Transcription factor GATA3 interacting with promoter of plant melatonin synthetase gene COMT1 and application of transcription factor GATA3

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to a transcription factor GATA3 interacting with a promoter of a plant melatonin synthetase gene COMT1 and application of the transcription factor GATA3. The transcription factor GATA3 interacting with the promoter of the plant melatonin key synthetase gene COMT1 is obtained by adopting a yeast one-hybridization method, the transcription factor GATA3 is a regulatory factor at the upstream of the COMT1 gene and has an important regulation effect on synthesis of melatonin in plants, and the application of the transcription factor GATA3 is beneficial to cultivation of high-yield melatonin transgenic plants.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and specifically relates to a transcription factor GATA3 interacting with a promoter of a plant melatonin synthase gene COMT1 and an application thereof. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention, and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] Melatonin (MLT), also known as N-acetyl-5-methoxytryptamine, is an indole tryptamine hormone that was first discovered in the pineal gland of cattle. It was later found to be widely present in humans, animals, microorganisms, and plants, and plays an important hormone regulatory function. In animals and humans, melatonin can maintain the circadian rhythm of physiological rhythm activities and is conducive to sleep; it also has the effects of increasing the body's immune function, anti-aging, inhibiting tumor cell growth, and relieving mental stress. In higher plants, melatonin is not only involved in regulating important growth and development processes such as seed germination, root growth, leaf aging, flowering and fruit ripening, but also in the response and regulation of plants to biological and abiotic stresses such as heavy metals, salt, low temperature, high temperature, drought, and pathogens.

[0004] Animals, including humans, can take melatonin from plants containing melatonin, which plays a physiological and health-care role in the body. However, the melatonin content in plants is very low, so increasing the melatonin content in plants is not only beneficial to the growth and development of the plants themselves, but also to human health. The synthesis pathway of melatonin in plants is very clear, but there is relatively little research on the regulation of melatonin content. Summary of the invention

[0005] In order to overcome the above problems, the present invention provides a transcription factor GATA3 that interacts with the promoter of the plant melatonin synthase gene COMT1 and its application.

[0006] In order to achieve the above technical objectives, the present invention adopts the following technical solutions:

[0007] The first aspect of the present invention provides a transcription factor GATA3, which is a protein encoded by a polynucleotide with a nucleotide sequence as shown in SEQ ID NO: 1.

[0008] The nucleotide sequence shown in SEQ ID NO:1:

[0009]

[0010] The second aspect of the present invention provides a polynucleotide encoding the transcription factor GATA3 described in the first aspect.

[0011] The third aspect of the present invention provides a recombinant expression vector, which contains the polynucleotide described in the second aspect.

[0012] In one or more embodiments, the recombinant expression vector is obtained by effectively connecting the above-mentioned polynucleotide to an expression vector, and the expression vector is any one or more of a viral vector, a plasmid, a bacteriophage, a cosmid or an artificial chromosome; the viral vector may include an adenoviral vector, a retroviral vector or an adeno-associated viral vector, and the artificial chromosome includes a bacterial artificial chromosome, a bacteriophage P1-derived vector, a yeast artificial chromosome or a mammalian artificial chromosome; preferably, the expression vector is a plasmid, and in a specific embodiment of the present invention, the plasmid is a pGADT7-Rec-53 yeast cell plasmid.

[0013] The fourth aspect of the present invention provides a host cell, wherein the host cell contains the vector described in the third aspect or the chromosome has the polynucleotide described in the second aspect integrated therein or expresses the transcription factor GATA3 described in the first aspect.

[0014] In one or more embodiments, the host cell can be a prokaryotic cell or a eukaryotic cell.

[0015] Preferably, the host cell is any one or more of a bacterial cell or a fungal cell;

[0016] wherein the bacterial cell is any species within the genus Escherichia, Agrobacterium, Bacillus, Streptomyces, Pseudomonas or Staphylococcus;

[0017] Further preferably, the bacterial cell is Escherichia coli (such as Escherichia coli BL21 (DE3)), Agrobacterium tumefaciens (such as GV3101), Agrobacterium rhizogenes, Bacillus subtilis, Bacillus cereus or Pseudomonas sp.

[0018] The fungal cells include yeast (such as Pichia pastoris) and the like.

[0019] The fifth aspect of the present invention provides the use of the transcription factor GATA3 described in the first aspect, the polynucleotide described in the second aspect, and the recombinant expression vector described in the third aspect in regulating the expression of the plant melatonin synthase gene COMT1.

[0020] In one or more embodiments, the plant is preferably cucumber.

[0021] In one or more embodiments, the transcription factor GATA3 described in the first aspect interacts with the promoter of the plant melatonin synthase gene COMT1 to regulate the expression of the plant melatonin synthase gene COMT1, wherein the nucleotide sequence of the plant melatonin synthase gene COMT1 is shown in SEQ ID NO:2.

[0022] The nucleotide sequence shown in SEQ ID NO:2:

[0023]

[0024] The sixth aspect of the present invention provides the use of the transcription factor GATA3 described in the first aspect, the polynucleotide described in the second aspect, and the recombinant expression vector described in the third aspect in regulating melatonin synthesis in plants.

[0025] In one or more embodiments, the transcription factor GATA3 described in the first aspect interacts with the promoter of the plant melatonin synthase gene COMT1 to regulate the expression of the plant melatonin synthase gene COMT1, thereby regulating the synthesis of melatonin in plants, wherein the nucleotide sequence of the plant melatonin synthase gene COMT1 is shown in SEQ ID NO:2.

[0026] The seventh aspect of the present invention provides the use of the transcription factor GATA3 described in the first aspect, the polynucleotide described in the second aspect, and the recombinant expression vector described in the third aspect in cultivating high-yield melatonin transgenic plants.

[0027] In an eighth aspect of the present invention, a melatonin synthase gene COMT1 promoter probe is provided, the nucleotide sequence of which is shown in SEQ ID NO:3 or SEQ ID NO:4.

[0028] The beneficial effects of the present invention are:

[0029] The present invention adopts the yeast single hybrid method to obtain the transcription factor GATA3 that interacts with the promoter of the plant melatonin key synthase gene COMT1. The transcription factor GATA3 is a regulatory factor upstream of the COMT1 gene and has an important regulatory effect on the synthesis of melatonin in plants. Its application is conducive to the cultivation of high-yield melatonin transgenic plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0031] Figure 1 This is a yeast one-hybridization point-to-point verification of GATA3 transcription factor and CsCOMT1 gene; in the SD-UL results, the number of dilution points is 10 0 , 10 -1 , 10 -2 , 10 -3 , 10 -4 ; In the results of SD-UL+100ng / mLAbA, the number of dilution points is 10 0 , 10 -1 , 10 -2 , 10 -3 , 10 -4 ;

[0032] Figure 2 The results of the initial EMSA screening of probes 1, 2 and 3 with protein CsGATA3;

[0033] Figure 3 EMSA interaction between probe 1 and protein CsGATA3;

[0034] Figure 4 EMSA interaction between probe 2 and protein CsGATA3;

[0035] Figure 5 Dual luciferase assay showed that CsGATA3 positively regulated the expression of CsCOMT1. DETAILED DESCRIPTION

[0036] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used in the present invention have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0037] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0038] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.

[0039] In the following examples, unless otherwise specified, the experimental methods were performed according to the instructions of the kit or in a conventional manner.

[0040] Example 1

[0041] Construction of pABAi-COMT1 plasmid:

[0042] (1) COMT1 amplification primers

[0043] (+):CTTGAATTCGAGCTCGGTACtttcacaattgagattgtttcaattttgtaccttctatatg;

[0044] (-):ATACAGAGCACATGCCTCGAccatatacctaatcccctggttggtg;

[0045] Sequencing primers:

[0046] catgccacccaccccctca;

[0047] 2. PCR system

[0048] Prepare a 50 μL system and perform the amplification reaction according to the following procedure:

[0049] The PCR system and procedure are shown in Tables 1 and 2.

[0050] Table 1 PCR system

[0051]

[0052] Table 2 PCR program

[0053]

[0054] Use 1% agarose gel electrophoresis at 5v / cm for 20 minutes, cut out the electrophoresis fragment of COMT1 (1500bp) under ultraviolet light, place it in a system for sol recovery, dissolve and recover the DNA with a total volume of 40μL of water (the recovered product is marked as: rDNAC1), and recombinant with the vector after detection.

[0055] (3) Vector digestion

[0056] The enzyme cleavage and ligation system and reaction conditions are shown in Table 3 and Table 4:

[0057] Table 3 Enzyme cleavage and ligation system

[0058]

[0059] Table 4 Reaction conditions

[0060]

[0061] The vector digest was purified using a PCR purification kit and used for the next recombination reaction.

[0062] (4) The recombination reaction system and reaction conditions are shown in Table 5 and Table 6:

[0063] Table 5 Recombination reaction system

[0064]

[0065] Table 6 Reaction conditions

[0066]

[0067] Transform competent cells with the ligation product.

[0068] (5) Conversion

[0069] 5-10 μL of the ligation product was transformed into competent E. coli, transformed into Amp-resistant plates, cultured at 37°C for 12 hours, and identified by plaque PCR. The identification primer was: pABAi-F:gttccttatatgtagctttcgaca (6137 bp).

[0070] Example 2

[0071] Construction of pGADT7-GATA3 plasmid:

[0072] (1) GATA3 amplification primers:

[0073] (+): GCCATGGAGGCCAGTGAATTatggagtcttctttggctttcatggatgac;

[0074] (-): CAGCTCGAGCTCGATGGATCtcaccctttatccattggattcaccacc;

[0075] Sequencing primers:

[0076] cattttctcccgatccctgc;

[0077] 2. PCR system

[0078] Prepare a 50 μL system and perform the amplification reaction according to the following procedure:

[0079] The PCR system and program are shown in Tables 7 and 8.

[0080] Table 7 PCR system

[0081]

[0082] Table 8 PCR program

[0083]

[0084] Use 1% agarose gel electrophoresis at 5v / cm for 20 minutes, cut out the electrophoresis fragment of GATA3 (864bp) under ultraviolet light, put it in a system for sol recovery, dissolve and recover DNA with a total volume of 40μL of water (the recovered product is marked as: rDNAC1), and recombinant with the vector after detection.

[0085] (3) Vector digestion

[0086] The enzyme digestion and ligation system and reaction conditions are shown in Table 9 and Table 10:

[0087] Table 9 Enzyme Digestion and Linking System

[0088]

[0089] Table 10 Reaction conditions

[0090]

[0091] The vector digest was purified using a PCR purification kit and used for the next recombination reaction.

[0092] (4) The recombination reaction system and reaction conditions are shown in Table 11 and Table 12:

[0093] Table 11 Recombination reaction system

[0094]

[0095] Table 12 Reaction conditions

[0096]

[0097] The ligation product was transformed into competent cells.

[0098] (5) Conversion

[0099] 5-10 μL of the ligation product was transformed into competent E. coli, and then the plates coated with Amp resistance were cultured at 37°C for 12 hours, and then the plaque PCR was performed for identification.

[0100] Identification primer: PGADT7-F: gatgatgtatataactatctat (1839 bp);

[0101] Target gene: cattttctcccgatccctgc (2603bp).

[0102] Example 3

[0103] In order to further analyze the molecular mechanism of COMT1 promoter in the synthesis of melatonin, yeast one-hybrid method was used for verification.

[0104] The empty plasmid vector p53-AbAi (i.e., pABAi) and the positive plasmid pGADT7-Rec53 were taken as one group; the pABAi-COMT1 plasmid constructed in Example 1 and the empty plasmid vector pGADT7 were taken as the second group; the pABAi-COMT1 plasmid constructed in Example 1 and the pGADT7-GATA3 plasmid constructed in Example 2 were taken as the third group, and the three groups of plasmids were transformed into Y1HGold yeast competent medium, and cultured in full synthetic yeast medium (SD / -Ura / -Leu) and full synthetic yeast medium with gold bacillus A (in SD / -Ura / -Leu+100ng / mLAbA), respectively.

[0105] The results are as follows Figure 1 As shown in the figure, on the SD / -Ura / -Leu plate, each group had obvious colonies growing, indicating that the transformation was successful and the system worked normally. On the SD / -Ura / -Leu+100AbA plate, the pCOMT-AbAi competent cells transferred with pGADT7 empty vector did not grow colonies, and the p53-AbAi competent cells transferred with pGADT7-Rec53 plasmid could grow large colonies, indicating that the negative control and positive control worked normally under this system. The experimental group transferred with pGADT7-GATA1 plasmid grew colonies on the SD / -Ura / -Leu+100ng / mLAbA plate, indicating that CsGATA3 and CsCOMT1 interacted with each other.

[0106] Example 3

[0107] EMSA validation of COMT1 promoter probe and transcription factor GATA3:

[0108] The COMT1 gene promoter probe was synthesized, and the sequence at site 1604 was designed as probe 1; since the sequences at sites 980 and 1001 were similar, probe 2 was designed; and the sequence at site 115 was designed as probe 3.

[0109] The nucleotide sequence of probe 1 is shown in SEQ ID NO: 3;

[0110] TATAAAAAGATCAAGAAAAC;

[0111] The nucleotide sequence of probe 2 is shown in SEQ ID NO:4;

[0112] CTAAAGATAAATGCATATGCACAAAAGATAGGGTAT;

[0113] The nucleotide sequence of probe 3 is:

[0114] AGGTGAAGGATCTGAAATTCT;

[0115] The recombinant CsGATA3 protein was expressed in Escherichia coli and purified by nickel column. The EMSA experiment showed that probes 1 and 2 could bind to GST-CsGATA3, but probe 3 could not bind to GST-CsGATA3. Figure 2 ). Probes 1 and 2 have migration bands with protein CsGATA3, 5× competition probe can compete with a small number of probes and protein CsGATA3 migration bands, 20× competition probe can compete with a part of the probes and protein CsGATA3 migration bands, 50× competition probe can compete with most of the probes and protein CsGATA3 migration bands, and the mutation probe has no migration band with protein CsGATA ( Figures 3-4 ), that is, probes 1 and 2 interact with protein CsGATA3.

[0116] After co-transfection of the promoters of transcription factors CsGATA3 and CsCOMT1 using dual luciferase reporter gene assay technology, there was a significant difference between the experimental group and the control group ( Figure 5 ), indicating that CsGATA3 interacts with CsCOMT1 and that CsGATA3 positively regulates the expression of CsCOMT1.

[0117] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A transcription factor GATA3, characterized in that It is a protein encoded by a polynucleotide having a nucleotide sequence as shown in SEQ ID NO:

1.

2. A polynucleotide, characterized in that The polynucleotide encodes the transcription factor GATA3 according to claim 1.

3. A recombinant expression vector, characterized in that: The recombinant expression vector contains the polynucleotide according to claim 2.

4. A host cell, characterized in that The host cell contains the vector of claim 3 or the chromosome is integrated with the polynucleotide of claim 2 or expresses the transcription factor GATA3 of claim 1.

5. Use of the transcription factor GATA3 according to claim 1, the polynucleotide according to claim 2, and the recombinant expression vector according to claim 3 in regulating the expression of the plant melatonin synthase gene COMT1.

6. The use according to claim 5, characterized in that The transcription factor GATA3 of claim 1 interacts with the promoter of the plant melatonin synthase gene COMT1 to regulate the expression of the plant melatonin synthase gene COMT1, wherein the nucleotide sequence of the plant melatonin synthase gene COMT1 is shown in SEQ ID NO:

2.

7. Use of the transcription factor GATA3 according to claim 1, the polynucleotide according to claim 2, and the recombinant expression vector according to claim 3 in regulating melatonin synthesis in plants.

8. The use according to claim 7, characterized in that The transcription factor GATA3 of claim 1 interacts with the promoter of the plant melatonin synthase gene COMT1 to regulate the expression of the plant melatonin synthase gene COMT1, thereby regulating the synthesis of melatonin in the plant, wherein the nucleotide sequence of the plant melatonin synthase gene COMT1 is shown in SEQ ID NO:

2.

9. Use of the transcription factor GATA3 according to claim 1, the polynucleotide according to claim 2, and the recombinant expression vector according to claim 3 in cultivating high-yield melatonin transgenic plants.

10. A melatonin synthase gene COMT1 promoter probe, characterized in that: Its nucleotide sequence is shown in SEQ ID NO:3 or SEQ ID NO:4.

Images