Fusarium pseudograminearum effect protein FpE01 and application thereof in wheat disease resistance

Abstract

The invention relates to the technical field of genetic engineering, and discloses a fusarium pseudograminearum effect protein FpE01 and application thereof in wheat disease resistance. The amino acid sequence of the Fusarium pseudograminearum effect protein FpE01 is as shown in SEQ ID NO. 1. The nucleotide sequence of the coding gene of the Fusarium pseudograminearum effect protein FpE01 is as shown in SEQ ID NO. 2. The fusarium pseudograminearum effect protein FpE01 and the application thereof in wheat disease resistance are adopted, a knockout mutant of the coding gene FpE01 is constructed, the toxic function of the coding gene FpE01 in the process that wheat is infected by fusarium pseudograminearum is determined, then the effect protein is utilized to construct a wheat strain resistant to stem rot, and the wheat strain resistant to stem rot is obtained. And an excellent wheat material is provided for cultivation of basal stem rot resistant varieties.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, in particular to a pseudo-Fusarium graminearum effector protein FpE01 and an application thereof in wheat disease resistance. Background Art

[0002] Wheatcrown rot (WCR), caused by Fusarium pseudograminearum, is an important soil-borne disease in wheat production. The main symptoms are browning and rot at the base of the wheat rhizome, and severe cases can cause seedling blight and white spikes. Wheatcrown rot occurs in Australia, the United States, Canada and other countries and causes serious damage. In normal years, wheatcrown rot causes an average yield loss of about 9.5% and can reach 35% in epidemic years. In recent years, the disease has been prevalent in the winter wheat areas of Huanghuaihai and has shown a trend of increasing year by year. At present, the disease rate in Henan and Hebei provinces is as high as 65.1% and 81.4%, respectively, which has seriously threatened the safe production of wheat. Due to the lack of understanding of the pathogenic mechanism of the pathogen, it is difficult to propose a long-term and efficient prevention and control strategy, and the disease is getting worse year by year. Therefore, it is an urgent need to analyze the pathogenic mechanism of Fusarium pseudograminearum infecting wheat as soon as possible for the development of new technologies for targeted prevention and control and the breeding of resistant varieties.

[0003] During the process of infecting plants, pathogens secrete a large number of effector proteins into host cells, which play an important role in the pathogenic processes such as invasion, colonization and expansion of plants. The interaction mechanism between pathogen effector proteins and host target proteins usually involves multiple molecular level interactions. The metabolic pathways where their interaction targets are located are mostly important disease resistance and physiological metabolic pathways of host plants. However, there are also obvious differences in the effector proteins of different types of pathogens. Therefore, the study of the interaction between effector proteins and hosts is an important way to deeply analyze the plant disease resistance mechanism and create resistant materials. At present, little is known about the biochemical activity of the effector proteins of Pseudomonas graminearum and how they regulate the immune response of plants, especially there are no reports on the effector proteins of Pseudomonas graminearum. Summary of the invention

[0004] The purpose of the present invention is to provide a pseudo-Fusarium graminearum effector protein FpE01 and its application in wheat disease resistance, construct a knockout mutant of the encoding gene FpE01, determine the toxic function of the encoding gene FpE01 in the process of pseudo-Fusarium graminearum infecting wheat, and then use the effector protein to construct a wheat line resistant to stem base rot, providing excellent wheat materials for the cultivation of stem base rot resistant varieties.

[0005] To achieve the above objectives, the present invention provides a pseudo-Fusarium graminearum effector protein FpE01, and the amino acid sequence of the effector protein FpE01 is shown in SEQ ID NO.1.

[0006] The present invention also provides a gene encoding the above-mentioned pseudo-Fusarium graminearum effector protein FpE01, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO.2.

[0007] The present invention also provides the use of the above-mentioned pseudo Fusarium graminearum effector protein FpE01 or the above-mentioned encoding gene in wheat resistance to stem base rot.

[0008] Furthermore, the effector protein FpE01 plays a role in the interaction between Fusarium graminearum and wheat.

[0009] Furthermore, the coding gene was upregulated during the infection of wheat by F. graminearum.

[0010] The present invention also provides the use of the above-mentioned Pseudofus graminearum effector protein FpE01 or the above-mentioned encoding gene in reducing the pathogenicity of Pseudofus graminearum.

[0011] The present invention also provides the use of the above-mentioned pseudo Fusarium graminearum effector protein FpE01 or the above-mentioned encoding gene in cultivating wheat varieties resistant to stem base rot.

[0012] The present invention also provides a method for breeding a wheat variety resistant to stem base rot, wherein the silent fragment of the above coding gene is transferred into a wheat material to obtain a wheat variety with a silent coding gene.

[0013] Furthermore, the nucleotide sequence of the silencing fragment encoding the gene is shown in SEQ ID NO.3.

[0014] Furthermore, a silencing fragment interference vector of the coding gene is constructed and transferred into wheat immature embryos through Agrobacterium-mediated transformation to obtain transgenic wheat with silencing coding gene.

[0015] The advantages and positive effects of the pseudo-Fusarium graminearum effector protein FpE01 and its application in wheat disease resistance of the present invention are:

[0016] 1. Reverse genetics was used to analyze the gene FpE01 encoding the effector protein of F. graminearum. The gene FpE01 was upregulated during the infection of stem base rot fungus. The gene FpE01 was knocked out using gene knockout technology to determine the toxic function of the gene FpE01 during the infection of F. graminearum. The gene FpE01 was cloned into an interference vector and transformed into wheat embryos using Agrobacterium-mediated transgenic technology. The transgenic wheat plants obtained showed resistance to F. graminearum.

[0017] 2. The transgenic plants with silenced coding gene FpE01 in the present invention show resistance to Fusarium graminearum. Therefore, the effector protein can be used to create strains resistant to stem base rot, providing excellent wheat materials for the cultivation of stem base rot-resistant varieties.

[0018] 3. Compared with traditional disease-resistant breeding technology, the plant disease-resistant genetic engineering technology of the present invention can break through the reproductive isolation and incompatibility of distant hybridization between species, achieve targeted improvement of target traits in a shorter period of time, and provide more comprehensive, continuous and broad-spectrum protection for crops.

[0019] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a flow chart of the verification method of the pseudo-Fusarium graminearum effector protein FpE01 in cultivating and improving wheat varieties in the embodiment of the present invention;

[0021] Figure 2 Schematic diagram of expression profile analysis of gene FpE01 encoding the effector protein of Pseudomonas graminearum in an embodiment of the present invention;

[0022] Figure 3 This is a schematic diagram of the phenotypic results of knocking out the coding gene FpE01 in an embodiment of the present invention, wherein A is the phenotypic result and B is the disease index;

[0023] Figure 4 The structure diagram of the gene FpE01 interference vector in the embodiment of the present invention;

[0024] Figure 5 This is a schematic diagram of the phenotypic results of the transgenic plants with silenced coding gene FpE01 inoculated with stem base rot fungi in an embodiment of the present invention, WT is a wild-type plant, RNi-L3 and RNi-L5 are two strains of L3 and L5 of the T3 generation of the transgenic plants with silenced coding gene FpE01, wherein A is the phenotypic result and B is the disease index. DETAILED DESCRIPTION

[0025] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0026] Unless otherwise defined, technical or scientific terms used in the present invention shall have the common meanings understood by one having ordinary skills in the field to which the present invention belongs.

[0027] Unless otherwise defined, the instruments, equipment and reagents used in the present invention are conventionally commercially available.

[0028] Source of wild-type strain 2035: isolated and preserved from diseased tissue of wheat stem base in Wuqiao by Fungal Disease Laboratory, Institute of Plant Protection, Hebei Academy of Agricultural and Forestry Sciences.

[0029] Figure 1The present invention provides a method for verifying the function of the gene FpE01 encoding the effector protein of Pseudomonas graminearum, including: S101, obtaining FpE01 transgenic wheat, and performing molecular detection on the obtained FpE01 transgenic wheat; S102, inoculating Pseudomonas graminearum transgenic plants of the T3 generation, identifying the disease resistance of the transgenic plants, and determining the function of the gene FpE01.

[0030] The embodiment of the present invention further provides a method for identifying the function of the effector protein FpE01 of Pseudofus graminearum, including: based on qRT-PCR with microtubule protein β-tubulin (TUB) as an internal reference, real-time quantitative PCR is performed using specific primers of the effector protein gene FpE01 to determine the expression level of the gene FpE01 at different infection times of wheat infected with Pseudofus graminearum; using the gene knockout technology of homologous recombination to knock out the Pseudofus graminearum effector protein FpE01 encoding gene FpE01, the pathogenicity of the knockout mutant is significantly lower than that of the wild type, and the full-length gene of FpE01 is re-introduced into the knockout mutant, the pathogenicity phenotype is restored to the wild type, and the toxicity function of FpE01 during the infection process of Pseudofus graminearum is verified.

[0031] Example 1 Identification and expression pattern of effector genes of Pseudomonas graminearum

[0032] 1.1 Extraction of total RNA from pathogens:

[0033] (1) Sample collection: Soak germinated wheat seeds in 1×10 5 / mL concentration of 2035 (wild-type strain) bacterial solution, soak the seeds for 15 minutes and then air dry naturally. Put the germinated wheat seeds in a glass culture dish and place them in a 25°C incubator for culture. Take samples at four time periods (24h, 48h, 72h, 96h) after inoculation. Quickly store the samples in a -80°C refrigerator for total RNA extraction.

[0034] (2) RNA extraction and first-strand cDNA synthesis: RNA was extracted using RNAprep Pure Kit (Tiangen Company), and the extracted RNA was purified. Then, the first-strand cDNA synthesis kit was used to synthesize the first strand. The operation steps are detailed in the instruction manual.

[0035] (3) Real-time fluorescence quantitative PCR was performed using the wheat-Fusarium graminearum interaction cDNA extracted from samples at different infection time points as a template and the β-tubulin (TUB) gene of Fusarium graminearum as an internal reference gene (FpTUB-F: 5'-CTTACGGCGACCTGAACTACCTTG-3' (SEQ ID NO.4) and FpTUB-R: 5'-AGCGAATCCGACCATGAAGAAGTG-3' (SEQ ID NO.5)). The specific quantitative primers of the effector protein gene FpE01 (FpE01Q-F: 5'-ACCCTACCAAGGTTGATGC-3' (SEQ ID NO.6) and FpE01Q-R: 5'-GTCGGTCCAGAAGGAGAAG-3' (SEQ ID NO.7)) were used to analyze the expression level of gene FpE01 at different infection times of wheat infected with stripe rust. Figure 2 As shown, the PCR reaction system is as follows: TBgreen quantitative Mix 12.5μL, template 2μL, forward primer and reverse primer 0.5μL each, RNA-Free water 9.5μL. The reaction program is as follows: 95℃ pre-denaturation 10min; 95℃, 15s; 60℃, 15s; 72℃, 20s; 40 cycles.

[0036] Figure 2 The expression profile of gene FpE01 at different infection time points after wheat was inoculated with F. graminearum 2035 was presented. Gene FpE01 began to be upregulated 1 day after F. graminearum infected the base of wheat stem, reaching the highest level on the 3rd day, indicating that gene FpE01 may play a toxic function in the interaction between wheat and F. graminearum.

[0037] 1.2 Expression of selected effector proteins in Nicotiana benthamiana:

[0038] The obtained candidate effector gene FpE01 sequence was removed from the front signal peptide, and the candidate effector gene was amplified by PCR using a high-fidelity enzyme. The pYBA1132 plasmid was digested with BamH I and Sal I restriction endonucleases, the PCR product was purified, connected to the pYBA1132 vector by a one-step cloning method, and transferred into Escherichia coli DH5a competent cells; the positive clones were detected using the PCR system of universal primers 1132-F (5'-TTGGTTGAAACAGAAGCGATAA-3' (SEQ ID NO.8)) and 1132-R (5'-TTGGTTGAAACAGAAGCGATAA-3' (SEQ ID NO.9)); the plasmid was extracted according to the instructions of the plasmid mini-extraction kit, and then the plasmid with the correct band was sent to Shenggong Biotechnology Co., Ltd. for sequencing. The sequenced information was compared with the sequence information given by the pseudograminearum Fusarium genome database. The complete correctness of the sequence indicates that the vector construction was successful.

[0039] The constructed recombinant vector FpEP-1132 was transformed into Agrobacterium GV3101 using the electroporation method, and the positive transformants were detected using the universal primers 1132-F and 1132-R. The positive transformants were selected and cultured in LB culture medium containing 50 μg / mL kanamycin at 28°C and 220 r / min for 2 days. The cells were then collected by centrifugation at 4500 r / min for 3 minutes. 10 mL MgCl2 (10 mmol·L -1 ) and then washed with MgCl2 (10 mmol·L -1 ) to OD 600 =0.5. Select tobacco leaves of 4 to 6 weeks old, draw a circle of about 1 cm in diameter on the lower epidermis with a marker, and perform infiltration injection in the circle. The injected tobacco is placed in a constant temperature culture at 25°C, with a photoperiod of 16 hours of light and 8 hours of darkness. Each treatment is repeated in 3 groups, with 9 leaves in each group with basically the same growth conditions. Observe the symptoms of the leaves continuously within 3 to 7 days.

[0040] The candidate effector gene FpE01 can inhibit BAX-induced programmed cell death, which means that this gene may have the toxic function of inhibiting plant defense response and will be used in subsequent experimental research.

[0041] Example 2 Analysis of pathogenic functions of candidate effector genes of Pseudomonas graminearum

[0042] 2.1 Effector gene FpE01 knockout:

[0043] Based on the effector gene FpE01 sequence, the upstream primers 1F / 2R, downstream primers 3F / 4R, detection primers 5F / 6R, hygromycin phosphatase H850-F / H852-R, 7F / H855R and H856F / 8R and complementary primers FpE01C-F / R were designed using Premier 5.0 software. The 5′ ends of primers 2R and 3F have homologous sequences at both ends of hygromycin, and the 5′ end of primer FpE01C-F / R has sequences homologous to both ends of the pFL2 XhoI restriction site. The primer sequences and their related parameters are shown in Table 1.

[0044] Table 1 Primers for knockout of gene FpE01

[0045]

[0046]

[0047] The genomic DNA of wild bacteria 2035 was extracted and used as a template to amplify the upstream and downstream fragments L1 and L2 with primers 1F / 2R and 3F / 4R respectively, and the primers HYG / F+HY / R and YG / F+HYG / R were used to amplify the hygromycin fragments H1 and H2. pCB1003 was used as a template (40 ng / 50 μL), the annealing temperature was set to 63°C and the PCR products were recovered by gel (gel recovery kit Sangon Biotech, the method is described in its instruction manual).

[0048] Overlap PCR step 1, PCR system (without primers): 5μL 10×Tap buffer; 4μL MgCl2; 4μL dNTPs (2.5mM); 40ng each of template 1 (H1+L1) + template 2 (H2+L2); 0.6μL FastPfu enzyme; add sterile water to 50μL. Step 1 program: 95℃, 3min; 95℃, 30s; 64.5℃, 40s; 72℃, 50s (15times); 72℃, 10min; 4℃forever.

[0049] Overlap PCR step 2: Add 1 μL of primers 1F+HY / R and primers YG / F+4R to the step 1, and add 0.3 μL of high-fidelity enzyme. Step 2 program: 95°C, 3 min; 95°C, 30 s; 61.5°C, 40 s; 72°C, 50 s (35 times); 72°C, 10 min; 4°C forever.

[0050] Electrophoresis detection: dilute the correct PCR product 10 times and amplify it with primers 1F+HY / R and YG / F+4R. Detect the target band by gel electrophoresis and concentrate the PCR product (>150μg). The concentrated product is the gene knockout cassette.

[0051] Inoculate the activated wild mushroom 2035 cake into 100mL CMC liquid culture medium and culture for 72h (25℃, 150r / min). Filter the culture medium with a sterile gauze filter (funnel made of gauze) and centrifuge at 4000r / min at room temperature for 8min. Discard the supernatant and transfer the spores to 100mL YEPD liquid culture medium and culture on a constant temperature shaker at 25℃, 175r / min for 12h. Filter the culture medium with a sterile gauze filter and collect the mycelium. Add 0.5g of mycelium to 10mL protoplast buffer and mix according to this ratio. Culture on a constant temperature shaker for 2h (30℃, 90r / min). Filter the enzymatic mixture with a gauze filter sandwiched between two layers of lens paper into a sterile centrifuge tube (50mL) and use 1.2mol·L -1 Rinse with potassium chloride (rinse out more protoplasts). Centrifuge at room temperature at 4000r / min for 6min. Discard the supernatant, add 10mL STC Buffer and gently resuspend, centrifuge at 4000r / min for 6min. Adjust the concentration to 1×10 7 / mL. Add two labeled DNA fusion fragments (5μg~10μg each) to a centrifuge tube (50mL) containing 200μL protoplasts, mix well, and let stand at room temperature for 20min. Add 1mL of 40% PTC to the tube, flip and mix well, and let stand at room temperature for 20min. Then add 5mL of TB3 containing 50g / mL ampicillin, and finally place it on a shaker at 25℃, 90r / min overnight. After the mycelium is clumped, centrifuge and discard the supernatant, add regeneration semi-solid culture medium containing hygromycin (120μL / mL), mix well and pour on a plate. Continue to culture at 25℃ until single colonies grow. Pick single colonies one by one and inoculate them on PDA medium containing hygromycin (120μL / mL). The colonies that can finally grow are transformants.

[0052] Using genomic DNA as a template, the pair of primers FpE01 / CF+FpE01 / CR was used to amplify the gene fragment containing its own promoter and termination sequence, and the PCR product was concentrated and dissolved in sterile water. The extracted pHZ2 plasmid and the concentrated PCR product were double-digested with restriction endonucleases Pst I and Bam HI (fermentas company), and the system was as follows: 5μL of 10×Greenbuffer, 2μg of plasmid or PCR product, 2.5μL of PstI, 2μL of Bam HI, and supplemented to 50μL with sterile water; digestion at 37℃ for 8h, and inactivation of the endonuclease at 80℃ for 20min; the digestion product was recovered and purified, and dissolved in sterile water. The linear vector pHZ100 recovered from the gel and the insert fragment were connected with ligase T4, and the system and conditions were as follows: 100ng of Vector, 5μL of Insert DNA and 2μL of 10×ligase buffer, and supplemented to 20μL with sterile water. Connection conditions: The connection was placed in a 4℃ refrigerator for more than 2 days, and the enzyme was inactivated at 80℃ for 20 minutes. After the initial screening with hygromycin, the transformants were tested by PCR with primers 5F+6R. The transformants with positive clones were observed for phenotype on PDA medium. When the transformant phenotype was wild-type, it could be used for subsequent experiments.

[0053] 2.2 Toxicity determination of mutants:

[0054] The mutants and wild-type strains were cultured on PDA plates for 7 days, and then the plates were punched with a 6-mm-diameter cork puncher and placed in 100 mL CMC liquid medium. The plates were shaken and cultured at 25°C and 170 rpm for 5 to 7 days. The concentration of the spore suspension of each strain was adjusted to 1 × 10 5 / mL was used for wheat inoculation. The germinated wheat seeds were immersed in the spore suspension for 15 minutes, then the bacterial solution was poured out and sown in plastic nutrient pots with sterile sand at the bottom. Each treatment was repeated 3 times, each repeat had 4 pots, and 5 seeds were sown in each pot, which was placed at 22℃ for 12 hours of alternating light and dark. The diseased length of the wheat stem base was measured after 21 days, and the disease index was calculated. The results showed that FPE01 gene knockout caused the pathogenicity of the pathogen to be reduced, indicating that FpE01 and its encoded effector protein play a toxic function in the interaction between stem base rot fungi and wheat ( Figure 3 ).

[0055] Example 3 Cultivation of gene-silenced wheat plants

[0056] This example describes the cultivation of transgenic wheat with the silencing gene FpE01 and the identification of its disease resistance. Figure 1The silencing fragment 1 of the gene FpE01 (SEQ ID NO.3: CGGCCAGTTCAGCATGAACTGGAACGGCAACCGTGGTAACCACGTCGG TGGTAAGGGATGGAACCC) was inserted into two positions of the vector by homologous recombination (one fragment was inserted in the forward direction and the other was inserted in the reverse complementary direction, thereby forming a hairpin structure) to obtain the gene FpE01 interference vector (such as Figure 4 As shown in the figure, the transgenic plants with gene FpE01 silenced were obtained by Agrobacterium-mediated genetic transformation, and the transgenic plants were tested by PCR. The L3 and L5 strains of the T3 generation were selected and inoculated with the wild-type strain 2035 of F. graminearum. The results showed that the transgenic plants with gene FpE01 silenced showed resistance to F. graminearum ( Figure 5 ).

[0057] Therefore, the present invention adopts the above-mentioned Fusarium graminearum effector protein FpE01 and its application in wheat disease resistance, constructs a knockout mutant of the encoding gene FpE01, determines the toxic function of the encoding gene FpE01 during the infection of wheat by Fusarium graminearum, and then uses the effector protein to construct a wheat line resistant to stem base rot, providing excellent wheat materials for the cultivation of stem base rot resistant varieties.

[0058] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. The pseudo-Fusarium graminearum effector protein FpE01 is characterized by: The amino acid sequence of the effector protein FpE01 is shown in SEQ ID NO.

1.

2. The gene encoding the pseudo-Fusarium graminearum effector protein FpE01 according to claim 1, characterized in that: The nucleotide sequence encoding the gene is shown in SEQ ID NO.

2.

3. Use of the pseudo-Fusarium graminearum effector protein FpE01 as described in claim 1 or the encoding gene as described in claim 2 in wheat resistance to stem base rot.

4. The use according to claim 3, characterized in that: The effector protein FpE01 plays a role in the interaction between Fusarium graminearum and wheat.

5. Use of the effector protein FpE01 of Pseudomonas graminearum according to claim 1 or the encoding gene according to claim 2 in reducing the pathogenicity of Pseudomonas graminearum.

6. Use of the pseudo-Fusarium graminearum effector protein FpE01 according to claim 1 or the encoding gene according to claim 2 in breeding wheat varieties resistant to stem base rot.

7. A method for breeding wheat varieties resistant to stem rot, characterized in that: The silent fragment of the coding gene described in claim 2 is transferred into wheat materials to obtain a wheat variety with silent coding genes.

8. The cultivation method according to claim 7, characterized in that: The nucleotide sequence of the silencing fragment encoding the gene is shown in SEQ ID NO.

3.

9. The cultivation method according to claim 7, characterized in that: A silencing fragment interference vector of the coding gene is constructed and transferred into wheat immature embryos through Agrobacterium-mediated transformation to obtain transgenic wheat with silencing coding genes.

Images