Use of isl2 in the regulation of melatonin synthesis
By regulating melatonin synthesis through the binding of ISL2 to the AANAT gene promoter, the problem of unclear melatonin synthesis regulation mechanism has been solved, enabling precise regulation of melatonin content and promoting the breeding of high-melatonin pig breeds.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- CHINA AGRI UNIV
- Filing Date
- 2024-12-31
- Publication Date
- 2026-05-01
AI Technical Summary
The synthetic regulatory mechanism of melatonin in pig reproductive activities is unclear in the existing technology, which limits the breeding of new breeding materials for pigs with high melatonin levels.
By binding ISL2 to the promoter of the melatonin synthesis rate-limiting enzyme AANAT gene, the expression level and activity of AANAT can be regulated, thereby regulating melatonin synthesis. ISL2-related biological materials or reagents can be used to upregulate the expression level and activity of ISL2, or ISL2 inhibitors can be used to reduce the expression level and activity of ISL2, thus achieving precise regulation of melatonin synthesis.
By increasing or decreasing the expression level and activity of ISL2, the melatonin content in animals can be significantly increased or decreased, allowing for the breeding of animal breeds with specific characteristics to meet breeding needs.
Smart Images

Figure HDA0005226395920000011 
Figure HDA0005226395920000012 
Figure HDA0005226395920000021
Abstract
Description
Application of ISL2 in the Regulation of Melatonin Synthesis Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to the application of ISL2 in regulating melatonin synthesis. Background Technology
[0002] Melatonin (MT) is an indoleamine hormone primarily synthesized and secreted by the pineal gland, possessing diverse biological functions, including regulating circadian rhythms, anti-oxidation, anti-inflammation, and immune modulation. Currently, numerous studies have demonstrated that melatonin can enhance reproductive capacity in pigs by regulating multiple stages of reproductive activity. Under heat stress, melatonin can alleviate heat damage to Sertoli cells in the pig testes by promoting the expression of various antioxidant genes and regulating glucose metabolism. In vitro experiments have shown that appropriate concentrations of melatonin supplementation can increase progesterone synthesis levels in pig corpus luteum cells, indicating that melatonin plays an important role in maintaining pregnancy in pigs. Furthermore, supplementing pigs with appropriate doses of melatonin during late pregnancy can effectively promote the expression of various antioxidant genes in placental tissue, increasing birth weight and weaning weight in piglets.
[0003] Currently, although a large amount of experimental data has shown that melatonin plays an important role in pig reproductive activity, the regulatory mechanism of melatonin synthesis remains unclear, which limits the breeding of new high-melatonin pigs. Therefore, given the problems existing in the current technology, it is necessary to decipher the key regulatory molecules of melatonin synthesis in the pig pineal gland, which is crucial for the development of the pig industry. Summary of the Invention
[0004] The first aspect of the present invention is to provide applications of ISL2.
[0005] A second aspect of the present invention aims to provide the application of ISL2, ISL2-related biological materials, or reagents that target and upregulate the expression level of ISL2 and / or enhance the activity of ISL2.
[0006] The third aspect of this invention aims to provide the application of ISL2 inhibitors.
[0007] The fourth aspect of this invention aims to provide a method.
[0008] The fourth aspect of this invention aims to provide siRNA or related biological materials that target ISL2.
[0009] To achieve the above objectives, the technical solution adopted by the present invention is as follows:
[0010] The first aspect of the invention provides the application of ISL2 in any of a1)-a3):
[0011] a1) Regulates the synthesis of melatonin in animals or animal cells;
[0012] a2) Regulates the expression level of AANAT in animals or animal cells;
[0013] a3) Regulates the activity of the AANAT promoter in animals or animal cells.
[0014] In some implementations, the ISL2 positively regulates the synthesis of melatonin in animals or animal cells.
[0015] In some implementations, the ISL2 positively regulates the expression level of AANAT in animals or animal cells.
[0016] In some implementations, the ISL2 positively regulates the activity of the AANAT promoter in animals or animal cells.
[0017] In some embodiments, the animal described in a1)-a3) (including "animal" in "animal cell") is a mammal; further, a domestic animal; even further, a cow, pig, sheep, horse, chicken, dog, duck, goose, alpaca, or camel; and still further, a pig.
[0018] In some embodiments, the cells described in a1)-a3) are pineal cells or 293T cells.
[0019] In some implementations, regulating the expression level of AANAT in animals or animal cells means regulating the expression level of AANAT mRNA or protein in animals or animal cells.
[0020] In some implementations, the ISL2 accession number is 110261563 (Gene ID).
[0021] In some implementations, the AANAT accession number is 100518330 (Gene ID).
[0022] In some implementations, the AANAT promoter's login number is: ENSSCG00000017176.4(Ensembl).
[0023] In some embodiments, the nucleotide sequence of the AANAT promoter contains SEQ ID NO:7.
[0024] In some implementations, the application does not involve the diagnosis and / or treatment of a disease.
[0025] In this invention, ISL2 can bind to the promoter of the melatonin synthesis rate-limiting enzyme AANAT gene (the binding site is located 1539-1546 bp upstream of the transcription start site of the AANAT gene), thereby regulating the activity of the AANAT promoter, and in turn regulating the expression level of AANAT, ultimately achieving the regulation of melatonin synthesis.
[0026] A second aspect of the invention provides the application of any one of b1)-b3) in any one of c1)-c5):
[0027] b1)ISL2;
[0028] b2) Biomaterials related to ISL2;
[0029] b3) Reagents that target and upregulate ISL2 expression and / or enhance ISL2 activity;
[0030] c1) Promotes the synthesis of melatonin in animals or animal cells;
[0031] c2) Increase the expression level of AANAT in animals or animal cells;
[0032] c3) Increases the activity of the AANAT promoter in animals or animal cells;
[0033] c4) Breeding animal breeds;
[0034] c5) Prepare a product, said product being used in any one of c1)-c4);
[0035] The biological material comprises at least one of g1)-g9): g1) a nucleic acid molecule encoding ISL2; g2) an expression cassette containing the nucleic acid molecule of g1); g3) a vector containing the nucleic acid molecule of g1); g4) a vector containing the expression cassette of g2); g5) a cell containing the nucleic acid molecule of g1); g6) a cell containing the expression cassette of g2); g7) a cell containing the vector of g3); g8) a cell containing the vector of g4); and g9) a cell containing ISL2.
[0036] In some embodiments, the animal breed includes at least one of the characteristics d1)-d3): d1) increased melatonin content; d2) increased AANAT expression; d3) increased AANAT promoter activity.
[0037] In some embodiments, the animal species includes at least one of the characteristics d1)-d3): d1) increased melatonin content relative to the reference animal; d2) increased AANAT expression level relative to the reference animal; d3) increased AANAT promoter activity relative to the reference animal.
[0038] In some embodiments, the reference animal refers to an animal that has not been treated with ISL2, ISL2-related biological materials, or reagents that target and upregulate ISL2 expression and / or enhance ISL2 activity.
[0039] In some embodiments, the animal described in c1)-c4) (including "animal" in "animal cell") is a mammal; further, a domestic animal; even further, a cow, pig, sheep, horse, chicken, dog, duck, goose, alpaca, or camel; and still further, a pig.
[0040] In some embodiments, the cells described in c1)-c3) are pineal cells or 293T cells.
[0041] In some implementations, regulating the expression level of AANAT in animals or animal cells means regulating the expression level of AANAT mRNA or protein in animals or animal cells.
[0042] In some implementations, the ISL2 accession number is 110261563 (Gene ID).
[0043] In some implementations, the AANAT accession number is 100518330 (Gene ID).
[0044] In some implementations, the AANAT promoter's login number is: ENSSCG00000017176.4(Ensembl).
[0045] In some embodiments, the nucleotide sequence of the AANAT promoter contains SEQ ID NO:7.
[0046] In some implementations, the applications described in c1)-c4) do not involve the diagnosis and / or treatment of a disease.
[0047] In some embodiments, any of the vectors described in g3)-g4) includes a prokaryotic expression vector and a eukaryotic expression vector.
[0048] In some embodiments, the eukaryotic expression vector includes yeast expression vectors, mammalian expression vectors, insect expression vectors, etc.
[0049] In some embodiments, any of the cells described in g5)-g9) are selected from prokaryotic cells and eukaryotic cells.
[0050] In some embodiments, the prokaryotic cells include bacterial cells, Escherichia coli, Streptomyces, etc.
[0051] In some embodiments, the eukaryotic cells include yeast cells, mammalian cells, insect cells, etc.
[0052] In some embodiments, the mammal is a domestic animal; further, it is a cow, pig, sheep, horse, chicken, dog, duck, goose, alpaca, or camel; and even further, it is a pig.
[0053] A third aspect of the invention provides the use of an ISL2 inhibitor in any of e1)-e5):
[0054] e1) Inhibits the synthesis of melatonin in animals or animal cells;
[0055] e2) Reduce the expression level of AANAT in animals or animal cells;
[0056] e3) Reduces the activity of the AANAT promoter in animals or animal cells;
[0057] e4) Breeding animal breeds;
[0058] e5) Prepare a product, which is used in any one of e1)-e4).
[0059] In some embodiments, the animal breed includes at least one of f1)-f3): f1) reduced melatonin content; f2) reduced AANAT expression; f3) reduced AANAT promoter activity.
[0060] In some embodiments, the animal species includes at least one of f1)-f3): f1) lower melatonin content relative to the reference animal; f2) lower AANAT expression level relative to the reference animal; f3) lower AANAT promoter activity relative to the reference animal.
[0061] In some implementations, the reference animal refers to an animal that has not been treated with an ISL2 inhibitor.
[0062] In some embodiments, the ISL2 inhibitor comprises at least one of a substance that inhibits ISL2 activity, a substance that degrades ISL2, and a substance that reduces ISL2 expression; and further comprises a substance that reduces ISL2 expression.
[0063] In some embodiments, the substance reducing ISL2 expression comprises at least one of h1)-h10): h1) an ISL2-targeting siRNA, dsRNA, miRNA, ribozyme, shRNA, or CRISPR / Cas system (preferably an ISL2-targeting siRNA); h2) a nucleic acid molecule encoding h1); h3) an expression cassette containing the nucleic acid molecule of h2); h4) a vector containing the nucleic acid molecule of h2); h5) a vector containing the expression cassette of h3); h6) a cell containing the nucleic acid molecule of h2); h7) a cell containing the expression cassette of h3); h8) a cell containing the vector of h4); h9) a cell containing the vector of h5); h10) a cell containing the ISL2-targeting siRNA, dsRNA, miRNA, ribozyme, shRNA, or CRISPR / Cas system of h1).
[0064] In some embodiments, the sequences of the sense and antisense strands of the siRNA targeting ISL2 are shown in SEQ ID NO:8 and SEQ ID NO:9, respectively.
[0065] In some embodiments, the animal described in e1)-e4) (including "animal" in "animal cell") is a mammal; further, a domestic animal; even further, a cow, pig, sheep, horse, chicken, dog, duck, goose, alpaca, or camel; and still further, a pig.
[0066] In some embodiments, the cells described in e1)-e3) are pineal cells or 293T cells.
[0067] In some implementations, regulating the expression level of AANAT in animals or animal cells means regulating the expression level of AANAT mRNA or protein in animals or animal cells.
[0068] In some implementations, the ISL2 accession number is 110261563 (Gene ID).
[0069] In some implementations, the AANAT accession number is 100518330 (Gene ID).
[0070] In some implementations, the AANAT promoter's login number is: ENSSCG00000017176.4(Ensembl).
[0071] In some embodiments, the nucleotide sequence of the AANAT promoter contains SEQ ID NO:7.
[0072] In some implementations, the applications described in e1)-e4) do not involve the diagnosis and / or treatment of a disease.
[0073] In some embodiments, any of the vectors in h4)-h5) includes a prokaryotic expression vector and a eukaryotic expression vector.
[0074] In some embodiments, the eukaryotic expression vector includes yeast expression vectors, mammalian expression vectors, insect expression vectors, etc.
[0075] In some embodiments, any of the cells described in h6)-h10) are selected from prokaryotic cells and eukaryotic cells.
[0076] In some embodiments, the prokaryotic cells include bacterial cells, Escherichia coli, Streptomyces, etc.
[0077] In some embodiments, the eukaryotic cells include yeast cells, mammalian cells, insect cells, etc.
[0078] In some embodiments, the mammal is a domestic animal; further, it is a cow, pig, sheep, horse, chicken, dog, duck, goose, alpaca, or camel; and even further, it is a pig.
[0079] A fourth aspect of the present invention provides a method comprising the steps of: increasing the expression level and / or activity of ISL2 in an animal or animal cells;
[0080] The method is any one of c1)-c4):
[0081] c1) Methods to promote the synthesis of melatonin in animals or animal cells;
[0082] c2) Methods to increase the expression level of AANAT in animals or animal cells;
[0083] c3) Methods to enhance the activity of the AANAT promoter in animals or animal cells;
[0084] c4) Methods for breeding animal breeds.
[0085] In some embodiments, the animal breed includes at least one of the characteristics d1)-d3): d1) increased melatonin content; d2) increased AANAT expression; d3) increased AANAT promoter activity.
[0086] In some embodiments, the animal species includes at least one of the characteristics d1)-d3): d1) increased melatonin content relative to the reference animal; d2) increased AANAT expression level relative to the reference animal; d3) increased AANAT promoter activity relative to the reference animal.
[0087] In some embodiments, the reference animal refers to an animal that has not been treated with ISL2, ISL2-related biological materials, or reagents that target and upregulate ISL2 expression and / or enhance ISL2 activity.
[0088] In some embodiments, the animal described in c1)-c4) (including "animal" in "animal cell") is a mammal; further, a domestic animal; even further, a cow, pig, sheep, horse, chicken, dog, duck, goose, alpaca, or camel; and still further, a pig.
[0089] In some embodiments, the cells described in c1)-c3) are pineal cells or 293T cells.
[0090] In some implementations, regulating the expression level of AANAT in animals or animal cells means regulating the expression level of AANAT mRNA or protein in animals or animal cells.
[0091] In some implementations, the ISL2 accession number is 110261563 (Gene ID).
[0092] In some implementations, the AANAT accession number is 100518330 (Gene ID).
[0093] In some implementations, the AANAT promoter's login number is: ENSSCG00000017176.4(Ensembl).
[0094] In some embodiments, the nucleotide sequence of the AANAT promoter contains SEQ ID NO:7.
[0095] In some embodiments, the method does not involve the diagnosis and / or treatment of a disease.
[0096] In some embodiments, the method for increasing the expression level and / or activity of ISL2 in animals or animal cells is to treat animals or animal cells with ISL2, ISL2-related biological materials, and / or reagents that target and upregulate the expression level of ISL2 and / or enhance the activity of ISL2, as described in the second aspect of the present invention.
[0097] In some embodiments, the method for increasing the expression level and / or activity of ISL2 in animals or animal cells is to introduce a nucleic acid molecule encoding ISL2 into animals or animal cells.
[0098] In some embodiments, the nucleic acid molecule encoding ISL2 is introduced into an animal or animal cell via a recombinant vector; the recombinant vector is a vector obtained by inserting the nucleic acid molecule encoding ISL2 into the multiple cloning site of an expression vector.
[0099] In some implementations, the import method is transfection.
[0100] A fourth aspect of the invention provides another method comprising the steps of: reducing the expression level and / or activity of ISL2 in an animal or animal cells;
[0101] The method is any one of e1)-e4):
[0102] e1) Methods to inhibit the synthesis of melatonin in animals or animal cells;
[0103] e2) Methods to reduce the expression level of AANAT in animals or animal cells;
[0104] e3) Methods to reduce the activity of the AANAT promoter in animals or animal cells;
[0105] e4) Methods for breeding animal breeds.
[0106] In some embodiments, the animal breed includes at least one of f1)-f3): f1) reduced melatonin content; f2) reduced AANAT expression; f3) reduced AANAT promoter activity.
[0107] In some embodiments, the animal species includes at least one of f1)-f3): f1) lower melatonin content relative to the reference animal; f2) lower AANAT expression level relative to the reference animal; f3) lower AANAT promoter activity relative to the reference animal.
[0108] In some implementations, the reference animal refers to an animal that has not been treated with an ISL2 inhibitor.
[0109] In some embodiments, the animal described in e1)-e4) (including "animal" in "animal cell") is a mammal; further, a domestic animal; even further, a cow, pig, sheep, horse, chicken, dog, duck, goose, alpaca, or camel; and still further, a pig.
[0110] In some embodiments, the cells described in e1)-e3) are pineal cells or 293T cells.
[0111] In some implementations, regulating the expression level of AANAT in animals or animal cells means regulating the expression level of AANAT mRNA or protein in animals or animal cells.
[0112] In some implementations, the ISL2 accession number is 110261563 (Gene ID).
[0113] In some implementations, the AANAT accession number is 100518330 (Gene ID).
[0114] In some implementations, the AANAT promoter's login number is: ENSSCG00000017176.4(Ensembl).
[0115] In some embodiments, the nucleotide sequence of the AANAT promoter contains SEQ ID NO:7.
[0116] In some embodiments, the method does not involve the diagnosis and / or treatment of a disease.
[0117] In some embodiments, the method for reducing the expression level and / or activity of ISL2 in animals or animal cells is to treat animals or animal cells with the ISL2 inhibitor described in the third aspect of the present invention.
[0118] In some embodiments, the method for reducing the expression level and / or activity of ISL2 in animals or animal cells is to introduce an ISL2-targeting siRNA from the third aspect of the present invention into animals or animal cells.
[0119] In some implementations, the import method is transfection.
[0120] A fifth aspect of the invention provides siRNA targeting ISL2 or related biological materials.
[0121] The sequences of the sense and antisense strands of the siRNA targeting ISL2 are shown in SEQ ID NO:8 and SEQ ID NO:9, respectively.
[0122] The biological material comprises any one of h1)-h9): h1) a nucleic acid molecule encoding the siRNA targeting ISL2; h2) an expression cassette containing the nucleic acid molecule of h1); h3) a vector containing the nucleic acid molecule of h1); h4) a vector containing the expression cassette of h2); h5) a cell containing the nucleic acid molecule of h1); h6) a cell containing the expression cassette of h2); h7) a cell containing the vector of h3); h8) a cell containing the vector of h4); h9) a cell containing the siRNA targeting ISL2.
[0123] In some embodiments, any of the cells described in h5)-h9) do not involve reproductive material.
[0124] In some embodiments, any of the vectors in h3)-h4) includes a prokaryotic expression vector and a eukaryotic expression vector.
[0125] In some embodiments, the eukaryotic expression vector includes yeast expression vectors, mammalian expression vectors, insect expression vectors, etc.
[0126] In some embodiments, any of the cells in h5)-h9) are selected from prokaryotic cells and eukaryotic cells.
[0127] In some embodiments, the prokaryotic cells include bacterial cells, Escherichia coli, Streptomyces, etc.
[0128] In some embodiments, the eukaryotic cells include yeast cells, mammalian cells, insect cells, etc.
[0129] In some embodiments, the mammal is a domestic animal; further, it is a cow, pig, sheep, horse, chicken, dog, duck, goose, alpaca, or camel; and even further, it is a pig.
[0130] The beneficial effects of this invention are:
[0131] This invention, through screening, has for the first time discovered that ISL2 can bind to the promoter of the AANAT gene, the rate-limiting enzyme in melatonin synthesis, thereby regulating the activity of the AANAT promoter, and subsequently regulating the expression level of AANAT, ultimately achieving the regulation of melatonin synthesis: by increasing the expression level and / or activity of ISL2 in animals or animal cells, the activity of the AANAT promoter in animals or animal cells can be increased, the expression level of AANAT in animals or animal cells can be increased, and the synthesis of melatonin in animals or animal cells can be promoted, thereby breeding related animal breeds; by decreasing the expression level and / or activity of ISL2 in animals or animal cells, the activity of the AANAT promoter in animals or animal cells can be decreased, the expression level of AANAT in animals or animal cells can be decreased, and the synthesis of melatonin in animals or animal cells can be inhibited, thereby breeding related animal breeds. Attached Figure Description
[0132] Figure 1 shows the expression levels of LIM family (transcription factor ISL2) and AANAT, a key enzyme in melatonin synthesis, in the pineal gland during the day (10 a.m.) and night (10 p.m.): A shows the expression changes of AANAT, the rate-limiting enzyme in melatonin synthesis, during the day and night; B shows the expression changes of transcription factor ISL2 during the day and night.
[0133] Figure 2 illustrates the activation of AANAT and ISL2 expression and melatonin synthesis by norepinephrine: A shows the flowchart of in vitro culture and drug treatment of porcine primary pineal cells; B shows the changes in melatonin concentration in the cell supernatant of the control group and the norepinephrine-treated group; C shows the changes in ISL2 expression in the control group and the norepinephrine-treated group; and D shows the changes in AANAT expression in the control group and the norepinephrine-treated group.
[0134] Figure 3 illustrates how ISL2 promotes melatonin synthesis by regulating AANAT expression: A shows the binding site of ISL2 in the AANAT promoter region; B shows the effect of ISL2 overexpression on AANAT gene promoter activity; C shows the changes in ISL2 and AANAT expression after ISL2 interference in porcine primary pineal cells; and D shows the changes in melatonin concentration in the supernatant of porcine primary pineal cells after ISL2 interference. Detailed Implementation
[0135] The present invention will be further described in detail below through specific embodiments.
[0136] It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.
[0137] Experimental methods in the following examples, unless otherwise specified, are generally performed under standard conditions or as recommended by the manufacturer. Unless otherwise stated, the materials and reagents used in these examples are commercially available. Unless otherwise specified, the techniques used in these examples are conventional methods well-known to those skilled in the art.
[0138] Experimental methods
[0139] 1. RNA extraction and reverse transcription from porcine pineal gland
[0140] Porcine pineal gland RNA was extracted using the TRIzol method. A number of RNase-free 2mL centrifuge tubes were pre-filled with 10 autoclaved steel balls. 1mL of TRIzol was added to each tube and the tubes were kept on ice. A suitable amount of tissue sample was placed in each centrifuge tube and vortexed at 300rpm for 2 minutes. The tubes were then immediately placed on ice for 2 minutes, and this process was repeated five times. Afterward, the tubes were placed on ice for 10 minutes to allow for complete lysis. The samples were then centrifuged at 12000rpm for 15 minutes at 4°C. The centrifuge tubes were carefully removed, and approximately 500μL of the top layer was transferred to a new 1.5mL centrifuge tube. 300μL of chloroform was added to each tube, and the mixture was inverted to mix. The tubes were then centrifuged at 12000rpm for 10 minutes at 4°C. Approximately 500μL of the top layer was transferred to a new 1.5mL centrifuge tube. An equal volume of chloroform was added, and the mixture was gently inverted to mix. The tubes were then centrifuged at 12000rpm for 10 minutes at 4°C. Centrifuge at 14000 rpm for 10 min; transfer approximately 350 μL of the supernatant to a new 1.5 mL centrifuge tube, add an equal volume of isopropanol, and place in a -20°C freezer for 1 h; centrifuge at 14000 rpm for 20 min at 4°C and remove the supernatant; add 500 μL of 75% ethanol to the RNA precipitate for washing, centrifuge at 14000 rpm for 5 min at 4°C, and repeat the washing three times; remove the supernatant, place the RNA precipitate on a clean bench to air dry (10 min is sufficient); add approximately 20 μL of DEPC water, place on ice for 10 min to dissolve the precipitate, and determine the RNA concentration.
[0141] The extracted RNA was reverse transcribed. The reaction mixture consisted of 2 μL of 5×Enzyme Mix (Takara, catalog number RR036A), 1 μg of RNA, and water to a final volume of 10 μL. The reaction conditions were 37℃ for 15 min and 85℃ for 5 s.
[0142] 2. qRT-PCR detection of AANAT and ISL2 gene expression in porcine pineal gland
[0143] The expression level of the target gene was determined using the Taq Pro Universal SYBR qPCR Master Mix from Novizan Biosciences. The reaction system consisted of 2 μL of 2×Taq Pro Universal SYBR qPCR Master Mix, 0.4 μL each of forward and reverse primers (AANAT forward primer: AAGCCTTCATCCCTGTCTCG (5'-3', SEQ ID NO:1); AANAT reverse primer: AAGAGGCGACCCTCCAAGAA (5'-3', SEQ ID NO:2); ISL2 forward primer: GTGCGGACTGTG CTCAACG (5'-3', SEQ ID NO:3); ISL2 reverse primer: CTGGAGGCTCGTCTTGTCG (5'-3', SEQ ID NO:4); internal reference gene GAPDH forward primer: GTCGGTTGTGGATCTGACCTGC (5'-3', SEQ ID NO:5); internal reference gene GAPDH reverse primer: GTCCTCAGTGTAGCCCAGGATG (5'-3', SEQ ID NO:6)), 1 μL of cDNA, and water to a final volume of 20 μL. The reaction conditions were: pre-denaturation at 95°C for 30 seconds, 1 cycle, followed by a cycle program of 95°C for 10 seconds, 60°C for 30 seconds, for 40 cycles.
[0144] 3. In vitro isolation and culture of primary porcine pineal cells
[0145] Pineal gland tissue was immediately removed from porcine brain tissue and placed in 10% FBS phenol red-free DMEM / F12 complete medium, then transported to the laboratory in a 4°C incubator. The pineal gland tissue was transferred to a 35mm culture dish and minced using ophthalmic scissors. The minced pineal gland tissue was transferred to a 15mL centrifuge tube, and 8mL of 0.1% collagenase II was added. The mixture was incubated at 37°C with shaking for 15 minutes. After digestion, the tissue was repeatedly pipetted and the process was repeated for another 15 minutes. The digested mixture was filtered through a 200-mesh cell sieve to obtain a cell suspension. The cell suspension was centrifuged at 1500g for 5 minutes, and the supernatant was discarded. The cells were resuspended in 5mL of phenol red-free DMEM / F12 basal medium, gently washed, centrifuged at 1500rpm for 5 minutes, and the supernatant was discarded. The cells were then resuspended in 10% FBS phenol red-free DMEM / F12 complete medium and cultured in a 37°C, 5% CO2 incubator.
[0146] 4. Melatonin content detection
[0147] Melatonin concentration was determined by LC-MS detection (for specific detection methods, please refer to the reference, Wang X, Liu T, LvX, Sun N, Li F, Luo L, Zhuge X, Huang J, Wang L. A Potential Nontraditional Approach To Combat tmexCD1-toprJ1-Mediated Tigecycline Resistance: Melatonin as a Synergistic Adjuvant of Tigecycline. Antimicrob Agents Chemother. 2023 Jul 18;67(7):e0004723. doi:10.1128 / aac.00047-23. Epub 2023 Jun 8. PMID:37289048;PMCID:PMC10353380.).
[0148] 5. Dual-luciferase assay to detect changes in AANAT gene promoter activity
[0149] Mix Luciferase Reagent rapidly by pipetting, incubate at room temperature in the dark for 30 min, and then detect the luminescence intensity of firefly luciferin using a microplate reader; add 75 μL Dual- Luciferase Reagent to each well. Stop & Reagent, quickly mix by pipetting, incubate at room temperature for 30 min, and detect the fluorescence intensity of Renida luciferin using an ELISA reader; the fluorescence intensity ratio of firefly luciferase to Renida luciferase represents the activation degree of the AANAT gene promoter.
[0150] Example 1. Expression levels of LIM family (transcription factor ISL2) and AANAT genes, a key enzyme in melatonin synthesis, in the pineal gland during the day (10 AM) and night (10 PM) of pigs.
[0151] Under infrared lamp irradiation, pineal gland tissues from four adult pigs were collected during the day (10:00 AM) and at night (10:00 PM). RNA was extracted using the TRIzol method and reverse transcribed into cDNA. The expression of the melatonin synthesis rate-limiting enzyme gene AANAT and the LIM family (transcription factor ISL2) gene was quantitatively detected by qRT-PCR. The results are shown in Figure 1.
[0152] Figure 1 shows the expression changes of AANAT, the rate-limiting enzyme in melatonin synthesis, during the day and night, specifically: (0.2075±0.02869 vs 0.8100±0.09670), n=4 (unit: head); Figure 1 also shows the expression changes of the transcription factor ISL2 during the day and night, specifically: (0.2675±0.02056 vs 0.7075±0.1015), n=4 (unit: head). All data in Figure 1 are expressed as mean ± standard error. Different letters indicate significant differences within groups (p<0.05), while the same letters indicate no significant differences within groups (p>0.05). The internal reference gene was GAPDH.
[0153] As shown in Figure 1, the expression level of melatonin synthase AANAT in the pineal gland at night was significantly higher than that during the day (p<0.05), and the expression of ISL2 gene at night was also significantly higher than that during the day (p<0.05), which showed a diurnal rhythm consistent with the expression trend of AANAT.
[0154] Example 2. Norepinephrine activates AANAT and ISL2 expression, promoting melatonin synthesis.
[0155] Primary porcine pineal gland cells were isolated in vitro and seeded into 12-well plates (approximately 0.5 × 10⁶ cells per well). 6Five cells were divided into a control group and a norepinephrine (NE) group, and five wells were cultured stably for 24 hours. The culture medium was then replaced with serum-free DMEM / F12 medium, and the cells were starved for 30 min. Norepinephrine was then added to a final concentration of 1 μM and treated for 40 min. The cell supernatant was collected for melatonin concentration detection. Simultaneously, cells were collected, RNA was extracted and reverse transcribed into cDNA, and the expression changes of ISL2 and AAN AT were quantitatively detected. The results are shown in Figure 2.
[0156] Figure 2 shows the following: A) Flowchart of in vitro culture and drug treatment of porcine primary pineal gland cells; B) Changes in melatonin concentration in the cell supernatant of the control group and the norepinephrine-treated group, specifically: (1.829±0.2466 vs 4.795±1.020), n=5 (wells); C) Changes in ISL2 expression in the control group and the norepinephrine-treated group, specifically: (0.2460±0.01568 vs 0.6500±0.1018), n=5 (wells); D) Changes in AANAT expression in the control group and the norepinephrine-treated group, specifically: (0.3280±0.04454 vs 0.6540±0.1027), n=5 (wells). All data in Figure 2 are expressed as mean ± standard error. Different letters indicate significant differences within groups (p < 0.05), while the same letter indicates no significant differences within groups (p > 0.05). The internal reference gene is GAPDH.
[0157] As shown in Figure 2, compared with the control group, treatment with norepinephrine significantly increased the melatonin concentration in primary porcine pineal cells (p<0.05). Simultaneously, the expression levels of the key melatonin synthesis enzyme AANAT and the transcription factor ISL2 were significantly increased (p<0.05), and the changes in their expression were positively correlated, further suggesting that ISL2 may be involved in regulating melatonin synthesis.
[0158] Example 3. ISL2 promotes melatonin synthesis by regulating AANAT expression.
[0159] Primary porcine pineal cells were seeded into 12-well plates (approximately 0.5 × 10⁶ cells per well). 6After 24 hours of stable culture, 4 μL of small interfering RNA (100 pM, with the sequence of the positive strand of small interfering RNA as CAGUCGAGGUGCAGACGUATT (5'-3', SEQ ID NO: 8) and the sequence of the negative strand of small interfering RNA as UACUGUCACCUCGACUGTT (5'-3', SEQ ID NO: 9)) and 4 μL of lip3000 transfection reagent were added to 50 μL of serum-free DMEM / F12 culture medium. After mixing and standing for 15 minutes, the cells were transfected into porcine primary pineal gland cells to inhibit the expression of the ISL2 gene. 24 hours after transfection, changes in melatonin concentration in the cell supernatant and changes in the expression of AANAT and ISL2 genes were detected. Simultaneously, 293T cells were transfected using the same method, and the regulatory effect of ISL2 on the AANAT promoter activity was detected using a dual-luciferase reporter assay. The results are shown in Figure 3.
[0160] Figure 3 shows: A) the binding site of ISL2 in the AANAT promoter region; B) the effect of ISL2 overexpression on the AAN AT gene promoter activity; C) the changes in ISL2 and AANAT expression after ISL2 interference in porcine primary pineal cells, specifically: (ISL2: 0.9333±0.03756 vs 0.6767±0.008819, AANAT: 0.9733±0.01764 vs 0.8633±0.02906), n=3 (unit: well); D) the changes in melatonin concentration in the supernatant of porcine primary pineal cells after ISL2 interference, specifically: (4.369±0.6470 vs 1.601±0.2678), n=3 (unit: well). All data in Figure 3 are expressed as mean ± standard error. Different letters indicate significant differences within groups (p < 0.05), while the same letter indicates no significant differences within groups (p > 0.05). The internal reference gene is GAPDH.
[0161] As shown in Figure 3, inhibiting the expression of the ISL2 gene significantly reduced the expression level of the melatonin synthase AANAT, thereby inhibiting melatonin synthesis (p<0.05). Furthermore, it was determined that ISL2, as a transcription factor, can bind to the AANAT promoter region and promote AANAT expression.
[0162] The above results indicate that the transcription factor ISL2 is involved in regulating the synthesis of melatonin in the porcine pineal gland.
[0163] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. Application of any one of b1)-b3) in any one of c1)-c2): b1) ISL2; b2) ISL2-related biological material; b3) reagents that target and upregulate the expression level of ISL2 and / or enhance ISL2 activity; c1) enhancing the activity of the AANAT promoter in animal cells; c2) breeding animal breeds; the biological material comprises at least one of g1)-g9): g1) a nucleic acid molecule encoding ISL2; g2) an expression cassette containing the nucleic acid molecule of g1); g3) a vector containing the nucleic acid molecule of g1); g4) a vector containing the expression cassette of g2); g5) a cell containing the nucleic acid molecule of g1); g6) a cell containing the expression cassette of g2); g7) a cell containing the vector of g3); g8) a cell containing the vector of g4); g9) a cell containing ISL2; the application does not involve the diagnosis and / or treatment of disease; the animal is a pig; the animal breed comprises the following characteristic: enhanced AANAT promoter activity.
2. Application of any one of b1)-b3) in the preparation of the product: the product is used for any one of c1)-c2): b1) ISL2; b2) ISL2-related biological material; b3) reagents that target and upregulate the expression level of ISL2 and / or enhance ISL2 activity; c1) increasing the activity of the AANAT promoter in an animal or animal cell; c2) breeding an animal breed; the biological material comprises at least one of g1)-g9): g1) a nucleic acid molecule encoding ISL2; g2) an expression cassette containing the nucleic acid molecule of g1); g3) a vector containing the nucleic acid molecule of g1); g4) a vector containing the expression cassette of g2); g5) a cell containing the nucleic acid molecule of g1); g6) a cell containing the expression cassette of g2); g7) a cell containing the vector of g3); g8) a cell containing the vector of g4); g9) a cell containing ISL2; the animal is a pig; the animal breed comprises the following characteristic: increased AANAT promoter activity.
3. The application according to any one of claims 1-2, characterized in that, Any of the vectors described in g3)-g4) includes prokaryotic expression vectors and eukaryotic expression vectors; and / or any of the cells described in g5)-g9) are selected from prokaryotic cells and eukaryotic cells.
4. Application of ISL2 inhibitors in any of e1)-e3): e1) inhibiting melatonin synthesis in animal cells; e2) reducing the expression level of AANAT in animal cells; e3) breeding animal breeds; the application does not involve the diagnosis and / or treatment of diseases; the animal is a pig; the animal breed includes at least one of f1)-f2): f1) reduced melatonin content; f2) reduced AANAT expression level.
5. Application of ISL2 inhibitor in product preparation: The product is used for any one of e1)-e3): e1) inhibiting the synthesis of melatonin in animals or animal cells; e2) reducing the expression level of AANAT in animals or animal cells; e3) breeding animal breeds; the animal is a pig; the animal breed contains at least one of f1)-f2): f1) reduced melatonin content; f2) reduced AANAT expression level.
6. The application according to any one of claims 4-5, characterized in that, The ISL2 inhibitor comprises at least one of the following: a substance that inhibits ISL2 activity, a substance that degrades ISL2, or a substance that reduces ISL2 expression.
7. The application according to claim 6, characterized in that, The ISL2 inhibitor contains substances that reduce ISL2 expression.
8. The application according to claim 7, characterized in that, The substance that reduces ISL2 expression comprises at least one of h1)-h10): h1) a siRNA, dsRNA, miRNA, ribozyme, shRNA, or CRISPR / Cas system targeting ISL2; h2) a nucleic acid molecule encoding h1); h3) an expression cassette containing the nucleic acid molecule of h2); h4) a vector containing the nucleic acid molecule of h2); h5) a vector containing the expression cassette of h3); h6) a cell containing the nucleic acid molecule of h2); h7) a cell containing the expression cassette of h3); h8) a cell containing the vector of h4); h9) a cell containing the vector of h5); h10) a cell containing the siRNA, dsRNA, miRNA, ribozyme, shRNA, or CRISPR / Cas system of ISL2 of h1).
9. The application according to claim 8, characterized in that, The sequences of the sense and antisense strands of the siRNA targeting ISL2 are shown in SEQ ID NO:8 and SEQ ID NO:9, respectively; and / or any of the vectors in h4)-h5) include prokaryotic expression vectors and eukaryotic expression vectors; and / or any of the cells in h6)-h10) are selected from prokaryotic cells and eukaryotic cells.
10. A method comprising the steps of: increasing the expression level and / or activity of ISL2 in an animal or animal cells; the method being any one of c1)-c2): c1) a method for increasing the activity of the AANAT promoter in animal cells; c2) a method for breeding an animal breed; the animal breed comprising the characteristic of increased AANAT promoter activity; the method not involving the diagnosis and / or treatment of a disease; the animal being a pig.
11. The method according to claim 10, characterized in that, The method for increasing the expression level and / or activity of ISL2 in animals or animal cells is to treat animals or animal cells with ISL2 as described in any one of claims 1-3, ISL2-related biological materials, and / or reagents that target and upregulate the expression level of ISL2 and / or enhance the activity of ISL2.
12. The method according to claim 11, characterized in that, The method for increasing the expression level and / or activity of ISL2 in animals or animal cells is to introduce a nucleic acid molecule encoding ISL2 into animals or animal cells.
13. The method according to claim 12, characterized in that, The nucleic acid molecule encoding ISL2 is introduced into an animal or animal cell via a recombinant vector; the recombinant vector is a vector obtained by inserting the nucleic acid molecule encoding ISL2 into the multiple cloning site of an expression vector.
14. A method comprising the steps of: reducing the expression level and / or activity of ISL2 in an animal or animal cells; the method being any one of e1)-e3): e1) a method for inhibiting melatonin synthesis in animal cells; e2) a method for reducing the expression level of AANAT in animal cells; e3) a method for breeding an animal breed; the animal breed comprising at least one characteristic of f1)-f2): f1) reduced melatonin content; f2) reduced AANAT expression; the method not relating to the diagnosis and / or treatment of a disease; the animal being a pig.
15. The method according to claim 14, characterized in that, The method for reducing the expression level and / or activity of ISL2 in animals or animal cells is as follows: treating animals or animal cells with the ISL2 inhibitor described in any one of claims 4-9.
16. The method according to claim 15, characterized in that, The method for reducing the expression level and / or activity of ISL2 in animals or animal cells is as follows: introducing the ISL2-targeting siRNA as described in claim 9 into animals or animal cells.
17. The application or method according to any one of claims 1-2, 4-5, and 7-16, characterized in that, The cells in question are pineal gland cells.
18. The application or method according to claim 3, characterized in that, The cells in question are pineal gland cells.
19. The application or method according to claim 6, characterized in that, The cells in question are pineal gland cells.