Gene OsbHLH178 for controlling cold tolerance of rice and application of gene OsbHLH178

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a gene OsbHLH178 for controlling cold tolerance of rice and application thereof. The nucleotide sequence of the gene is shown as a sequence table SEQ ID NO: 1, and the coded amino acid sequence is shown as a sequence table SEQ ID NO: 2. According to the invention, the rice OsbHLH178 gene is edited by using a CRISPR-Cas9 gene editing technology, and the expression of the encoding protein of the rice OsbHLH178 gene is silenced, so that the cold-sensitive rice mutant is obtained. The method comprises the following steps: cloning OsbHLH178CDS into a pC1390U vector, and constructing an overexpression vector; under cold stress, the survival rate of the mutant is lower than that of a wild type, and the survival rate of overexpressed transgenic rice is higher than that of the wild type, so that the OsbHLH178 gene plays an important role in regulating the cold tolerance of the rice. The invention provides a new resource for cold-resistant breeding of plants and rice.

Description

Technical Field

[0001] The invention relates to the technical field of plant transgenic technology and crop genetic breeding, in particular to a gene OsbHLH178 for controlling cold tolerance of rice and an application thereof. Technical Background

[0002] Rice is one of the important food crops, widely planted and providing staple food. Rice grows well in warm and humid environments because of its high yield and rich nutrition. However, rice is extremely sensitive to low temperatures. When the temperature is lower than the suitable temperature for its growth, the metabolic process is inhibited, resulting in abnormal development and may even lead to death. Low temperature stress limits the cultivation of rice in cold areas, especially in the north and high latitudes, where the problem of cold damage is particularly prominent. Therefore, cold-resistant breeding has become an important direction for rice improvement. By studying the cold-resistant mechanism of rice and developing cold-resistant varieties, it is possible to improve the adaptability of rice in low temperature environments and meet the needs of rice in different regions.

[0003] Although several genes related to cold tolerance have been identified in rice, such as the DREB gene family, bZIP transcription factor genes OsABI5 and OsbZIP23, and rice NAC family transcription factor OsNAC5, these genes have shown certain cold tolerance effects in experiments, but the cold tolerance genes that can be actually applied to rice breeding are still very limited. Researchers have found that overexpression of the OsDREB1 gene can significantly improve the cold tolerance of rice, and overexpression of genes such as OsNAC5 can also enhance the cold tolerance of rice by activating genes in the downstream cold response signal pathway. However, most of these genes belong to the upstream part of the signal transduction pathway, and their overexpression often leads to abnormal phenotypes or poor epigenetic traits in rice growth, such as dwarf plants and reduced yields, thus limiting their application in actual production. In addition, some cold tolerance genes may show unstable tolerance under different environmental conditions, so their application faces great challenges. In order to promote the application of cold tolerance genes, current research focuses on screening and cloning cold tolerance genes that can not only improve cold tolerance but also have good expression stability. Summary of the invention

[0004] The present invention discovered the gene OsbHLH178 related to rice cold tolerance through high-throughput genomics analysis and functional genomics research. The gene is located on chromosome 7, with the MSU_Locus number LOC_Os07g48900, a genome sequence of 774 bp in length, a coding region of 534 bp in length, and a protein encoding length of 177 amino acid residues. Through gene knockout and overexpression, we verified the function of the OsbHLH178 gene under low temperature stress. After knocking out the gene, the cold tolerance of rice was significantly weakened, as shown by an increase in mortality under low temperature conditions; while overexpressing the gene enhanced the cold tolerance of rice and reduced the mortality under low temperature conditions.

[0005] In the first aspect, the present invention protects a protein OsbHLH178, which is any one of the following proteins: A1) a protein having an amino acid sequence as shown in SEQ ID NO: 2;

[0006] A2) a protein obtained by replacing and / or deleting and / or adding amino acid residues of the protein of A1) and having an identity of more than 80% with the protein of A1) and having the function of improving the cold resistance of rice;

[0007] A3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of A1) or A2).

[0008] In order to facilitate purification or detection of the protein in A1), a tag protein may be connected to the amino terminus or carboxyl terminus of the protein consisting of the amino acid sequence shown in SEQ ID No. 2 in the sequence listing.

[0009] The above proteins can be artificially synthesized, or their encoding genes can be synthesized first and then expressed biologically.

[0010] The tag protein includes but is not limited to: GST (glutathione sulfhydryltransferase) tag protein, His6 tag protein (His-tag), MBP (maltose binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomeric red fluorescent protein) or AviTag tag protein, etc.

[0011] In a specific embodiment, the protein is derived from rice.

[0012] In a second aspect, the present invention also protects biological materials related to the above-mentioned protein, wherein the biological material is any one of the following:

[0013] B1) a nucleic acid molecule encoding the protein described above;

[0014] B2) a recombinant vector containing the nucleic acid molecule described in B1);

[0015] B3) a recombinant microorganism containing the nucleic acid molecule described in B1) or a recombinant microorganism containing the recombinant vector described in B2);

[0016] B4) A transgenic plant cell line containing the nucleic acid molecule described in B1) or a transgenic plant cell line containing the recombinant vector described in B3).

[0017] In a specific embodiment, the nucleotide sequence of the nucleic acid molecule in B1) is shown as SEQ ID NO:1.

[0018] In a specific embodiment, the nucleotide sequence shown in SEQ ID NO:1 (OsbHLH178 gene) encodes the protein OsbHLH178 having the amino acid sequence shown in SEQ ID NO:2.

[0019] The vectors described herein are well known to those skilled in the art, including but not limited to: plasmid, phage (such as lambda phage or M13 filamentous phage, etc.), cosmid (i.e., cosmid), Ti plasmid or viral vector. Specifically, it can be a pC1390U vector or a TKC vector.

[0020] In a third aspect, the present invention also protects the use of the above-mentioned protein or the above-mentioned biological material in improving the cold resistance of rice.

[0021] In a fourth aspect, the present invention also protects the use of the above-mentioned protein or the above-mentioned biological material in the preparation of rice with improved cold resistance.

[0022] In a fifth aspect, the present invention also protects the use of the above-mentioned protein or the above-mentioned biological material in cultivating cold-resistant rice.

[0023] In a sixth aspect, the present invention also protects a method for improving the cold resistance of rice, wherein the method obtains cold-resistant rice by increasing the expression level of the gene encoding the protein mentioned above in the target rice, or by increasing the activity and / or content of the protein mentioned above.

[0024] Overexpression of the OsbHLH178 gene in the target rice revealed that the cold tolerance of the rice was enhanced and the mortality rate under low temperature conditions was reduced.

[0025] In a seventh aspect, the present invention also protects a method for cultivating cold-resistant rice, by increasing the expression level of the gene encoding the protein mentioned above in the target rice, or by increasing the activity and / or content of the protein mentioned above, to obtain cold-resistant rice.

[0026] Based on the above research, the present invention proposes a method for improving the cold tolerance of rice by increasing the expression of the OsbHLH178 gene. This method can effectively improve the growth adaptability of rice in a cold environment and provide a new idea for rice breeding.

[0027] In addition, the cold-tolerant gene and its application technology provided by the present invention can not only enhance the resistance of rice to low temperature conditions, but also provide a reference for improving the cold tolerance of other crops. As global climate change leads to increasingly severe low-temperature environments, this technology has broad application prospects and can help agricultural production better cope with the challenges brought by the cold climate. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 is the vector map of the pC1390U vector;

[0029] Figure 2 This is the map of the TKC vector used for CRISPR-Cas9;

[0030] Figure 3 It is a map of CRISPR-Cas9 knockout targets and mutation sites;

[0031] Figure 4 Figure 2 shows the cold tolerance phenotypes and quantitative results of the wild type (WT), mutant (bhlh178) and overexpression (178OE) plants (A left: phenotypes of the wild type and bhlh178 mutant plants after 3 days of cold treatment and one week of recovery, B is a quantitative graph of their survival rate; A middle, phenotypes of the wild type and overexpression (178OE) plants grown under normal conditions; A right, phenotypes of the wild type and overexpression (178OE) plants after 5 days of cold treatment and one week of recovery, C is a quantitative graph of their survival rate, and D is the measurement result of ion leakage rate after cold treatment). DETAILED DESCRIPTION

[0032] The following examples are provided for better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified.

[0033] The rice variety Zhonghua 11 was preserved in the laboratory. The overexpression vector pC1390U used in the present invention is shown in the map. Figure 1 , the sequence is shown in SEQ ID NO:3.

[0034] Example 1: Cloning of the rice cold tolerance gene OsbHLH178

[0035] (1) Rice RNA extraction

[0036] 0.2 g of young rice leaves were used to extract total RNA using the Trizol method. The RNA purity was assessed by measuring the RNA concentration and A260 / A280 ratio; meanwhile, the integrity of the RNA was tested by agarose gel electrophoresis to verify its quality.

[0037] (2) Reverse transcription to obtain rice cDNA

[0038] The residual genomic DNA in RNA was removed and reverse transcribed to obtain cDNA. The operation was performed according to PrimeScript of TaKaRa Company. TM Follow the instructions of RT reagent Kit with gDNAeraser (Perfect Real Time).

[0039] The reaction conditions were as follows: incubation at 42°C for 30 min in a PCR instrument and heating at 85°C for 5 sec to inactivate Prime Script RT Enzyme Mix and gDNA Eraser.

[0040] (3) Acquisition of OsbHLH178 gene

[0041] Primers were designed using Primer3 Plus software, the GC content was controlled between 40% and 60%, and the cloning primers OsbHLH178-F and OsbHLH178-R were designed for OsbHLH178, and PCR amplification was performed to obtain the full-length coding region product of OsbHLH178. The primer sequence information is: OsbHLH178-F: AATTTGAGTCGTGGCCTGC, OsbHLH178-R: CACACAGGCCAAATCCGAAC.

[0042] According to the pC1390U vector (vector map see Figure 1 ) on the rice, designed primers OsbHLH178-KpnI-F and OsbHLH178-BamHI-R, and introduced the flanking sequence of the OsbHLH178 gene into the KpnI and BamHI restriction sites by PCR amplification. The success of the amplification product was verified by 1% agarose gel electrophoresis. Finally, the sequencing results showed that the sequence of the coding region of the OsbHLH178 gene was consistent with the OsbHLH178 coding region sequence annotated in the rice genome data.

[0043] Example 2: Construction of OsbHLH178 gene overexpression vector

[0044] Gene fragment recovery: Agarose gel electrophoresis was used to recover the OsbHLH178 gene coding region fragment obtained from Example 1. Vector double digestion: KpnI and BamHI were used to double digest the pC1390U vector. The vector fragment was recovered after digestion. Ligation reaction: ExnaseII ligase (Novozyme) was used to connect the OsbHLH178 gene coding region fragment with the vector fragment. The ligation reaction conditions were: 37°C, 30min. Reaction system: ExnaseII ligase (2μL), 5×CE Buffer (4μL), OsbHLH178 gene fragment (2μL, 100ng), linearized pC1390U vector (2μL, 50ng), sterile water (10μL). Transformation: Take 10μL of the ligation product and transform Escherichia coli DH5α cells using the heat shock method. After transformation, the bacteria were spread on LB solid medium containing kanamycin. Cultivation and screening: Cultivate overnight at 37°C, select 10 single clones for plasmid extraction, and perform PCR identification. PCR identification and sequencing: Select two positive clones for sequencing. The sequencing results show that the inserted PCR product sequence is SEQ ID NO.1, with a length of 534bp. The protein encoded by this sequence consists of 177 amino acid residues, and the sequence is SEQID NO.2. Construction of recombinant expression vector: Through the above steps, an overexpression vector containing the OsbHLH178 gene was obtained, named pC1390U-OsbHLH178.

[0045] Example 3: Construction of OsbHLH178 gene knockout expression vector

[0046] The exon region sequence with high specificity for gene OsbHLH178 was screened as the target through the CRISPR website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR / CRISPR), and then the target sequence was cloned into the TKC vector (see vector map for details). Figure 2 ), the knockout vector of OsbHLH178 was obtained by sequencing identification. The process is as follows:

[0047] (1) Primers are synthesized according to the target sequence, and the sequence information is:

[0048] Primer1: 5'

[0049] CAGATGATCCGTGGCACACGACCGCAAGCTCGATCCGTTTTAGAGCTAGAA3';

[0050] Primer2: 5'TTCTAGCTCTAAAACGGATCGAGCTTGCGGTCGTGTGCCACGGATCATCTG 3'.

[0051] (2) Dissolve the above primer sequences in 1×TE to a 100 μM stock solution. Take 1 μL of primer 1 and primer 2 as the front and back primers, add 1 μL of each into 98 μL of 0.5×TE solution, and mix and dilute to 1 μM.

[0052] (3) Keep at 95°C for 3 min, then cool to room temperature to complete annealing.

[0053] (4) Enzyme digestion and conjugation system (Thermo scientific) is as follows:

[0054]

[0055] The reaction procedure was: 37°C for 5 min, 20°C for 5 min. The above two conditions were maintained for 10 cycles. The amplification reaction was carried out in a BIO-RAD T100 thermal cycler. The product was transformed into Escherichia coli DH5α competent cells (CB101, Beijing Tiangen Company), and the positive clones were selected and sequenced. The sequence determination results showed that the obtained fragment was an OsbHLH178 knockout vector containing the target sequence, named pTKC-OsbHLH178.

[0056] Example 4: Rice genetic transformation

[0057] Rice transformation was carried out by using the Agrobacterium EHA105-mediated genetic transformation method. The specific steps of the Agrobacterium-mediated genetic transformation method are as follows:

[0058] (1) Obtaining recombinant Agrobacterium

[0059] pC1390U-OsbHLH178 and pTKC-OsbHLH178 were transformed into Agrobacterium EHA105 strain (purchased from American Jun Company) by freeze-thaw method to obtain recombinant strains, and plasmids were extracted for PCR identification. The correctly identified recombinant strains were named EH-pC1390U-OsbHLH178 and EH-pTKC-OsbHLH178.

[0060] (2) Transformation of Agrobacterium

[0061] Seed treatment: Select mature and full rice seeds, remove the shells, disinfect with 75% alcohol for 1-2 minutes, discard the alcohol, add 0.15% mercuric chloride (containing 0.1% Tween 20) for 10 minutes, discard the mercuric chloride, and rinse with sterile distilled water for 6 times. Inoculate the seeds with callus induction medium and culture them at 28℃ for 20 days.

[0062] Preparation of Agrobacterium: Streak Agrobacterium EHA105 transformed with pC1390U-OsbHLH178 and pTKC-OsbHLH178 vectors on LB plates containing 20 mg / L Rif and 50 mg / L Kan, respectively, and culture at 28°C for 2 days; pick a single colony in LB liquid culture medium and culture at 28°C and 200 rpm for 2 days; before infection, scrape the bacterial liquid into the suspension culture medium, shake at 28°C and 180 rpm for 3-3.5 hours, and adjust to OD600=0.1-0.15.

[0063] Callus infection: Take rice callus with a diameter of 2-4 mm and immerse it in the bacterial solution for 20 minutes. Then absorb the surface bacterial solution and cover it with sterilized filter paper. After blowing dry in a clean bench for 30 minutes, transfer it to the co-cultivation medium covered with sterilized filter paper, and culture it in the dark at 20℃ overnight, and then culture it in the dark at 25℃ for 2 days.

[0064] Washing and screening: The co-cultured callus tissue was repeatedly washed with sterile distilled water for 7-8 times, and finally soaked in sterile water containing 500 mg / L carbenicillin for 30 minutes, the solution was discarded, the surface water was dried, and then blown dry in a clean bench for 1 hour. Subsequently, the callus tissue after bacterial removal was placed in a screening medium containing hygromycin and cultured at 32°C for 14 days.

[0065] (3) Callus differentiation and regeneration: After 14 days of screening and culture, the resistant callus was transferred to differentiation medium and cultured at 28°C (photoperiod of 14 hours light / 10 hours dark). When the resistant callus formed 3-4 cm high regenerated seedlings on the differentiation medium, it was transferred to rooting medium and cultured until complete transgenic rice plants were formed.

[0066] Example 5 Identification of cold tolerance of wild type, OsbHLH178 gene mutants and overexpressing plants

[0067] The seeds of wild type, OsbHLH178 mutant and overexpressed rice were placed in 2.5% sodium hypochlorite solution for disinfection for 20 minutes (note that the time should not be too long), and then washed 5 times with sterilized deionized water. After washing, the seeds were evenly spread on filter paper, added with an appropriate amount of sterilized water, and placed in an incubator at 28°C for germination. Three days later, the germinated seeds were transferred to a 96-well hydroponic box, and 40 seeds of each variety (wild type, OsbHLH178 mutant, overexpressed plants) were planted, and 3 biological replicates were set. The growth conditions were: 13h light, 11h dark, light intensity 40000LUX, temperature 28°C during light, temperature 25°C in the dark, and relative humidity 75%.

[0068] When the seedlings grow to two weeks old, they are transferred to an artificial climate chamber for cold tolerance assessment. The cold treatment conditions are: 13 hours of light, 11 hours of darkness, light intensity of 40,000 LUX, temperature of 4°C during light, temperature of 4°C during darkness, and relative humidity of 70%. After 3-5 days of cold treatment, the seedlings are removed and restored to normal growth conditions: 13 hours of light, 11 hours of darkness, light intensity of 40,000 LUX, temperature of 28°C during light, temperature of 25°C during darkness, and relative humidity of 70%. After 7 days of recovery, the survival rate was calculated by the ratio of the number of surviving seedlings to the total number of seedlings, and the ion leakage rate was determined (about 0.3 grams of seedling leaf samples treated at 4°C were placed in a 15-ml centrifuge tube containing 5 ml of deionized water. Subsequently, the solution was shaken at 200 rpm for 1 hour at room temperature, and the conductivity of the solution was measured and recorded as S1. Next, the centrifuge tube was placed in boiling water and heated for 20 minutes, and shaken again at room temperature for 1 hour, and the total conductivity was measured and recorded as S2. S0 is the conductivity of deionized water. The relative ion leakage rate was calculated according to the following formula: Ion leakage rate (%) = (S1-S0) / (S2-S0).).

[0069] The results are as follows Figure 4 As shown: Compared with the wild type, after 3 days of treatment at 4°C, the osbhlh178 mutant plants were significantly shorter and their leaves showed significant yellowing ( Figure 4 A left); after 5 days of treatment at 4°C, the growth of OsbHLH178 overexpressing plants was better than that of the wild type, with leaves green and no obvious yellowing ( Figure 4 A right). Figure 4 B shows that after 3 days of cold stress treatment, the survival rate of the osbhlh178 mutant was 54.9%, which was lower than that of the wild type (78.5%); Figure 4 C shows that after 5 days of cold stress treatment, the survival rate of OsbHLH178 overexpressing plants was 78.5%, significantly higher than that of the wild type (22.3%). Figure 4 D shows that the ion leakage rate of OsbHLH178 overexpressing plants was only 25.2%, significantly lower than 42.6% of the wild type. These results indicate that the OsbHLH178 gene plays an important role in improving the cold tolerance of rice.

[0070] The cold-tolerant gene and its application method provided by the present invention can significantly improve the adaptability and resistance of rice in low-temperature environments, and it is expected to increase the yield and stability of rice in the context of global climate change. Through gene editing technology, precision breeding can be achieved, reducing dependence on traditional breeding methods and improving the sustainability of rice production. The cold-tolerant gene and its application method provided by the present invention can significantly improve the adaptability and resistance of rice in low-temperature environments, and it is expected to increase the yield and stability of rice in the context of global climate change. Through gene editing technology, precision breeding can be achieved, reducing dependence on traditional breeding methods and improving the sustainability of rice production.

[0071] The present invention has been described in detail above with general descriptions and specific embodiments, but it is obvious to those skilled in the art that some modifications or improvements can be made on the basis of the present invention. Therefore, these modifications or improvements made on the basis of not departing from the spirit of the present invention all belong to the scope of protection claimed by the present invention.

[0072] sequence

[0073] SEQ ID NO: 1

[0074] CDS

[0075] >LOC_Os07g48900.1

[0076] ATGGCGTCCTCGCCGACCTCCACGGCGCCACACGACCGCAAGCTCGATCCCGCCGCCTCGCCGGCAGCCAGGTGGCGGACGAGGCGGGAGCAGGAGAGCTACTCCTCCAAGCTGCTCGACGCGCTGCGCCTGGTCCGCGCCGCCAGCGGCAGACCATCACCCGCGTCGTCGCGCGAGGTGCGCCACGCGGCCGACCGCGCCCTCGCCGTGGCGGCGCGAGGGCGGTCGCGGTGGAGCCGCGCCATCCTCGCCTCCCGCGCGCGCGCGTGCGCGCTCCGCCGCGTGCGCCTCGGCGCGCCGCCCCCGCCGCCCGCCGCGCGTCCGGCGCCGCGCTCGCGGCCGCCGCTGGCGAGCAAGGCGAAGGTGCTGGGGCGGCTAGTGCCCGGGTGCCGGAAGCTGGCGTTCCCGGCGCTCCTGGCGGAGGCGTCGGACTACATTGCTGCGCTGGAGATGCAGGTGCGCGCCATGGCGGCGCTCGCGCAGGCACTCCAGTCCGTGGCACCCGCGCCGCCGCCGCCGC

[0077] CGTCGTCGTCGTGA

[0078] Protein

[0079] >LOC_Os07g48900.1

[0080] Met Ala Ser Ser Pro Thr Ser Thr Ala Pro His Asp Arg Lys Leu Asp ProAla Ala Ser Pro AlaArg Trp Arg Thr Arg Glu Gln Glu Ser Tyr SerLys Leu Leu Asp Ala Leu Arg Leu Val ArgAla Ala Ser Gly Arg Pro Arg Pro AlaSer Arg Arg Arg Ala Glu Ala Arg GlyArg Ser Arg Trp Ser Arg Ala Ile Leu Ala Ser Arg Ala Arg Ala Cys Ala Leu ArgArgVal Arg Leu Gly Ala Pro Pro Pro Ala Ala Arg Pro Ala Pro Arg SerArg Pro Leu Ala SerLys Ala Lys Val Leu Gly Arg Leu Val Pro Gly Ala Serle Arg Le Leu Tyla Leu Ala P Leu GluMet Gln Val Arg Ala Met Ala Ala Leu Alapro Gln Ala Leu Gln SerVal Ala Pro AlaPro Pro Pro Pro Ser Ser Ser*。

Claims

1. A protein, wherein the protein is any of the following: A1) a protein with an amino acid sequence as shown in SEQ ID NO: 2; A2) a protein obtained by replacing and / or deleting and / or adding amino acid residues of the protein of A1) and having an identity of more than 80% with the protein of A1) and having the function of improving the cold resistance of rice; A3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of A1) or A2).

2. The protein according to claim 1, characterized in that The protein is derived from rice.

3. A biological material related to the protein according to claim 1 or 2, wherein the biological material is any one of the following: B1) a nucleic acid molecule encoding the protein according to claim 1; B2) a recombinant vector containing the nucleic acid molecule described in B1); B3) a recombinant microorganism containing the nucleic acid molecule described in B1) or a recombinant microorganism containing the recombinant vector described in B2); B4) A transgenic plant cell line containing the nucleic acid molecule described in B1) or a transgenic plant cell line containing the recombinant vector described in B3).

4. The biomaterial according to claim 2, characterized in that B1) The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO:

1.

5. Use of the protein according to claim 1 or 2 or the biomaterial according to claim 3 or 4 in improving the cold resistance of rice.

6. Use of the protein according to claim 1 or 2 or the biomaterial according to claim 3 or 4 in the preparation of rice for improving the cold resistance.

7. Use of the protein according to claim 1 or 2 or the biological material according to claim 3 or 4 in cultivating cold-resistant rice.

8. A method for improving the cold resistance of rice, characterized in that: Cold-resistant rice is obtained by increasing the expression level of the gene encoding the protein of claim 1 in the target rice, or by increasing the activity and / or content of the protein of claim 1.

9. A method for cultivating cold-resistant rice, characterized in that: Cold-resistant rice is obtained by increasing the expression level of the gene encoding the protein of claim 1 in the target rice, or by increasing the activity and / or content of the protein of claim 1.

Images