Application of ISL2 in regulation and control of melatonin synthesis

Abstract

The invention belongs to the technical field of biology, and particularly relates to application of ISL2 in regulation and control of melatonin synthesis. The invention discloses that ISL2 can be combined with a melatonin synthesis rate-limiting enzyme AANAT gene promoter for the first time, so that the activity of the AANAT promoter is regulated and controlled, the expression quantity of AANAT is regulated and controlled, and finally regulation and control of melatonin synthesis are realized.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to the application of ISL2 in regulating melatonin synthesis. Background Art

[0002] Melatonin (MT) is an indoleamine hormone mainly synthesized and secreted by the pineal gland. It has multiple biological functions, including regulating circadian rhythm, anti-oxidation, anti-inflammation and regulating the body's immunity. At present, a large number of literatures have shown that melatonin can improve the reproductive capacity of pigs by regulating multiple stages of pig reproductive activity. Under heat stress conditions, melatonin can alleviate the thermal damage of pig testicular supporting cells by promoting the expression of various antioxidant genes and regulating glucose metabolism. In vitro experiments have found that the addition of appropriate concentrations of melatonin can increase the level of progesterone synthesis in pig luteal cells, indicating that melatonin plays an important role in maintaining pig pregnancy. In addition, supplementing an appropriate dose of melatonin in the late stage of pig pregnancy can effectively promote the expression of various antioxidant genes in placental tissue and increase the birth weight and weaning weight of piglets.

[0003] At present, although a large amount of experimental data has shown that melatonin plays an important role in pig reproductive activities, the synthetic regulatory mechanism of melatonin is still unclear, which also limits the cultivation of new breeding materials for high melatonin pigs. Therefore, in view of the problems existing in the existing technology, it is necessary to crack the key regulatory molecules of melatonin synthesis in the pig pineal gland, which is crucial for the development of the pig industry. Summary of the invention

[0004] The purpose of the first aspect of the present invention is to provide an application of ISL2.

[0005] The second aspect of the present invention aims to provide applications of ISL2, biological materials related to ISL2, or agents for targeted upregulation of ISL2 expression and / or enhancement of ISL2 activity.

[0006] The third aspect of the present invention aims to provide the use of ISL2 inhibitors.

[0007] The fourth aspect of the present invention aims to provide a method.

[0008] The fourth aspect of the present invention aims to provide siRNA targeting ISL2 or biological materials related thereto.

[0009] In order to achieve the above object, the technical solution adopted by the present invention is:

[0010] The first aspect of the present invention provides the use of ISL2 in any one of items a1)-a3):

[0011] a1) regulating the synthesis of melatonin in animals or animal cells;

[0012] a2) regulating the expression of AANAT in animals or animal cells;

[0013] a3) regulating the activity of AANAT promoter in animals or animal cells.

[0014] In some embodiments, the ISL2 positively regulates the synthesis of melatonin in the animal or animal cell.

[0015] In some embodiments, the ISL2 positively regulates the expression level of AANAT in the animal or animal cell.

[0016] In some embodiments, the ISL2 positively regulates the activity of the AANAT promoter in the animal or animal cell.

[0017] In some embodiments, the animal described in a1)-a3) (including the "animal" in "animal cell") is a mammal; further is livestock; further is cattle, pigs, sheep, horses, chickens, dogs, ducks, geese, alpacas, or camels; and further is pigs.

[0018] In some embodiments, the cells in a1)-a3) are pineal cells or 293T cells.

[0019] In some embodiments, regulating the expression level of AANAT in an animal or an animal cell is regulating the expression level of AANAT mRNA or protein in the animal or an animal cell.

[0020] In some embodiments, the accession number of ISL2 is: 110261563 (Gene ID).

[0021] In some embodiments, the accession number of the AANAT is: 100518330 (Gene ID).

[0022] In some embodiments, the accession number of the AANAT promoter is: ENSSSCG00000017176.4 (Ensembl).

[0023] In some embodiments, the nucleotide sequence of the AANAT promoter comprises SEQ ID NO:7.

[0024] In some embodiments, the use does not involve diagnosis and / or treatment of a disease.

[0025] In the present invention, ISL2 can bind to the promoter of the AANAT gene, the rate-limiting enzyme in melatonin synthesis (the binding site is located 1539-1546bp upstream of the transcription start site of the AANAT gene), thereby regulating the activity of the AANAT promoter, and then regulating the expression level of AANAT, ultimately achieving the regulation of melatonin synthesis.

[0026] The second aspect of the present invention provides the use of any one of b1)-b3) in any one of c1)-c5):

[0027] b1)ISL2;

[0028] b2) biological materials related to ISL2;

[0029] b3) agents that target and upregulate the expression of ISL2 and / or enhance the activity of ISL2;

[0030] c1) promoting the synthesis of melatonin in animals or animal cells;

[0031] c2) increasing the expression level of AANAT in animals or animal cells;

[0032] c3) increasing the activity of the AANAT promoter in an animal or animal cell;

[0033] c4) breeding of animal breeds;

[0034] c5) preparing a product, wherein the product is used in any one of c1) to c4);

[0035] The biological material comprises at least one of g1)-g9): g1) a nucleic acid molecule encoding ISL2; g2) an expression cassette containing the nucleic acid molecule of g1); g3) a vector containing the nucleic acid molecule of g1); g4) a vector containing the expression cassette of g2); g5) a cell containing the nucleic acid molecule of g1); g6) a cell containing the expression cassette of g2); g7) a cell containing the vector of g3); g8) a cell containing the vector of g4); g9) a cell containing ISL2.

[0036] In some embodiments, the animal species comprises at least one of the characteristics d1)-d3): d1) increased melatonin content; d2) increased expression of AANAT; d3) increased activity of the AANAT promoter.

[0037] In some embodiments, the animal species comprises at least one of the characteristics d1)-d3): d1) the melatonin content is increased relative to that of a reference animal; d2) the expression level of AANAT is increased relative to that of a reference animal; d3) the activity of the AANAT promoter is increased relative to that of a reference animal.

[0038] In some embodiments, the reference animal refers to an animal that has not been treated with ISL2, biological materials related to ISL2, or agents that target upregulating the expression of ISL2 and / or enhancing the activity of ISL2.

[0039] In some embodiments, the animal described in c1)-c4) (including the "animal" in "animal cell") is a mammal; further is livestock; further is cattle, pigs, sheep, horses, chickens, dogs, ducks, geese, alpacas, or camels; and further is pigs.

[0040] In some embodiments, the cells in c1)-c3) are pineal cells or 293T cells.

[0041] In some embodiments, regulating the expression level of AANAT in an animal or an animal cell is regulating the expression level of AANAT mRNA or protein in the animal or an animal cell.

[0042] In some embodiments, the accession number of ISL2 is: 110261563 (Gene ID).

[0043] In some embodiments, the accession number of the AANAT is: 100518330 (Gene ID).

[0044] In some embodiments, the accession number of the AANAT promoter is: ENSSSCG00000017176.4 (Ensembl).

[0045] In some embodiments, the nucleotide sequence of the AANAT promoter comprises SEQ ID NO:7.

[0046] In some embodiments, the applications described in c1)-c4) do not involve diagnosis and / or treatment of a disease.

[0047] In some embodiments, any of the vectors in g3)-g4) includes a prokaryotic expression vector and a eukaryotic expression vector.

[0048] In some embodiments, the eukaryotic expression vector includes a yeast expression vector, a mammalian expression vector, an insect expression vector, and the like.

[0049] In some embodiments, the cell described in any one of g5)-g9) is selected from a prokaryotic cell and a eukaryotic cell.

[0050] In some embodiments, the prokaryotic cells include bacterial cells, Escherichia coli, Streptomyces, etc.

[0051] In some embodiments, the eukaryotic cells include yeast cells, mammalian cells, insect cells, etc.

[0052] In some embodiments, the mammal is livestock; further is cattle, pigs, sheep, horses, chickens, dogs, ducks, geese, alpacas, or camels; further is pigs.

[0053] The third aspect of the present invention provides the use of an ISL2 inhibitor in any one of e1) to e5):

[0054] e1) inhibiting the synthesis of melatonin in animals or animal cells;

[0055] e2) reducing the expression of AANAT in animals or animal cells;

[0056] e3) reducing the activity of the AANAT promoter in an animal or animal cell;

[0057] e4) breeding of animal breeds;

[0058] e5) preparing a product, wherein the product is used for any one of e1) to e4).

[0059] In some embodiments, the animal species comprises at least one of the characteristics f1)-f3): f1) reduced melatonin content; f2) reduced expression of AANAT; f3) reduced activity of AANAT promoter.

[0060] In some embodiments, the animal species comprises at least one of the characteristics f1)-f3): f1) the melatonin content is reduced relative to that of reference animals; f2) the expression level of AANAT is reduced relative to that of reference animals; f3) the activity of the AANAT promoter is reduced relative to that of reference animals.

[0061] In some embodiments, the reference animal refers to an animal that has not been treated with an ISL2 inhibitor.

[0062] In some embodiments, the ISL2 inhibitor comprises at least one of a substance that inhibits ISL2 activity, a substance that degrades ISL2, and a substance that reduces the expression level of ISL2; and further comprises a substance that reduces the expression level of ISL2.

[0063] In some embodiments, the substance that reduces the expression level of ISL2 comprises at least one of h1)-h10): h1) siRNA, dsRNA, miRNA, ribozyme, shRNA, or CRISPR / Cas system targeting ISL 2 (preferably siRNA targeting ISL2); h2) a nucleic acid molecule encoding h1); h3) an expression cassette comprising the nucleic acid molecule described in h2); h4) a vector comprising the nucleic acid molecule described in h2); h5) a vector comprising the expression cassette described in h3); h6) a cell comprising the nucleic acid molecule described in h2); h7) a cell comprising the expression cassette described in h3); h8) a cell comprising the vector described in h4); h9) a cell comprising the vector described in h5); h10) a cell comprising the siRNA, dsRNA, miRNA, ribozyme, shRNA, or CRISPR / Cas system described in h1) for ISL2.

[0064] In some embodiments, the sequences of the sense strand and antisense strand of the siRNA targeting ISL2 are shown as SEQ ID NO: 8 and SEQ ID NO: 9, respectively.

[0065] In some embodiments, the animal described in e1)-e4) (including the "animal" in "animal cell") is a mammal; further is livestock; further is cattle, pigs, sheep, horses, chickens, dogs, ducks, geese, alpacas, or camels; and further is pigs.

[0066] In some embodiments, the cells in e1)-e3) are pineal cells or 293T cells.

[0067] In some embodiments, regulating the expression level of AANAT in an animal or an animal cell is regulating the expression level of AANAT mRNA or protein in the animal or an animal cell.

[0068] In some embodiments, the accession number of ISL2 is: 110261563 (Gene ID).

[0069] In some embodiments, the accession number of the AANAT is: 100518330 (Gene ID).

[0070] In some embodiments, the accession number of the AANAT promoter is: ENSSSCG00000017176.4 (Ensembl).

[0071] In some embodiments, the nucleotide sequence of the AANAT promoter comprises SEQ ID NO:7.

[0072] In some embodiments, the uses described in e1)-e4) do not involve diagnosis and / or treatment of a disease.

[0073] In some embodiments, any of the vectors described in h4)-h5) includes a prokaryotic expression vector and a eukaryotic expression vector.

[0074] In some embodiments, the eukaryotic expression vector includes a yeast expression vector, a mammalian expression vector, an insect expression vector, and the like.

[0075] In some embodiments, any of the cells h6)-h10) is selected from prokaryotic cells and eukaryotic cells.

[0076] In some embodiments, the prokaryotic cells include bacterial cells, Escherichia coli, Streptomyces, etc.

[0077] In some embodiments, the eukaryotic cells include yeast cells, mammalian cells, insect cells, etc.

[0078] In some embodiments, the mammal is livestock; further is cattle, pigs, sheep, horses, chickens, dogs, ducks, geese, alpacas, or camels; further is pigs.

[0079] A fourth aspect of the present invention provides a method comprising the following steps: increasing the expression level and / or activity of ISL2 in an animal or animal cell;

[0080] The method is any one of c1) to c4):

[0081] c1) Methods for promoting the synthesis of melatonin in animals or animal cells;

[0082] c2) A method for increasing the expression level of AANAT in an animal or animal cell;

[0083] c3) A method for increasing the activity of the AANAT promoter in an animal or animal cell;

[0084] c4) Methods of breeding animal breeds.

[0085] In some embodiments, the animal species comprises at least one of the characteristics d1)-d3): d1) increased melatonin content; d2) increased expression of AANAT; d3) increased activity of the AANAT promoter.

[0086] In some embodiments, the animal species comprises at least one of the characteristics d1)-d3): d1) the melatonin content is increased relative to that of a reference animal; d2) the expression level of AANAT is increased relative to that of a reference animal; d3) the activity of the AANAT promoter is increased relative to that of a reference animal.

[0087] In some embodiments, the reference animal refers to an animal that has not been treated with ISL2, biological materials related to ISL2, or agents that target upregulating the expression of ISL2 and / or enhancing the activity of ISL2.

[0088] In some embodiments, the animal described in c1)-c4) (including the "animal" in "animal cell") is a mammal; further is livestock; further is cattle, pigs, sheep, horses, chickens, dogs, ducks, geese, alpacas, or camels; and further is pigs.

[0089] In some embodiments, the cells in c1)-c3) are pineal cells or 293T cells.

[0090] In some embodiments, regulating the expression level of AANAT in an animal or an animal cell is regulating the expression level of AANAT mRNA or protein in the animal or an animal cell.

[0091] In some embodiments, the accession number of ISL2 is: 110261563 (Gene ID).

[0092] In some embodiments, the accession number of the AANAT is: 100518330 (Gene ID).

[0093] In some embodiments, the accession number of the AANAT promoter is: ENSSSCG00000017176.4 (Ensembl).

[0094] In some embodiments, the nucleotide sequence of the AANAT promoter comprises SEQ ID NO:7.

[0095] In some embodiments, the method does not involve diagnosis, and / or treatment of a disease.

[0096] In some embodiments, the method for increasing the expression level and / or activity of ISL2 in animals or animal cells is to treat animals or animal cells with ISL2, ISL2-related biological materials, and / or reagents that target upregulating the expression level of ISL2 and / or enhancing the activity of ISL2 in the second aspect of the present invention.

[0097] In some embodiments, the method for increasing the expression level and / or activity of ISL2 in an animal or an animal cell is to introduce a nucleic acid molecule encoding ISL2 into the animal or the animal cell.

[0098] In some embodiments, the nucleic acid molecule encoding ISL2 is introduced into an animal or animal cell via a recombinant vector; the recombinant vector is a vector obtained by inserting the nucleic acid molecule encoding ISL2 into a multiple cloning site of an expression vector.

[0099] In some embodiments, the method of introduction is transfection.

[0100] A fourth aspect of the present invention provides another method comprising the steps of: reducing the expression level and / or activity of ISL2 in an animal or animal cell;

[0101] The method is any one of e1) to e4):

[0102] e1) Method for inhibiting the synthesis of melatonin in animals or animal cells;

[0103] e2) A method for reducing the expression of AANAT in an animal or animal cell;

[0104] e3) A method for reducing the activity of the AANAT promoter in an animal or animal cell;

[0105] e4) Methods of breeding animal breeds.

[0106] In some embodiments, the animal species comprises at least one of the characteristics f1)-f3): f1) reduced melatonin content; f2) reduced expression of AANAT; f3) reduced activity of AANAT promoter.

[0107] In some embodiments, the animal species comprises at least one of the characteristics f1)-f3): f1) the melatonin content is reduced relative to that of reference animals; f2) the expression level of AANAT is reduced relative to that of reference animals; f3) the activity of the AANAT promoter is reduced relative to that of reference animals.

[0108] In some embodiments, the reference animal refers to an animal that has not been treated with an ISL2 inhibitor.

[0109] In some embodiments, the animal described in e1)-e4) (including the "animal" in "animal cell") is a mammal; further is livestock; further is cattle, pigs, sheep, horses, chickens, dogs, ducks, geese, alpacas, or camels; and further is pigs.

[0110] In some embodiments, the cells in e1)-e3) are pineal cells or 293T cells.

[0111] In some embodiments, regulating the expression level of AANAT in an animal or an animal cell is regulating the expression level of AANAT mRNA or protein in the animal or an animal cell.

[0112] In some embodiments, the accession number of ISL2 is: 110261563 (Gene ID).

[0113] In some embodiments, the accession number of the AANAT is: 100518330 (Gene ID).

[0114] In some embodiments, the accession number of the AANAT promoter is: ENSSSCG00000017176.4 (Ensembl).

[0115] In some embodiments, the nucleotide sequence of the AANAT promoter comprises SEQ ID NO:7.

[0116] In some embodiments, the method does not involve diagnosis, and / or treatment of a disease.

[0117] In some embodiments, the method for reducing the expression level and / or activity of ISL2 in an animal or animal cell is: treating the animal or animal cell with the ISL2 inhibitor of the third aspect of the present invention.

[0118] In some embodiments, the method for reducing the expression level and / or activity of ISL2 in an animal or an animal cell is: introducing the siRNA targeting ISL2 in the third aspect of the present invention into the animal or the animal cell.

[0119] In some embodiments, the method of introduction is transfection.

[0120] A fifth aspect of the present invention provides siRNA targeting ISL2 or biological materials related thereto.

[0121] The sequences of the sense strand and antisense strand of the siRNA targeting ISL2 are shown in SEQ ID NO:8 and SEQ ID NO:9, respectively;

[0122] The biological material comprises any one of h1)-h9): h1) a nucleic acid molecule encoding the siRNA targeting ISL2; h2) an expression cassette comprising the nucleic acid molecule of h1); h3) a vector comprising the nucleic acid molecule of h1); h4) a vector comprising the expression cassette of h2); h5) a cell comprising the nucleic acid molecule of h1); h6) a cell comprising the expression cassette of h2); h7) a cell comprising the vector of h3); h8) a cell comprising the vector of h4); h9) a cell comprising the siRNA targeting ISL2.

[0123] In some embodiments, the cell of any one of h5)-h9) is not involved in propagation material.

[0124] In some embodiments, any of the vectors described in h3)-h4) includes a prokaryotic expression vector and a eukaryotic expression vector.

[0125] In some embodiments, the eukaryotic expression vector includes a yeast expression vector, a mammalian expression vector, an insect expression vector, and the like.

[0126] In some embodiments, any of the cells h5)-h9) is selected from prokaryotic cells and eukaryotic cells.

[0127] In some embodiments, the prokaryotic cells include bacterial cells, Escherichia coli, Streptomyces, etc.

[0128] In some embodiments, the eukaryotic cells include yeast cells, mammalian cells, insect cells, etc.

[0129] In some embodiments, the mammal is livestock; further is cattle, pigs, sheep, horses, chickens, dogs, ducks, geese, alpacas, or camels; further is pigs.

[0130] The beneficial effects of the present invention are:

[0131] Through screening, the present invention first discovered that ISL2 can bind to the promoter of the AANAT gene, which is the rate-limiting enzyme in melatonin synthesis, so as to regulate the activity of the AANAT promoter, and then regulate the expression level of AANAT, and finally achieve the regulation of melatonin synthesis: by increasing the expression level and / or activity of ISL2 in animals or animal cells, the activity of the AANAT promoter in animals or animal cells can be increased, the expression level of AANAT in animals or animal cells can be increased, and the synthesis of melatonin in animals or animal cells can be promoted, so as to cultivate relevant animal varieties; by reducing the expression level and / or activity of ISL2 in animals or animal cells, the activity of the AANAT promoter in animals or animal cells can be reduced, the expression level of AANAT in animals or animal cells can be reduced, and the synthesis of melatonin in animals or animal cells can be inhibited, so as to cultivate relevant animal varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0132] Figure 1 The expression levels of LIM family (transcription factor ISL2) and melatonin synthesis key enzyme AANAT genes in the pig pineal gland during the day (10 am) and night (10 pm) are shown: wherein A shows the expression changes of AANAT, the rate-limiting enzyme for melatonin synthesis, during the day and at night; B shows the expression changes of transcription factor ISL2 during the day and at night.

[0133] Figure 2The figure shows that norepinephrine activates the expression of AANAT and ISL2 and the synthesis of melatonin: wherein A shows the flow chart of in vitro culture and drug treatment of primary porcine pineal cells; B shows the changes in melatonin concentration in the supernatant of cells of the control group and the norepinephrine-treated group; C shows the changes in ISL2 expression in cells of the control group and the norepinephrine-treated group; D shows the changes in AANAT expression in cells of the control group and the norepinephrine-treated group.

[0134] Figure 3 It is shown that ISL2 promotes melatonin synthesis by regulating AANAT expression: wherein, A shows the binding site of ISL2 in the AANAT promoter region; B shows the effect of overexpression of ISL2 on the promoter activity of the AANAT gene; C shows the expression changes of ISL2 and AANAT after interfering with ISL2 in primary pig pineal cells; D shows the change of melatonin concentration in the supernatant of primary pig pineal cells after interfering with ISL2. DETAILED DESCRIPTION

[0135] The present invention is further described in detail below through specific examples.

[0136] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0137] The experimental methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or under conditions recommended by the manufacturer. The materials, reagents, etc. used in the present examples are commercially available unless otherwise specified. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

[0138] Experimental methods

[0139] 1. RNA Extraction and Reverse Transcription from Pig Pineal Gland

[0140] The TRIzol method was used to extract RNA from the pig pineal gland. Take a corresponding number of RNase-free 2mL centrifuge tubes, put 10 high-pressure sterilized steel beads in advance, add 1mL TRIzol to each tube and place on ice for later use; take an appropriate amount of tissue sample and put it in a centrifuge tube, place it in an oscillating crusher at 300rpm, shake for 2min, and then immediately place it on ice to cool for 2min, repeat five times. Then place it on ice for 10min to fully lyse the sample; centrifuge at 4℃, 12000rpm for 15min, carefully remove the centrifuge tube, and the sample can be seen to be layered. Pipette about 500μL of the top layer sample and place it in a new 1.5mL centrifuge tube; add 300μL of chloroform to each tube and mix it upside down; centrifuge at 4℃, 12000rpm for 10min, and aspirate about 500μL of the top layer liquid and place it in a new 1.5mL centrifuge tube; add an equal amount of chloroform, gently invert and mix, 4℃, 12000rpm rpm, centrifuge for 10 min; aspirate about 350 μL of supernatant and place it in a new 1.5 mL centrifuge tube, add an equal volume of isopropanol, and place it in a -20°C refrigerator for 1 h; centrifuge at 4°C, 14000 rpm for 20 min, and remove the supernatant; add 500 μL of 75% ethanol to the RNA precipitate for washing, centrifuge at 4°C, 14000 rpm for 5 min, and repeat the washing three times; remove the supernatant, place the RNA precipitate on a clean bench to dry (10 min is enough); add about 20 μL of DEPC water, place on ice for 10 min to dissolve the precipitate, and measure the RNA concentration.

[0141] The extracted RNA was reverse transcribed, and the reaction system was 5×Enzyme Mix 2 μL (Takara, Catalog No. RR036A), RNA 1 μg, and water was added to make up to 10 μL. The reaction conditions were 37°C for 15 min and 85°C for 5 s.

[0142] 2. qRT-PCR detection of AANAT and ISL2 gene expression in pig pineal gland

[0143] The expression level of target genes was determined using Taq Pro Universal SYBR qPCR Master Mix from Novagen Biopharmaceuticals. The reaction system was 2 μL of 2×Taq Pro Universal SYBR qPCR Master Mix, 0.4 μL of upstream and downstream primers (AANAT upstream primer: AAGCCTTCATCCCTGTCTCG (5'-3', SEQ ID NO: 1); AANAT downstream primer: AAGAGGCGACCCTCCAAGAA (5'-3', SEQ ID NO: 2); ISL2 upstream primer: GTGCGGACTGTG CTCAACG (5'-3', SEQ ID NO: 3), ISL2 downstream primer: CTGGAGGCTCGTCTTGTCG (5'-3', SEQ ID NO: 4); internal reference gene GAPDH upstream primer: GTCGGTTGTGGATCTGACCTGC (5'-3', SEQ ID NO: 5); internal reference gene GAPDH downstream primer: GTCCTCAGTGTAGCCCAGGATG (5'-3', SEQ ID NO: 6)), cDNA 1 μL, and water was added to 20 μL. The reaction conditions were: pre-denaturation at 95°C for 30 seconds, 1 cycle, and cycling program at 95°C for 10 seconds, 60°C for 30 seconds, 40 cycles.

[0144] 3. Isolation and culture of primary porcine pineal cells in vitro

[0145] After the pineal tissue was removed from the pig brain tissue, it was immediately placed in 10% FBS phenol red-free DMEM / F12 complete medium, placed in a 4°C incubator and transported to the laboratory; the pineal tissue was moved to a 35mm culture dish and minced with ophthalmic scissors; the minced pineal tissue was transferred to a 15mL centrifuge tube, 8mL of 0.1% collagenase II was added, and the digestion was shaken at 37°C for 15min. After the end, the tissue was repeatedly blown and digested under the same conditions for another 15min; the digested mixture was filtered using a 200-mesh cell sieve to obtain a cell suspension. The cell suspension was centrifuged at 1500g for 5min and the supernatant was discarded; 5mL of phenol red-free DMEM / F12 basal medium was added to resuspend the cells, the cells were gently blown and washed, and the supernatant was discarded; 10% FBS phenol red-free DMEM / F12 complete medium was added to resuspend the cells, and the cells were incubated at 37°C and 5% CO 2 Culture in an incubator.

[0146] 4. Melatonin content detection

[0147] The melatonin concentration was determined by LC-MS detection (for specific detection methods, see references, Wang X, Liu T, LvX, Sun N, Li F, Luo L, Zhuge X, Huang J, Wang L. APotential Nontraditional Approach To Combat tmex CD1-toprJ1-Mediated Tigecycline Resistance: Melatonin as a Synergistic Adjuv ant of Tigecycline. Antimicrob Agents Chemother. 2023 Jul 18; 67(7): e0004723. doi: 10.1128 / aac.00047-23. Epub 2023 Jun 8. PMID: 37289048; PMCID: PMC10353380.).

[0148] 5. Dual luciferase assay to detect changes in AANAT gene promoter activity

[0149] Luciferase Reagent, quickly pipette to mix, incubate at room temperature in the dark for 30 minutes, and detect the luminescence intensity of firefly luciferase with an enzyme reader; add 75 μL Dual- Stop& Reagent, quickly pipette to mix, incubate at room temperature for 30 min, and detect the luminescence intensity of Renilla luciferase with a microplate reader; the fluorescence intensity ratio of firefly luciferase to Renilla luciferase represents the activation degree of the AANAT gene promoter.

[0150] Example 1. Expression levels of LIM family (transcription factor ISL2) and melatonin synthesis key enzyme AANAT genes in pig pineal gland during the day (10 am) and at night (10 pm)

[0151] Under infrared light irradiation, pineal tissues of 4 adult pigs were collected during the day (10 am) and at night (10 pm), RNA was extracted using the TRIzol method and reverse transcribed into cDNA, and qRT-PCR was used to quantitatively detect the expression of melatonin synthesis rate-limiting enzyme gene AANAT and LIM family (transcription factor ISL2) genes. The test results are as follows Figure 1 shown.

[0152] Figure 1 In the figure, A shows the expression changes of AANAT, the rate-limiting enzyme in melatonin synthesis, during the day and at night, as follows: (0.2075±0.02869VS 0.8100±0.09670), n=4 (unit: head); B shows the expression changes of ISL 2, a transcription factor, during the day and at night, as follows: (0.2675±0.02056VS 0.7075±0.1015), n=4 (unit: head). Figure 1 All data are expressed as mean ± standard error. Different letters indicate significant differences within the group (p<0.05), and the same letters indicate no significant differences within the group (p>0.05). The internal reference gene is GAPDH.

[0153] pass Figure 1 It can be seen that the expression level of melatonin synthase AANAT in pig pineal gland at night is significantly higher than that during the day (p<0.05). At the same time, the expression of ISL2 gene at night is also significantly higher than that during the day (p<0.05), which is consistent with the expression change trend of AANAT and shows circadian rhythm.

[0154] Example 2. Norepinephrine activates the expression of AANAT and ISL2 and promotes melatonin synthesis

[0155] Primary porcine pineal cells were isolated in vitro and plated in 12-well plates (approximately 0.5 × 10 cells per well). 65 wells were added to each well of the control group and the norepinephrine (NE group) group, and the cells were stably cultured for 24 hours. The culture medium was replaced with serum-free DMEM / F12 medium, and the cells were starved for 30 minutes. Norepinephrine was added at a final concentration of 1 μM for 40 minutes. The cell supernatant was collected for melatonin concentration detection. At the same time, the cells were collected, RNA was extracted and reversely transcribed into cDNA, and the expression changes of ISL2 and AAN AT were quantitatively detected. The measurement results are shown in Figure 2 shown.

[0156] Figure 2 In the figure, A shows the flow chart of in vitro culture and drug treatment of primary porcine pineal cells; B shows the changes in melatonin concentration in the supernatant of cells in the control group and the norepinephrine treatment group, as follows: (1.829±0.2466VS 4.795±1.020), n=5 (unit: well); C shows the changes in ISL2 expression in cells in the control group and the norepinephrine treatment group, as follows: (0.2460±0.01568VS 0.6500±0.1018), n=5 (unit: well); D shows the changes in AANAT expression in cells in the control group and the norepinephrine treatment group, as follows: (0.3280±0.04454VS 0.6540±0.1027), n=5 (unit: well). Figure 2 All data are expressed as mean ± standard error, different letters indicate significant differences within the group (p < 0.05), and the same letters indicate no significant differences within the group (p > 0.05). The internal reference gene is GAPDH.

[0157] pass Figure 2 It can be seen that compared with the control group, norepinephrine treatment can significantly increase the concentration of melatonin in primary pig pineal cells (p<0.05). At the same time, the expression levels of the key enzyme AANAT and transcription factor ISL2 in melatonin synthesis were significantly increased (p<0.05), and the expression changes of the two were positively correlated, further suggesting that ISL2 may be involved in regulating the synthesis of melatonin.

[0158] Example 3. ISL2 promotes melatonin synthesis by regulating AANAT expression

[0159] Primary porcine pinealocytes were plated into 12-well plates (approximately 0.5 × 10 cells per well). 6), after stable culture for 24 hours, 4 μL of small interfering RNA (concentration of 100 pM, the sequence of the positive chain of the small interfering RNA is: CAGUCGAGGUGCAGACGUATT (5'-3', SEQ ID NO: 8), the sequence of the antisense chain of the small interfering RNA is: UACGIUCUGCACCUCGACUGTT (5'-3', SEQ ID NO: 9)) and 4 μL of lip3000 transfection reagent were added to 50 μL of serum-free DMEM / F12 culture medium, mixed, and allowed to stand for 15 minutes before transfection into primary porcine pineal cells to inhibit the expression of the ISL2 gene. After 24 hours of transfection, the changes in melatonin concentration in the cell supernatant and the changes in the expression of AANAT and ISL2 genes were detected. At the same time, 293T cells were transfected according to the above method, and the regulatory effect of ISL2 on the activity of the AA NAT promoter was detected using a dual luciferase reporter experiment. The measurement results are as follows Figure 3 shown.

[0160] Figure 3 In the figure, A shows the binding site of ISL2 in the AANAT promoter region; B shows the effect of overexpression of ISL2 on the promoter activity of the AANAT gene; C shows the expression changes of ISL2 and AANAT after interfering with ISL2 in primary porcine pineal cells, as follows: (ISL2: 0.9333±0.03756VS 0.6767±0.008819, AANAT: 0.9733±0.01764VS0.8633±0.02906), n=3 (unit: well); D shows the change of melatonin concentration in the supernatant of primary porcine pineal cells after interfering with ISL2, as follows: (4.369±0.6470VS1.601±0.2678), n=3 (unit: well). Figure 3 All data are expressed as mean ± standard error, different letters indicate significant differences within the group (p < 0.05), and the same letters indicate no significant differences within the group (p > 0.05). The internal reference gene is GAPDH.

[0161] pass Figure 3 It can be seen that inhibiting the expression of the ISL2 gene can significantly reduce the expression level of the melatonin synthase AANAT, thereby inhibiting melatonin synthesis (p<0.05). In addition, it was determined that ISL2, as a transcription factor, can bind to the AANAT promoter region and promote the expression of AANAT.

[0162] The above results indicate that the transcription factor ISL2 is involved in regulating the synthesis of melatonin in the pig pineal gland.

[0163] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. Application of ISL2 in any of a1)-a3): a1) regulating the synthesis of melatonin in animals or animal cells; a2) regulating the expression of AANAT in animals or animal cells; a3) regulating the activity of AANAT promoter in animals or animal cells.

2. The use according to claim 1, characterized in that: The ISL2 positively regulates the synthesis of melatonin in animals or animal cells; and / or The ISL2 positively regulates the expression of AANAT in animals or animal cells; and / or The ISL2 positively regulates the activity of the AANAT promoter in an animal or animal cell; Preferably, the application does not involve diagnosis and / or treatment of a disease.

3. Application of any of b1)-b3) in any of c1)-c5): b1)ISL2; b2) biological materials related to ISL2; b3) agents that target and upregulate the expression of ISL2 and / or enhance the activity of ISL2; c1) promoting the synthesis of melatonin in animals or animal cells; c2) increasing the expression level of AANAT in animals or animal cells; c3) increasing the activity of the AANAT promoter in an animal or animal cell; c4) breeding of animal breeds; c5) preparing a product, wherein the product is used in any one of c1) to c4); The biological material comprises at least one of g1)-g9): g1) a nucleic acid molecule encoding ISL2; g2) an expression cassette containing the nucleic acid molecule of g1); g3) a vector containing the nucleic acid molecule of g1); g4) a vector containing the expression cassette of g2); g5) a cell containing the nucleic acid molecule of g1); g6) a cell containing the expression cassette of g2); g7) a cell containing the vector of g3); g8) a cell containing the vector of g4); g9) a cell containing ISL2.

4. The use according to claim 3, characterized in that: The animal species comprises at least one of the characteristics d1)-d3): d1) increased melatonin content; d2) increased expression of AANAT; d3) increased activity of AANAT promoter; Preferably, the applications described in c1)-c4) do not involve the diagnosis and / or treatment of diseases; Preferably, any one of the vectors in g3)-g4) includes a prokaryotic expression vector and a eukaryotic expression vector; Preferably, the cell described in any one of g5) to g9) is selected from prokaryotic cells and eukaryotic cells.

5. Use of ISL2 inhibitor in any of e1)-e5): e1) inhibiting the synthesis of melatonin in animals or animal cells; e2) reducing the expression of AANAT in animals or animal cells; e3) reducing the activity of the AANAT promoter in an animal or animal cell; e4) breeding of animal breeds; e5) preparing a product, wherein the product is used for any one of e1) to e4).

6. The use according to claim 5, characterized in that: The animal species comprises at least one of the characteristics of f1)-f3): f1) reduced melatonin content; f2) reduced expression of AANAT; f3) The activity of AANAT promoter is reduced; Preferably, the ISL2 inhibitor comprises at least one of a substance that inhibits ISL2 activity, a substance that degrades ISL2, and a substance that reduces the expression amount of ISL2; and further comprises a substance that reduces the expression amount of ISL2; Preferably, the substance that reduces the expression amount of ISL2 comprises at least one of h1)-h10): h1) siRNA, dsRNA, miRNA, ribozyme, shRNA, or CRISPR / Cas system targeting ISL2; h2) a nucleic acid molecule encoding h1); h3) an expression cassette comprising the nucleic acid molecule of h2); h4) a vector comprising the nucleic acid molecule of h2); h5) a vector comprising the expression cassette of h3); h6) a cell comprising the nucleic acid molecule of h2); h7) a cell comprising the expression cassette of h3); h8) a cell comprising the vector of h4); h9) a cell comprising the vector of h5); h10) a cell comprising the siRNA, dsRNA, miRNA, ribozyme, shRNA, or CRISPR / Cas system of ISL2 of h1); Preferably, the sequences of the sense strand and antisense strand of the siRNA targeting ISL2 are shown in SEQ ID NO: 8 and SEQ ID NO: 9, respectively; Preferably, the applications described in e1)-e4) do not involve the diagnosis and / or treatment of diseases; Preferably, any one of the vectors in h4)-h5) includes a prokaryotic expression vector and a eukaryotic expression vector; Preferably, any one of the cells h6)-h10) is selected from prokaryotic cells and eukaryotic cells.

7. A method comprising the steps of: increasing the expression level and / or activity of ISL2 in an animal or animal cell; The method is any one of c1) to c4): c1) Methods for promoting the synthesis of melatonin in animals or animal cells; c2) A method for increasing the expression level of AANAT in an animal or animal cell; c3) A method for increasing the activity of the AANAT promoter in an animal or animal cell; c4) Methods of breeding animal breeds.

8. The method according to claim 7, characterized in that The animal species comprises at least one of the characteristics d1)-d3): d1) increased melatonin content; d2) increased expression of AANAT; d3) increased activity of AANAT promoter; Preferably, the method for increasing the expression and / or activity of ISL2 in an animal or animal cell is to treat the animal or animal cell with the ISL2, the ISL2-related biomaterial, and / or the reagent for targeted upregulation of the expression and / or enhancement of the ISL2 activity as described in any one of claims 3 to 4; Preferably, the method for increasing the expression level and / or activity of ISL2 in an animal or animal cell is to introduce a nucleic acid molecule encoding ISL2 into the animal or animal cell; Preferably, the nucleic acid molecule encoding ISL2 is introduced into an animal or animal cell via a recombinant vector; the recombinant vector is a vector obtained by inserting the nucleic acid molecule encoding ISL2 into a multiple cloning site of an expression vector; Preferably, the method does not involve diagnosis, and / or treatment of a disease.

9. A method comprising the steps of: reducing the expression and / or activity of ISL2 in an animal or animal cell; The method is any one of e1) to e4): e1) Method for inhibiting the synthesis of melatonin in animals or animal cells; e2) A method for reducing the expression of AANAT in an animal or animal cell; e3) A method for reducing the activity of the AANAT promoter in an animal or an animal cell; e4) Methods of breeding animal breeds.

10. The method according to claim 9, characterized in that The animal species comprises at least one of the characteristics of f1)-f3): f1) reduced melatonin content; f2) reduced expression of AANAT; f3) The activity of AANAT promoter is reduced; Preferably, the method for reducing the expression level and / or activity of ISL2 in an animal or animal cell comprises: treating the animal or animal cell with the ISL2 inhibitor described in any one of claims 5 to 6; Preferably, the method for reducing the expression level and / or activity of ISL2 in an animal or animal cell comprises: introducing the siRNA targeting ISL2 as described in claim 6 into the animal or animal cell; Preferably, the method does not involve diagnosis, and / or treatment of a disease.

11. The use or method according to any one of claims 1 to 10, characterized in that: The animal is a mammal; further a livestock; further a cow, a pig, a sheep, a horse, a chicken, a dog, a duck, a goose, an alpaca, or a camel; further a pig; Preferably, the cells are pinealocytes or 293T cells.

12. siRNA targeting ISL2 or biological materials related thereto, The sequences of the sense strand and antisense strand of the siRNA targeting ISL2 are shown in SEQ ID NO:8 and SEQ ID NO:9, respectively; The biological material comprises any one of h1)-h9): h1) a nucleic acid molecule encoding the siRNA targeting ISL2; h2) an expression cassette comprising the nucleic acid molecule of h1); h3) a vector comprising the nucleic acid molecule of h1); h4) a vector comprising the expression cassette of h2); h5) a cell comprising the nucleic acid molecule of h1); h6) a cell comprising the expression cassette of h2); h7) a cell comprising the vector of h3); h8) a cell comprising the vector of h4); h9) a cell comprising the siRNA targeting ISL2.

Images