the term "comprising" or "including" is used, unless otherwise indicated, it also covers the situation consisting of the stated elements, integers or steps. For example, when referring to a polypeptide "comprising" a specific sequence, it is also intended to cover a polypeptide consisting of the specific sequence.

[0042] "Adeno-associated virus (AAV)" is a non-enveloped icosahedral capsid virus of the Parvoviridae family, including a single-stranded DNA viral genome. The Parvoviridae family includes the genus Dependovirus, which includes AAV, which relies on the presence of a helper virus such as adenovirus for its replication. Due to its relatively simple structure, ability to infect a variety of cells (including quiescent and dividing cells) without integrating into the host genome, and its relatively mild immunogenic characteristics, AAV has been shown to be useful as a biological tool for expressing a gene of interest in vitro or in vivo. AAV-based expression vectors are also contemplated herein, including recombinant AAV (rAAV) with a gene of interest for therapeutic purposes.

[0043] The wild-type AAV viral genome is a linear, single-stranded DNA (ssDNA) molecule with a length of about 5000 nucleotides (nt). The AAV viral genome typically includes two inverted terminal repeats (ITRs), which cap the viral genome at the 5' and 3' ends, respectively, and provide a replication origin for the viral genome. These ITRs have a characteristic T-shaped hairpin structure and have multiple functions, including but not limited to acting as a starting point for DNA replication by acting as a primer for the endogenous DNA polymerase complex of the host viral replication cell.

[0044] The wild-type AAV viral genome also includes the Rep gene and the Cap gene, which encode four non-structural Rep proteins (Rep78, Rep68, Rep52, Rep40) and three capsid proteins or structural proteins (VP1, VP2, VP3), respectively. The Rep protein is associated with viral replication and packaging, while the capsid protein assembles to form the protein shell of AAV or the AAV capsid. Alternative splicing and alternate start codons and promoters result in the production of four different Rep proteins from a single open reading frame in the Rep gene and three capsid proteins from a single open reading frame in the Cap gene.

[0045] In the context of AAV, the terms "viral capsid protein" or "capsid protein" used refer to the protein of AAV that is capable of self-assembly to produce AAV particles, also known as coat protein or VP protein. The VP protein includes three subunits VP1, VP2 and VP3, and thus the changes in the VP protein mutant relative to the wild-type VP protein can be reflected in the changes in the amino acid sequences of the VP1, VP2 and VP3 subunits. Accordingly, in this article, "capsid protein mutants" include VP protein mutants, and also VP1 VP2 and / or VP3 subunit mutants. Due to the consistency of the amino acid sequences between the VP1, VP2 and VP3 subunits expressed from the same Cap gene, when the coding sequence in the Cap gene is altered, for example, when the coding sequence of the VP1 subunit is altered, the amino acid sequences of the expressed VP2 and VP3 subunits are also changed.

[0046] The term "serotype" used in the context of AAV is used to refer to the difference in the capsid protein of AAV that is serologically different from other AAV serotypes. The determination of serological uniqueness is based on the reactivity between an antibody and one AAV, but lacks cross-reactivity with other or another AAV. This cross-reactivity difference is usually due to differences in the capsid protein sequence (or its subunit sequence) / antigenic determinants (for example, due to differences in the VP1, VP2 and / or VP3 sequences of serotype AAV9). A variety of AAV serotypes have been discovered, including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 and AAV12, and their mutants.

[0047] When referring to the capsid protein or its subunits of AAV, the "variable region" refers to the region whose amino acid sequence varies relatively greatly between different serotypes. Usually, the amino acid sequences of AAV capsid proteins of many serotypes can be compared to determine the relatively conserved regions, and the sequences between them are the variable region sequences. The variable region may be related to the binding of AAV to cell surface receptors.

[0048] "Recombinant AAV vector" refers to an AAV genome derived by removing some wild-type genes (e.g., Rep genes and Cap genes) from the AAV genome using molecular biological methods and replacing them with heterologous nucleic acid sequences (e.g., coding sequences of proteins or RNA for therapeutic purposes). Typically, for recombinant AAV vectors, one or two inverted terminal repeat (ITR) sequences of the AAV genome are retained. In most cases, recombinant AAV vectors are replication-defective and lack sequences encoding functional Rep and Cap proteins in their viral genomes. These replication-defective AAV particles may lack most of the parental coding sequences and essentially carry only one or two AAV ITR sequences and target nucleic acids for delivery to cells, tissues, organs or organisms. AAVs including recombinant AAV vectors are referred to herein as recombinant AAV (rAAV).

[0049] "Amino acid changes" herein include amino acid substitutions, deletions or insertions. The number of amino acid changes in the mutant sequence relative to the parent sequence can be calculated as the sum of the number of amino acid substitutions, the number of deleted amino acids and the number of inserted amino acids.

[0050] As used herein, the terms "nucleic acid molecule", "nucleic acid" and "polynucleotide" are used interchangeably to refer to nucleotide polymers. Such nucleotide polymers may contain natural and / or non-natural nucleotides and include (but are not limited to) DNA, RNA and PNA. "Nucleic acid sequence" refers to a linear sequence of nucleotides contained in a nucleic acid molecule or polynucleotide. "Isolated nucleic acid molecule" refers to a nucleic acid molecule that is separated from its natural environment (such as the intracellular environment) and is substantially free of one or more substances that are normally associated with it in nature, such as proteins, nucleic acids, lipids, carbohydrates, cell membranes, etc., or is an artificially prepared (such as artificially synthesized) nucleic acid molecule.

[0051] The term "expression vector" refers to a nucleic acid molecule comprising various expression elements for expressing a target protein or target RNA in a host cell. For expression vectors for expressing a target protein in eukaryotic cells, these expression elements generally include promoters, enhancers, polyadenylation signal sequences, etc. For convenience of amplification in Escherichia coli, the expression vector generally also includes an Escherichia coli replicon sequence. In addition, the expression vector may also include an antibiotic resistance gene or a selective marker gene (e.g., ampicillin resistance gene (AmpR), thymidine kinase gene (TK), kanamycin resistance gene (KanR), neomycin resistance gene (NeoR) etc.) for screening and a multiple cloning site (MCS) for insertion of the target gene.

[0052] The term "host cell" refers to cells in which an expression vector can be maintained and / or replicated, including prokaryotic cells and eukaryotic cells, such as bacteria (such as E. coli), fungi (yeast), insect cells (such as SF9) and mammalian cells (such as HEK-293T).

[0053] When referring to a pharmaceutical composition, the term "pharmaceutically acceptable carrier" is used to refer to a solid or liquid diluent, filler, antioxidant, stabilizer, or other substance that can be safely administered, is suitable for administration to humans and / or animals without excessive adverse side effects, and is suitable for maintaining the activity of the drug or active agent located therein. Depending on the route of administration, various different carriers well known in the art can be used, including, but not limited to, sugars, starch, cellulose and its derivatives, maltose, gelatin, talc, calcium sulfate, vegetable oils, synthetic oils, polyols, alginic acid, phosphate buffer, emulsifiers, isotonic saline, and / or pyrogen-free water, etc.

[0054] The "targeting" of AAV or rAAV refers to the phenomenon that when it is introduced into the body, it is relatively concentrated in a specific tissue or organ. For example, the targeting can be manifested as a higher concentration in tissue A than in tissue B. This targeting can be reflected by detecting the content or concentration of its genome in different tissues or organs.

[0055] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. It should be understood by those skilled in the art that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0056] Unless otherwise specified, the experimental methods used in the examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial channels.

[0057] Example 1: Construction of AAV capsid protein mutants and virus production

[0058] (1) Discovery and determination of targeting peptide sequences

[0059] The present invention explores the structural and functional analysis of naturally occurring viruses or ligand peptides in nature, and applies different strategies to construct candidate serotype mutants in a more direct way and at a lower cost. The RGD motif can bind to the motif of the integrin receptor, and some integrin receptors are relatively specifically expressed in muscle cells. Some integrin receptor-related ligands and viruses with muscle infection ability are screened, and potential muscle-targeted peptides are mined from them, especially peptides containing the RGD motif as potential targeting peptides, and then relevant experimental verification analysis is performed.

[0060] RGD peptides of different sequences, peptides of different lengths, different insertion or replacement methods, etc. may have a huge impact on the final targeting effect. The peptide sequences selected in the present invention are shown in Table 1:

[0061] Table 1 Selected peptide sequences

[0062] type Sequence source Peptide sequence Remark Viral peptides FMDV O VP1 SPNLRGDLQVLAA Mutant 1 targeting peptide Viral peptides FMDV O VP1 SNLRGDLQVLA Mutant 5 targeting peptide Viral peptides FMDV C VP1 SASARGDLAHLTA Mutant 2 targeting peptide Viral peptides FMDV C VP1 SSARGDLAHLA Mutant 6 targeting peptide Ligand peptide TGFβ STGRRGDLATIHA Mutant 3 targeting peptide Ligand peptide TGFβ SGRRGDLATIA Mutant 7 targeting peptide Ligand peptide Tenascin(TNC) SISRRGDMSSNPA Mutant 4 targeting peptide Ligand peptide Tenascin(TNC) SSRRGDMSSNA Mutant 8 targeting peptide

[0063] The "S" and "A" at both ends of the amino acid sequence in Table 1 are used as the connecting sequence between the serotype VP1 backbone and the targeting peptide. For example, the above-mentioned targeting peptide amino acid sequence replaces R584 to R587 of the low hepatotropic serotype (SEQ ID NO.13) VP1, or S584 to R594 of the serotype 109 (SEQ ID NO.14) VP1, to form a new serotype VP1 sequence.

[0064] (2) Construction of mutant serotype vector and plasmid extraction

[0065] The AAV9 Rep-CAP plasmid (purchased from Guangzhou Paizhen Biotechnology Co., Ltd.) was double-digested with Smi I and BshT I, and the fragment band of about 5000 bp was cut out for gel electrophoresis and gel recovery to obtain the digested backbone fragment.

[0066] According to the Cap sequence of mutant 1, the following primers were designed, and the specific steps were as follows: using the Rep-CAP plasmid of serotype 109 as a template, using the Cap-f+YJ561-R primers to amplify and gel-recover to obtain the target product YJ561-1, using the Rep-CAP plasmid of serotype 109 as a template, using the YJ561-F+cap-r primers to amplify and gel-recover to obtain the target product YJ561-2, and by mixing the backbone fragment, YJ561-1, and YJ561-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 1 can be recombined and constructed;

[0067] According to the Cap sequence of mutant 2, the following primers were designed, and the specific steps were as follows: using the Rep-CAP plasmid of serotype 109 as a template, using the Cap-f+YJ563-R primers to amplify and gel-recover to obtain the target product YJ563-1, using the Rep-CAP plasmid of serotype 109 as a template, using the YJ563-F+cap-r primers to amplify and gel-recover to obtain the target product YJ563-2, and by mixing the backbone fragment, YJ563-1, and YJ563-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 2 can be recombined and constructed;

[0068] According to the Cap sequence of mutant 3, the following primers were designed, and the specific steps were as follows: using the Rep-CAP plasmid of serotype 109 as a template, using the Cap-f+YJ565-R primers to amplify and gel-recover to obtain the target product YJ565-1, using the Rep-CAP plasmid of serotype 109 as a template, using the YJ565-F+cap-r primers to amplify and gel-recover to obtain the target product YJ565-2, and by mixing the backbone fragment, YJ565-1, and YJ565-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 3 can be recombined and constructed;

[0069] According to the Cap sequence of mutant 4, the following primers were designed, and the specific steps were as follows: using the Rep-CAP plasmid of serotype 109 as a template, using the Cap-f+YJ567-R primers to amplify and gel-recover to obtain the target product YJ567-1, using the Rep-CAP plasmid of serotype 109 as a template, using the YJ567-F+cap-r primers to amplify and gel-recover to obtain the target product YJ567-2, and by mixing the backbone fragment, YJ567-1, and YJ567-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 4 can be recombined and constructed;

[0070] According to the Cap sequence of mutant 5, the following primers were designed, and the specific steps were as follows: using the Rep-CAP plasmid of serotype 109 as a template, using the Cap-f+YJ562-R primers to amplify and gel-recover to obtain the target product YJ562-1, using the Rep-CAP plasmid of serotype 109 as a template, using the YJ562-F+cap-r primers to amplify and gel-recover to obtain the target product YJ562-2, and by mixing the backbone fragment, YJ562-1, and YJ562-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 5 can be recombined and constructed;

[0071] According to the Cap sequence of mutant 6, the following primers were designed, and the specific steps were as follows: using the Rep-CAP plasmid of serotype 109 as a template, using the Cap-f+YJ564-R primers to amplify and gel-recover to obtain the target product YJ564-1, using the Rep-CAP plasmid of serotype 109 as a template, using the YJ564-F+cap-r primers to amplify and gel-recover to obtain the target product YJ564-2, and by mixing the backbone fragment, YJ564-1, and YJ564-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 6 can be recombined and constructed;

[0072] According to the Cap sequence of mutant 7, the following primers were designed, and the specific steps were as follows: using the Rep-CAP plasmid of serotype 109 as a template, using the Cap-f+YJ566-R primers to amplify and gel-recover to obtain the target product YJ566-1, using the Rep-CAP plasmid of serotype 109 as a template, using the YJ566-F+cap-r primers to amplify and gel-recover to obtain the target product YJ566-2, and by mixing the backbone fragment, YJ566-1, and YJ566-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 7 can be recombined and constructed;

[0073] According to the Cap sequence of mutant 8, the following primers were designed, and the specific steps were as follows: using the Rep-CAP plasmid of serotype 109 as a template, using the Cap-f+YJ568-R primers to amplify and gel-recover to obtain the target product YJ568-1, using the Rep-CAP plasmid of serotype 109 as a template, using the YJ568-F+cap-r primers to amplify and gel-recover to obtain the target product YJ568-2, and by mixing the backbone fragment, YJ568-1, and YJ568-2 in the following steps and proportions, the Rep-CAP plasmid of mutant 8 can be recombined and constructed;

[0074] The primers involved in the construction of the Rep-CAP vector of the above-mentioned AAV capsid protein mutant are shown in Table 2:

[0075] Table 2 Primer sequences

[0076] Primer name Primer sequence (5'->3') Cap-f CATCTTTGAACAATAAATGATTTAAATCAGGTATG cap-r TCAACTGAAACGAATCAACCGGTTT YJ561-R GACCTGGAGGTCTCCTTCCAGGTTAGGGCTCTGGAGGTTGGTAGATACAGAACCATACT YJ561-F GAGAGGAGACCTCCAGGTCCTGGCTGCTCAAGCAGCTACCGCAGAT YJ563-R ATGAGCGAGGTCTCCTCTTGCAGAAGCGCTCTGGAGGTTGGTAGATACAGAACCATACT YJ563-F AGAGGAGACCTCGCTCATCTGACAGCTCAAGCAGCTACCGCAGAT YJ565-R ATAGTAGCGAGGTCTCCTCTTCGACCAGTGCTCTGGAGGTTGGTAGATACAGAACCATACT YJ565-F AGAGGAGACCTCGCTACTATCCATGCTCAAGCAGCTACCGCAGAT YJ567-R TTGGAAGACATGTCTCCTCTTCGAGAGATGCTCTGGAGGTTGGTAGATACAGAACCATACT YJ567-F AGAGGAGACATGTCTTCCAATCCTGCTCAAGCAGCTACCGCAGAT YJ562-R GACCTGGAGGTCTCCTCTCAGGTTGCTCTGGAGGTTGGTAGATACAGAACCATACT YJ562-F GAGAGGAGACCTCCAGGTCCTGGCTCAAGCAGCTACCGCAGAT YJ564-R ATGAGCGAGGTCTCCTCTTGCAGAGCTCTGGAGGTTGGTAGATACAGAACCATACT YJ564-F AGAGGAGACCTCGCTCATCTGGCTCAAGCAGCTACCGCAGAT YJ566-R ATAGTAGCGAGGTCTCCTCTTCGACCGCTCTGGAGGTTGGTAGATACAGAACCATACT YJ566-F AGAGGAGACCTCGCTACTATCGCTCAAGCAGCTACCGCAGAT YJ568-R TTGGAAGACATGTCTCCTCTTCGAGAGCTCTGGAGGTTGGTAGATACAGAACCATACT YJ568-F AGAGGAGACATGTCTTCCAATGCTCAAGCAGCTACCGCAGAT

[0077] Take a clean 200uL PCR tube, mark it and place it on an ice box. Prepare the reaction solution with the above enzyme-cut backbone and each target fragment at a backbone: fragment molar ratio of 1:3, and react in a PCR instrument at 50℃ for 30min for recombination connection. Take 50μL competent cells and thaw them on ice. Mix 10μL of the connection product with DH5α competent cells and place them on ice for 20-30 minutes; heat shock at 42℃ for 45 seconds; quickly place them on ice for 2 minutes, add 400μL of recovery SOC medium (without antibiotics), and culture at 37℃, 200rpm for 1h; evenly apply it to Amp resistance plate (50μg / ml) and culture at 37℃ for 14 hours. Select monoclonal bacteria, expand the culture in 4ml liquid LB medium (Amp+ resistance), and culture at 37℃ for 14 hours.

[0078] The bacterial solution was centrifuged at 12000rpm for 1 minute, and the supernatant medium was discarded; 250μL of buffer P1 / RNaseA mixture was added, and the bacteria were resuspended by high-speed vortexing; 250μL of buffer P2 was added, and the solution was inverted 8-10 times; 350μL of buffer P3 was added, and the solution was immediately inverted and mixed 8-10 times to completely neutralize the solution; centrifuged at 13000rpm for 10 minutes, and the supernatant was passed through the column; centrifuged at 12000 for 1 minute, and the waste liquid was discarded, 500μL of PW1 was added, and the waste liquid was discarded; 600μL of PW2 was added, and the supernatant was discarded; 600μL of PW2 was added, and the supernatant was discarded; the supernatant was idling at 12000rpm for 2 minutes; 30-50μL of 55℃ preheated eluent was added, and the solution was allowed to stand for 2 minutes, and the solution was centrifuged at 12000rpm for 1 minute. Use a micro-volume nucleic acid quantifier to detect the concentration.

[0079] The obtained plasmid was tested for concentration, and 10 μL of the positive plasmid identified by enzyme digestion was sent for sequencing, and the positive plasmid was stored at -20°C. The sequencing results showed that the obtained plasmid could encode the variant capsid protein VP1. Finally, according to the amount of virus required for the later test, the relevant Helper plasmid, the Rep-Cap plasmid of each group (control serotype AAV2, AAV9, MyoAAV 4A, 109 and mutants 1-8) plasmid and the GOI plasmid (ssAAV.CAG.Fluc-2a-eGFP.WPRE.SV40pA) were extracted.

[0080] (3) Packaging and purification of mutant serotype viruses

[0081] The Rep-Cap plasmid of each group (control serotype and AAV mutants 1-8), the GOI plasmid expressing firefly luciferase (Fluc) and green fluorescent protein (EGFP), and the pHelper plasmid were co-transfected into HEK-293T cells in appropriate amounts, and the AAV virus was purified by iodixanol gradient ultracentrifugation. The virus titer was measured and 1E+12GC / mL-1E+13GC / mL was considered appropriate, and the cells were placed at -80°C for use.

[0082] Example 2: Comparative test of various indicators of mutant serotypes

[0083] (1) Mouse injection and dissection

[0084] The animal experiment used 6-8 week old Balb / c male mice. The relevant viruses were prepared according to the designed experimental and control groups (mutant 5 had low virus yield, so only one mouse was used). Each mouse in each group was injected with 2E11GC virus, and in vivo imaging was performed 14 and 21 days after injection. Animal dissection and organ sampling were performed 21 days after injection. The samples were quickly frozen in liquid nitrogen and used for subsequent RNA extraction and WB detection experiments.

[0085] (2) In vivo imaging

[0086] The mice were imaged in vivo 14 and 21 days after injection. The mice were weighed before imaging, and the animal in vivo imaging system (AniView100, Guangzhou Bolu Teng Biotechnology Co., Ltd.) was turned on in advance and the small animal anesthesia system was debugged. Set the image saving path, shooting parameters and other information. Each mouse was intraperitoneally injected with luciferin (15 mg / mL, Promega, E1605) at a dose of 150 mg / kg, i.e. 10 uL / g, and imaging began 10 minutes after injection of each group. The shooting of each batch of mice was completed in the order of supine, left lateral, prone, and right lateral. After the shooting is completed, the mice are put back into the cage to wait for awakening from anesthesia, and the state of the mice is observed for any abnormalities.

[0087] (3) Detection of target gene mRNA expression level

[0088] (3.1) Total RNA extraction and reverse transcription:

[0089] Sample grinding: Pre-cool the grinder 10 minutes in advance and set the grinding parameters. Take out the animal tissue sample stored in the -80℃ refrigerator, take about 50-100mg of tissue, cut it into soybean size in a sterile petri dish, and transfer it to a 1.5mlRNase-free EP tube. Add an appropriate amount of TransZolUp according to the ratio of 1ml TransZol Up per 50-100mg tissue, then add two clean and sterile 3mm grinding steel beads and wrap it with sealing film. Place the sample in the 24-hole grinding adapter and balance it, tighten the screw, and press the cover button. Start the grinding program, take out the sample after the instrument runs, observe the sample grinding particle size, if there is no large piece of tissue left, you can proceed with the subsequent extraction operation. The ground sample is centrifuged at 4℃, 12,000×g for 2min, and the supernatant is transferred to a new 1.5mlRNase-free EP tube with the corresponding label.

[0090] Extraction of total RNA from samples: Refer to the instructions of TransZol Up Plus RNA Kit (Beijing Quanshijin, catalog number: ER501) for details. For every 1 ml of TranZol up, add 0.2 ml of RNA Extraction Agent, shake vigorously for 5 min; centrifuge at 12,000×g, 4°C for 10 min. At this time, the sample is divided into three layers. Transfer the colorless aqueous phase to a new 1.5ml RNase-free EP tube, add an equal volume of anhydrous ethanol (precipitate may appear at this time), and gently invert to mix; add the obtained solution and precipitate to the centrifuge column, centrifuge at 12,000×g at room temperature for 30s, and discard the filtrate; add 500μL CB9, centrifuge at 12,000×g at room temperature for 30s, and discard the filtrate; repeat the above steps once; add 500μL WB9, centrifuge at 12,000×g at room temperature for 30s, and discard the filtrate; repeat the above steps once; centrifuge at 12,000×g at room temperature for 2min to completely remove residual ethanol; place the centrifuge column in a 1.5ml RNase-free EP tube, add 30-50μL (depending on the size of the tissue) RNase-free Water in the center of the centrifuge column, and let it stand at room temperature for 1min; centrifuge at 12,000×g at room temperature for 1min to elute RNA;

[0091] Determination of sample nucleic acid concentration: Use a micro-nucleic acid quantifier detector to detect RNA concentration, record the concentration, OD260 / 280, OD260 / 230, and store the RNA at -80°C.

[0092] Reverse transcription: Each RNA sample was used All-in-One First-Strand cDNASynthesis SuperMix for qPCR (One-Step gDNA Removal) (Beijing Quanshijin, Catalog No.: AE341-03). For specific steps, please refer to the instruction manual.

[0093] (3.2) Quantitative PCR (qPCR) experiment:

[0094] Each group of cDNA was used as a template, and the qPCR system was configured according to the instructions of 2x SYBR Green qPCR Master Mix (Bimake, Cat. No.: B21203):

[0095] Table 3 qPCR system

[0096] Reagents Usage 2x SYBR Green qPCR Master Mix 10ul cDNA template 2ul Upstream primer (10 μM) 1ul Downstream primer (10 μM) 1ul ROX Reference Dye 0.4ul Deionized water Up to 20ul

[0097] Table 4 qPCR program settings

[0098]

[0099] Table 5 qPCR primer sequences

[0100] Primer name Primer sequence (5'->3') Fluc2-qPCR-F1 AACCAGCGCCATTCTGATCA Fluc2-qPCR-R1 TCGGGGTTGTTAACGTAGCC GAPDH-F2 CAGGAGAGTGTTTCCTCGTCC GAPDH-R2 TTCCCATTCTCGGCCTTGAC

[0101] (3.3) Data analysis

[0102] According to the Ct value of each group, according to formula 2 -ΔΔct Calculate the relative expression.

[0103] (4) Western Blot detection of target protein expression level

[0104] Sample pretreatment: Cut the tissue into small pieces, weigh and record the weight, place in 1.5mL or 2mL centrifuge tubes, label the tubes, freeze at -80℃ for later use, and precool the cryo-grinder; dissolve in RIPA (Biyuntian, P0013B) lysis buffer (add PMSF within a few minutes before use to make the final concentration of PMSF 1mM);

[0105] Add the above complete lysis solution at a ratio of 150-250 μL lysis solution per 20 mg tissue, then add two sterilized zirconium oxide grinding beads, and grind the sample directly in the lysis solution (brain, spinal cord and other tissue samples: temperature -20°C, frequency 70 Hz, 50 s pause 10 s for each oscillation, 3-4 cycles; muscle, liver and other samples: temperature -20°C, frequency 70 Hz, 50 s pause 10 s for each oscillation, 5-7 times). After the sample is ground, centrifuge the sample in a refrigerated centrifuge at 4°C, 12,000×g for 5-10 minutes, then take the supernatant and transfer it to a new sterilized EP tube and store at -20°C or -80°C;

[0106] Protein concentration determination: After determining the protein concentration according to the method in the modified BCA protein concentration determination kit (Shenggong, Cat. No. C503051), take an appropriate amount of protein homogenate sample according to the required amount, mix it with the corresponding amount of 5X SDS-PAGE protein loading buffer, boil it in a boiling water bath for 10 minutes, centrifuge it at low speed for a while after cooling, and wait for loading.

[0107] WB (Western Blot) detection:

[0108] A.SDS-PAGE electrophoresis: Determine the appropriate loading volume according to the protein concentration and expression level, which should be less than 20μL / well. The loading volume of tissue homogenate protein is about 20-50μg. The specific operation process of electrophoresis is as follows: Pull out the comb on the precast gel, install the gel into the electrophoresis tank, add electrophoresis buffer to the inner and outer tanks, add the newly prepared buffer to the inner tank, and check for leaks. If there is no leak, add electrophoresis buffer to the outer tank; Load an appropriate amount of processed protein sample, use the pre-stained standard protein as a reference, and perform 100V constant voltage electrophoresis on the Tianneng electrophoresis device for 100 minutes until bromophenol blue reaches the bottom of the gel. Turn off the power, carefully remove the precast gel plate, remove the gel, and place it in the transfer buffer and wait for subsequent operations;

[0109] B. Transfer: Cut 6 filter papers and 1 PVDF membrane according to the gel area. Soak the PVDF membrane in methanol for 5-10 seconds, then transfer to the transfer buffer and soak for 5 minutes. The filter paper is also pre-wetted in the transfer buffer; install the transfer device: negative electrode (blackboard) - sponge - 3 layers of wet filter paper - gel - PVDF membrane - 3 layers of wet filter paper - sponge - positive electrode (transparent plate). Drive away bubbles in each layer to avoid affecting the transfer effect, clamp the bracket, and put it into the electrotransfer tank; use 100V constant voltage ice bath to transfer the membrane for 100 minutes; judge whether the transfer is successful or not based on whether the pre-stained protein molecular weight standard band is completely transferred to the PVDF membrane; soak the transferred PVDF membrane in PBST solution and wash at room temperature for 5 minutes, cut the PVDF membrane as needed, and be careful not to let the PVDF membrane dry during the cutting process;

[0110] C. Blocking and antibody incubation: Incubate the PVDF membrane with blocking solution (5% skim milk powder) at room temperature for 2 hours or at 4°C overnight; transfer the blocked PVDF membrane into primary antibody hybridization solution (Luciferase Rabbit Polyclonal antibody (Proteintech, 27986-1-AP) at 1:2000; GADPH Rabbit Polyclonal antibody (Proteintech, 10494-1-AP) at 1:2000; Rabbit GFP tag Polyclonal antibody (Proteintech, 50430-2-AP) at 1:2000) and add them to 4 ml QuickBlock TMThe washed PVDF membrane was transferred to the secondary antibody hybridization solution (HRP-conjugated Affinipure Goat Anti-Rabbit IgG (H+L) (Proteintech, SA00001-2) at a ratio of 1:5000 and added to 4 ml QuickBlock TM Western secondary antibody diluent (Biyuntian, P0258), i.e., secondary antibody hybridization solution), incubate at room temperature for 1 h, and wash the membrane with PBST for 3 × 5 min;

[0111] D. Color development: Mix equal volumes of Solution A and Solution B of the ECL chemiluminescence kit, shake and mix thoroughly, then drop the luminescent solution on the PVDF membrane so that the entire PVDF membrane is covered with the luminescent solution. Adjust different exposure times to make the protein bands clear and use the instrument to take pictures.

[0112] (5) Cynomolgus monkey injection, puncture and NGS analysis

[0113] Male cynomolgus monkeys of about 4 years old were used in the animal experiment, and they were used after passing the AAV2 and AAV9 neutralizing antibody tests before the experiment. Different serotype mutants and control serotypes were packaged with different GOIs (ssAAV.CAG.Fluc.WPRE.polyA vectors carrying different barcodes), and intravenously injected with equal viral amounts (the total dose of mixed viruses was controlled to be 3E13GC / Kg). Muscle punctures and liver punctures were performed at different sites at 2 weeks and 4 weeks, respectively. Finally, tissue RNA extraction, RT-PCR and NGS sequencing were performed. By analyzing the NGS data, the multiples of each serotype mutant relative to the control AAV9 were determined.

[0114] The results of the above-mentioned multiple verification experiments show that the serotypes with different ligand peptides and different insertion strategies, although the sequences all contain the RGD motif, have very different effects. For example, the serotype mutants 1-4 with longer inserted peptides are significantly better than the mutants 5-8 with shorter lengths. In addition, mutant 4 has the best targeting effect on mouse muscle, followed by mutants 2 and 3. In the gastrocnemius, quadriceps, triceps, biceps and abdominal muscles, the infection effect of mutant 4 is 53.84 times, 55.76 times, 257.58 times, 12.63 times and 54.47 times that of AAV9, respectively. Among them, the effect in the biceps and abdominal muscles is better than that of the control MyoAAV 4A, which may be related to the low liver tropism skeleton developed in the early stage (109 with the same skeleton has a similar trend). In cardiac tissue, the effect of mutant 4 was not as good as mutant 2 and mutant 3 (10.16 times and 10.36 times that of AAV9, respectively) and the control MyoAAV 4A, indicating that it has stronger muscle specificity. In mouse liver, the characteristics of the low liver-tropic skeleton are particularly obvious. Different targeting peptides using this skeleton are significantly lower than AAV9 and MyoAAV 4A based on the AAV9 skeleton. The liver expression of mutants 1-4 is 0.02 times, 0.01 times, 0.01 times and 0.01 times that of AAV9, respectively. The mRNA effects of the above serotype mutants on muscle and liver are basically consistent with the results of in vivo imaging and WB, which support each other. In addition, the targeting effects on different tissues such as the brain, lungs, and kidneys are basically lower than AAV9, except for a few serotypes that are slightly higher than AAV9 (for example, mutant 2 in the brain is 1.85 times higher than AAV9, and mutant 5 in the kidneys is 1.82 times higher than AAV9). Especially in the brain and kidneys, the differences between different serotypes are not obvious.

[0115] In order to further illustrate the potential clinical use value of the serotype of the present invention, the mutant and control serotype viruses were intravenously injected into cynomolgus monkeys in an equal amount, and finally the expression strength relationship of different serotypes in muscle and liver tissues was determined by NGS analysis. Significantly different from the mouse results, the best mutant 4 serotype in mouse muscle was poor in cynomolgus monkeys, but the mutant 3 serotype was the best among many mutant individuals. The existence of this difference may be due to species differences. In addition, consistent with the mouse results, the serotype mutants 1-4 with longer inserted peptides are significantly better than the mutants 5-8 with shorter lengths, which is also one of the innovative points of the present invention. Another point consistent with the mouse results is the liver tropism of different serotypes. 109 and other mutants using a low liver tropism skeleton, compared with AAV9 and MyoAAV 4A using an AAV9 skeleton, all show the characteristics of low liver tropism, and the trends of the 2-week and 4-week results are consistent.

[0116] In summary, by using peptides containing RGD motifs that exist in nature, such as peptides in certain viruses or peptides in certain integrin ligands, and using different construction strategies, we screened out peptides that can better match and be compatible with the low liver-tropism AAV backbone developed in the early stage, and obtained multiple serotype mutants with better muscle targeting than AAV9. The mRNA and protein expression levels verified that they have good effects in muscle tissues such as gastrocnemius, quadriceps, triceps, biceps and abdominal muscles, and have lower liver tropism and good specificity. These mutants can further evaluate their clinical application value and safety, provide more useful and optional vector tools for gene therapy of muscle diseases, and benefit a large number of patients.

[0117] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. An adeno-associated virus capsid protein mutant, characterized in that: Its amino acid sequence is shown in SEQ ID No.

2.

2. A nucleic acid encoding the adeno-associated virus capsid protein mutant according to claim 1.

3. The nucleic acid according to claim 2, characterized in that The nucleotide sequence thereof is shown as the nucleotide sequence shown in SEQ ID No.

10.

4. An expression vector, characterized in that: It comprises the nucleic acid according to claim 2 or 3.

5. A host cell, characterized in that It comprises the expression vector according to claim 4.

6. A host cell, characterized in that It expresses the adeno-associated virus capsid protein mutant described in claim 1.

7. A recombinant adeno-associated virus, characterized in that: It includes the adeno-associated virus capsid protein mutant described in claim 1.

8. The recombinant adeno-associated virus according to claim 7, characterized in that Heterologous genes of interest are also included.

9. The recombinant adeno-associated virus according to claim 8, characterized in that The heterologous target gene encodes any gene product of interfering RNA, aptamer, endonuclease, and guide RNA.

10. A method for preparing a recombinant adeno-associated virus, characterized in that: The method comprises introducing at least the following components into a host cell: 1) the nucleic acid according to claim 2 or 3 or the expression vector according to claim 4, 2) an adeno-associated virus helper plasmid, and 3) a plasmid containing two terminal inverted repeat sequences.

11. rAAV prepared by the method according to claim 10.

12. A pharmaceutical composition comprising the recombinant adeno-associated virus according to any one of claims 7 to 9 or the rAAV according to claim 11, and a pharmaceutically acceptable carrier.

13. Use of the adeno-associated virus capsid protein mutant according to claim 1, the expression vector according to claim 4, the host cell according to claim 5 or 6, the recombinant adeno-associated virus according to any one of claims 7 to 9, and the rAAV according to claim 11 in the preparation of a drug or preparation for delivering a gene product to a subject's cells or tissues, characterized in that: The cells are muscle cells or heart cells; the tissues are muscle tissues or heart tissues.

Images