Gene osbhlh178 for controlling cold tolerance of rice and application thereof

By regulating the overexpression of the rice gene OsbHLH178, the problem of rice's growth adaptability in low-temperature environments was solved, enabling stable growth and high yield of rice in cold regions.

CN119708185BActive Publication Date: 2026-03-24NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-31
Publication Date
2026-03-24

AI Technical Summary

Technical Problem

In existing technologies, rice is sensitive to low temperatures, which limits its cultivation in cold regions. Existing cold-resistant genes have problems with abnormal growth or instability in application, which limits their application in breeding.

Method used

By discovering and verifying the function of the rice gene OsbHLH178, we can regulate the cold tolerance of rice and improve its growth adaptability in low-temperature environments through gene knockout and overexpression technologies.

Benefits of technology

It significantly enhances the resistance of rice to low temperatures, reduces mortality, improves growth adaptability, and provides a stable pathway for improving cold tolerance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119708185B_ABST
    Figure CN119708185B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of plant genetic engineering, and particularly relates to a gene OsbHLH178 for controlling cold tolerance of rice and application thereof. The nucleotide sequence of the gene is shown in the sequence table SEQ ID NO:1, and the amino acid sequence encoded by the gene is shown in the sequence table SEQ ID NO:2. The application uses CRISPR-Cas9 gene editing technology to edit the rice OsbHLH178 gene, silences the expression of the coded protein, and obtains a cold-sensitive rice mutant. The OsbHLH178 CDS is cloned into a pC1390U vector to construct an overexpression vector. Under cold stress, the survival rate of the mutant is lower than that of the wild type, and the survival rate of the overexpression transgenic rice is higher than that of the wild type, indicating that the OsbHLH178 gene plays an important role in regulating the cold tolerance of rice. The application provides a new resource for plant and rice cold resistance breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of plant transgenic technology and crop genetic breeding, and more specifically, to the gene OsbHLH178 that controls cold tolerance in rice and its application. Technical Background

[0002] Rice is one of the most important food crops, widely cultivated and providing staple food. Rice thrives in warm, humid environments due to its high yield and rich nutritional value. However, rice is extremely sensitive to low temperatures; below its optimal growth temperature, metabolic processes are inhibited, leading to abnormal development and even death. Low-temperature stress limits rice cultivation in cold regions, particularly in northern and high-latitude areas where chilling injury is especially prominent. Therefore, cold-resistant breeding has become an important direction for rice improvement. By studying the cold-resistance mechanisms of rice and developing cold-resistant varieties, we can not only improve the adaptability of rice to low-temperature environments but also meet the needs of different regions.

[0003] Although several cold-resistance-related genes have been identified in rice, such as the DREB gene family, the bZIP transcription factor genes OsABI5 and OsbZIP23, and the rice NAC family transcription factor OsNAC5, these genes have shown certain cold-resistance effects in experiments. However, the number of cold-resistance genes that can be practically applied to rice breeding remains very limited. Researchers have found that overexpression of the OsDREB1 gene can significantly improve the cold resistance of rice, and overexpression of genes such as OsNAC5 can also enhance the cold resistance of rice by activating genes in downstream cold response signaling pathways. However, most of these genes belong to the upstream part of the signal transduction pathway, and their overexpression often leads to abnormal phenotypes or undesirable epigenetic traits in rice growth, such as stunted growth and reduced yield, thus limiting their application in actual production. In addition, some cold-resistance genes may exhibit unstable tolerance under different environmental conditions, so their application faces significant challenges. To promote the application of cold-resistance genes, current research mainly focuses on screening and cloning cold-resistance genes that not only improve cold resistance but also have good expression stability. Summary of the Invention

[0004] This invention, through high-throughput genomics analysis and functional genomics research, identified the gene OsbHLH178, associated with cold tolerance in rice. This gene is located on chromosome 7, with the MSU_Locus number LOC_Os07g48900. Its full-length genome sequence is 774 bp, with a coding region of 534 bp, encoding a protein of 177 amino acid residues. Through gene knockout and overexpression, we verified the function of the OsbHLH178 gene under low-temperature stress. Knockout of this gene significantly reduced the cold tolerance of rice, manifested as increased mortality under low-temperature conditions; while overexpression of this gene enhanced the cold tolerance of rice and reduced mortality under low-temperature conditions.

[0005] In a first aspect, the present invention protects a protein OsbHLH178, said protein being any of the following: A1) a protein with an amino acid sequence as shown in SEQ ID NO: 2;

[0006] A2) A protein obtained by substituting and / or deleting and / or adding amino acid residues of the protein in A1) has more than 80% identity with the protein shown in A1) and has the ability to improve the cold resistance of rice.

[0007] A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1) or A2).

[0008] To facilitate the purification or detection of the protein in A1), a tag protein can be attached to the amino or carboxyl terminus of the protein, which consists of the amino acid sequence shown in SEQ ID No. 2 in the sequence listing.

[0009] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0010] The tagged proteins include, but are not limited to: GST (glutathione thiotransferase) tagged protein, His6 tagged protein (His-tag), MBP (maltose-binding protein) tagged protein, Flag tagged protein, SUMO tagged protein, HA tagged protein, Myc tagged protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tagged protein, etc.

[0011] In a specific implementation plan, the protein is derived from rice.

[0012] Secondly, the present invention also protects biological materials related to the proteins described above, wherein the biological materials are any of the following:

[0013] B1) Nucleic acid molecules that encode the proteins described above;

[0014] B2) A recombinant vector containing the nucleic acid molecules described in B1);

[0015] B3) Recombinant microorganisms containing the nucleic acid molecules described in B1) or recombinant microorganisms containing the recombinant vector shown in B2);

[0016] B4) A transgenic plant cell line containing the nucleic acid molecule described in B1) or a transgenic plant cell line containing the recombinant vector described in B3).

[0017] In a specific implementation scheme, the nucleotide sequence of the nucleic acid molecule described in B1) is as shown in SEQ ID NO: 1.

[0018] In a specific implementation, the nucleotide sequence (OsbHLH178 gene) shown in SEQ ID NO: 1 encodes the protein OsbHLH178 with the amino acid sequence shown in SEQ ID NO: 2.

[0019] The vectors described herein are well-known to those skilled in the art and include, but are not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cosmids), Ti plasmids, or viral vectors. Specifically, they may be pC1390U vectors or TKC vectors.

[0020] Thirdly, the present invention also protects the application of the proteins or biological materials described above in improving the cold resistance of rice.

[0021] Fourthly, the present invention also protects the use of the proteins or biomaterials described above in the preparation of rice with improved cold resistance.

[0022] Fifthly, the present invention also protects the use of the proteins or biological materials described above in the cultivation of cold-resistant rice.

[0023] Sixthly, the present invention also protects a method for improving the cold resistance of rice, wherein the method obtains cold-resistant rice by increasing the expression level of the coding gene of the protein described above in the target rice, or by increasing the activity and / or content of the protein described above.

[0024] Overexpression of the OsbHLH178 gene in the target rice variety resulted in enhanced cold resistance and reduced mortality under low-temperature conditions.

[0025] Seventhly, the present invention also protects a method for cultivating cold-resistant rice, which obtains cold-resistant rice by increasing the expression level of the coding gene of the protein described above in the target rice, or by increasing the activity and / or content of the protein described above.

[0026] Based on the above research, this invention proposes a method to improve the cold tolerance of rice by increasing the expression of the OsbHLH178 gene. This method can effectively improve the growth adaptability of rice in cold environments and provide new ideas for rice breeding.

[0027] Furthermore, the cold-resistant gene and its application technology provided by this invention not only enhance the resistance of rice to low-temperature conditions but also provide a reference for improving the cold resistance of other crops. With global climate change leading to increasingly severe low-temperature environments, this technology has broad application prospects and can help agricultural production better cope with the challenges posed by cold climates. Attached Figure Description

[0028] Figure 1 This is the vector map of the pC1390U vector;

[0029] Figure 2 This is a map of the TKC vector used in CRISPR-Cas9;

[0030] Figure 3 This is a diagram of CRISPR-Cas9 knockout targets and mutation sites;

[0031] Figure 4 Figures showing the cold tolerance phenotypes and quantification results of wild-type (WT), mutant (bhlh178), and overexpression (178OE) plants (A left: phenotypes of wild-type and bhlh178 mutant plants after 3 days of cold treatment and 1 week of recovery, B is a quantification of their survival rate; A middle: phenotypes of wild-type and overexpression (178OE) plants under normal conditions; A right: phenotypes of wild-type and overexpression (178OE) plants after 5 days of cold treatment and 1 week of recovery, C is a quantification of their survival rate, D is the result of ion leakage rate measurement after cold treatment). Detailed Implementation

[0032] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores.

[0033] The rice variety Zhonghua 11 was preserved in the laboratory. The overexpression vector pC1390U used in this invention is shown in the figure. Figure 1 The sequence is shown in SEQ ID NO: 3.

[0034] Example 1: Cloning of the rice cold tolerance gene OsbHLH178

[0035] (1) Rice RNA extraction

[0036] 0.2 g of young rice leaves were used to extract total RNA using the Trizol method. The purity of RNA was assessed by measuring its concentration and A260 / A280 ratio; the integrity of RNA was verified by agarose gel electrophoresis.

[0037] (2) Obtaining rice cDNA by reverse transcription

[0038] Residual genomic DNA was removed from the RNA and cDNA was obtained by reverse transcription, following the procedure described in TaKaRa's PrimeScript. TM Follow the instructions for the RT reagent kit with gDNAeraser (Perfect Real Time).

[0039] The reaction conditions were: incubation at 42°C for 30 min in a PCR instrument, followed by heating at 85°C for 5 sec to inactivate Prime Script RT Enzyme Mix and gDNA Eraser.

[0040] (3) Obtaining the OsbHLH178 gene

[0041] Primers were designed using Primer3 Plus software, controlling the GC content between 40% and 60%. Cloning primers OsbHLH178-F and OsbHLH178-R were designed for PCR amplification to obtain the full-length coding region of OsbHLH178. The primer sequences are: OsbHLH178-F: AATTTTGAGTCGTTGGCCTGC, OsbHLH178-R: CACACAGGCCAAATCCGAAC.

[0042] Based on the pC1390U vector (vector pattern see...), Figure 1 Primers OsbHLH178-KpnI-F and OsbHLH178-BamHI-R were designed to amplify the flanking sequences of the OsbHLH178 gene into the KpnI and BamHI restriction sites using PCR. The success of the amplification was verified using 1% agarose gel electrophoresis. Finally, sequencing results showed that the coding region of the OsbHLH178 gene was consistent with the OsbHLH178 coding region sequence annotated in the rice genome data.

[0043] Example 2: Construction of OsbHLH178 gene overexpression vector

[0044] Gene fragment recovery: The OsbHLH178 gene coding region fragment obtained from Example 1 was recovered by agarose gel electrophoresis. Vector double digestion: The pC1390U vector was double-digested with KpnI and BamHI. The vector fragment was recovered after digestion. Ligation reaction: The OsbHLH178 gene coding region fragment was ligated to the vector fragment using Exnase II ligase (Novizan). The ligation conditions were: 37℃, 30 min. Reaction system: Exnase II ligase (2 μL), 5×CE Buffer (4 μL), OsbHLH178 gene fragment (2 μL, 100 ng), linearized pC1390U vector (2 μL, 50 ng), sterile water (10 μL). Transformation: 10 μL of the ligation product was used to transform *E. coli* DH5α cells using the heat shock method. After transformation, the bacteria were plated onto LB agar containing kanamycin. Culture and Screening: The cells were cultured overnight at 37℃. Ten single clones were selected for plasmid extraction and PCR identification. PCR Identification and Sequencing: Two positive clones were selected for sequencing. Sequencing results showed that the inserted PCR product sequence was SEQ ID NO.1, with a length of 534 bp. The protein encoded by this sequence consists of 177 amino acid residues, with the sequence SEQ ID NO.2. Construction of Recombinant Expression Vector: Through the above steps, an overexpression vector containing the OsbHLH178 gene was obtained, named pC1390U-OsbHLH178.

[0045] Example 3: Construction of OsbHLH178 gene knockout expression vector

[0046] The CRISPR website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR / CRISPR) was used to screen for highly specific exon sequences of the OsbHLH178 gene as targets. The target sequences were then cloned into the TKC vector (vector map can be found here). Figure 2 In this study, the OsbHLH178 knockout vector was identified through sequencing. The process is as follows:

[0047] (1) Primers were synthesized based on the target sequence. The sequence information is as follows:

[0048] Primer 1: 5'

[0049] CAGATGATCCGTGGCACACGACCGCAAGCTCGATCCGTTTTAGAGCTAGAA3';

[0050] Primer2: 5'TTCTAGCTCTAAAACGGATCGAGCTTGCGGTCGTGTGCCACGGATCATCTG 3'.

[0051] (2) Dissolve the above primer sequences in 1×TE to prepare a 100μM stock solution. Use primer1 and primer2 as the front and back primers respectively, and add 1μL of each to 98μL of 0.5×TE solution to mix and dilute to 1μM.

[0052] (3) Hold at 95℃ for 3 minutes, then move to room temperature to cool and complete the annealing.

[0053] (4) The enzyme digestion and ligation system (Thermo Scientific) is as follows:

[0054]

[0055] The reaction program was as follows: incubation at 37℃ for 5 min, followed by incubation at 20℃ for 5 min. These two conditions were maintained for 10 cycles. The amplification reaction was performed using a BIO-RAD T100 thermal cycler. The product was transformed into *E. coli* DH5α competent cells (Beijing Tiangen CB101), and positive clones were selected for sequencing. Sequencing results showed that the obtained fragment was an OsbHLH178 knockout vector containing the target sequence, named pTKC-OsbHLH178.

[0056] Example 4: Genetic transformation of rice

[0057] All rice transformations were performed using Agrobacterium-mediated genetic transformation (Agb. EHA105). The specific steps of the Agrobacterium-mediated genetic transformation method are as follows:

[0058] (1) Obtaining recombinant Agrobacterium

[0059] pC1390U-OsbHLH178 and pTKC-OsbHLH178 were transformed into Agrobacterium tumefaciens strain EHA105 (purchased from Ingenium Biotech, USA) using the freeze-thaw method to obtain recombinant strains. Plasmids were extracted and identified by PCR. The correctly identified recombinant strains were named EH-pC1390U-OsbHLH178 and EH-pTKC-OsbHLH178, respectively.

[0060] (2) Transformation of Agrobacterium

[0061] Seed treatment: Select mature and plump rice seeds, remove the husks, disinfect with 75% alcohol for 1-2 minutes, and discard the alcohol; add 0.15% mercuric chloride (containing 0.1% Tween 20) for 10 minutes and then discard the mercuric chloride; rinse 6 times with sterile distilled water. Inoculate the seeds into callus induction medium and culture at 28℃ under light for 20 days.

[0062] Agrobacterium preparation: Agrobacterium EHA105 transformed with pC1390U-OsbHLH178 and pTKC-OsbHLH178 vectors were streaked onto LB plates containing 20 mg / L Rif and 50 mg / L Kan, respectively, and incubated at 28°C for 2 days; single colonies were picked and cultured in LB liquid medium at 28°C and 200 rpm for 2 days; before infection, the bacterial culture was scraped into suspension medium and shaken at 28°C and 180 rpm for 3-3.5 h to adjust OD600 to 0.1-0.15.

[0063] Callus infection: Rice callus with a diameter of 2-4 mm was immersed in bacterial solution for 20 min, the surface bacterial solution was blotted dry and covered with sterile filter paper, dried in a clean bench for 30 min, and then transferred to co-culture medium covered with sterile filter paper. It was incubated in the dark at 20℃ overnight, and then incubated in the dark at 25℃ for 2 days.

[0064] Cleaning and screening: The co-cultured callus tissue was repeatedly washed with sterile distilled water 7-8 times, and finally soaked in sterile water containing 500 mg / L carbenicillin for 30 minutes. The solution was discarded, and the surface moisture was blotted dry. The tissue was then dried in a laminar flow hood for 1 hour. Subsequently, the cleaned callus tissue was placed in a screening medium containing hygromycin and cultured at 32°C under light for 14 days.

[0065] (3) Differentiation and regeneration of callus: After screening and culturing for 14 days, the resistant callus was transferred to differentiation medium and cultured at 28°C (photocycle of 14 hours light / 10 hours dark). When the resistant callus formed 3-4 cm tall regenerated seedlings on the differentiation medium, it was transferred to rooting medium for further culture until a complete transgenic rice plant was formed.

[0066] Example 5: Identification of cold tolerance in wild-type, OsbHLH178 gene mutants, and overexpressing plants.

[0067] Wild-type, OsbHLH178 mutant, and overexpressing rice seeds were sterilized in a 2.5% sodium hypochlorite solution for 20 minutes (do not over-sterilize), followed by rinsing five times with sterile deionized water. After rinsing, the seeds were evenly spread on filter paper, an appropriate amount of sterile water was added, and the seeds were placed in an incubator at 28°C for germination. Three days later, the germinated seeds were transferred to 96-well hydroponic boxes, with 40 seeds of each variety (wild-type, OsbHLH178 mutant, and overexpressing plants) planted, and three biological replicates were set up. The growth conditions were: 13 hours of light, 11 hours of darkness, light intensity of 40,000 LUX, temperature of 28°C during light, temperature of 25°C during darkness, and relative humidity of 75%.

[0068] Two weeks after the seedlings reached maturity, they were transferred to an artificial climate chamber for cold tolerance testing. The cold treatment conditions were: 13 hours of light followed by 11 hours of darkness, light intensity of 40,000 LUX, temperature of 4°C during light exposure and 4°C during darkness, and relative humidity of 70%. After 3-5 days of cold treatment, the seedlings were removed and restored to normal growth conditions: 13 hours of light followed by 11 hours of darkness, light intensity of 40,000 LUX, temperature of 28°C during light exposure and 25°C during darkness, and relative humidity of 70%. Seven days after recovery, the survival rate was calculated by the ratio of surviving seedlings to the total number of seedlings, and the ion leakage rate was measured (approximately 0.3 g of seedling leaf sample treated at 4℃ was placed in a 15 mL centrifuge tube containing 5 mL of deionized water. The tube was then shaken at 200 rpm for 1 h at room temperature, and the conductivity of the solution was measured and recorded as S1. Next, the centrifuge tube was heated in boiling water for 20 min, and shaken again at room temperature for 1 h, and the total conductivity was measured and recorded as S2. S0 was the conductivity of the deionized water. The relative ion leakage rate was calculated using the following formula: Ion leakage rate (%) = (S1 - S0) / (S2 - S0).

[0069] The results are as follows Figure 4 As shown: Compared with the wild type, after treatment at 4℃ for 3 days, the osbhlh178 mutant plants were significantly stunted, and the leaves showed significant yellowing. Figure 4 (A left); after treatment at 4℃ for 5 days, the OsbHLH178 overexpressing plants showed better growth than the wild type, with tender green leaves and no obvious yellowing. Figure 4 A right). Figure 4 B showed that after 3 days of cold stress treatment, the survival rate of the osbhlh178 mutant was 54.9%, which was lower than the wild type's 78.5%. Figure 4 C showed that after 5 days of cold stress treatment, the survival rate of OsbHLH178 overexpressing plants was 78.5%, which was significantly higher than that of wild-type plants (22.3%). Figure 4 The results showed that the ion leakage rate of OsbHLH178-overexpressing plants was only 25.2%, significantly lower than the 42.6% of the wild type. These results indicate that the OsbHLH178 gene plays an important role in improving the cold tolerance of rice.

[0070] The cold-resistant gene and its application method provided by this invention can significantly improve the adaptability and resistance of rice in low-temperature environments, and are expected to enhance rice yield and stability in the context of global climate change. Through gene editing technology, precision breeding can be achieved, reducing reliance on traditional breeding methods and improving the sustainability of rice production.

[0071] The present invention has been described in detail above with general descriptions and specific embodiments. However, modifications or improvements can be made to the present invention, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention are within the scope of protection claimed by the present invention.

[0072] sequence

[0073] SEQ ID NO: 1

[0074] CDS

[0075] >LOC_Os07g48900.1

[0076] ATGGCGTCCTCGCCGACCTCCACGGCGCCACACGACCGCAAGCTCGATCCCGCCGCCTCGCCGGCAGCCAGGTGGCGGACGAGGCGGGAGCAGGAGAGCTACTCCTCCAAGCTGCTCGACGCGCTGCGCCTGGTCCGCGCCGCCAGCGGCAGACCATCACCCGCGTCGTCGCGCGAGGTGCGCCACGCGGCCGACCGCGCCCTCGCCGTGGCGGCGCGAGGGCGGTCGCGGTGGAGCCGCGCCATCCTCGCCTCCCGCGCGCGCGCGTGCGCGCTCCGCCGCGTGCGCCTCGGCGCGCCGCCCCCGCCGCCCGCCGCGCGTCCGGCGCCGCGCTCGCGGCCGCCGCTGGCGAGCAAGGCGAAGGTGCTGGGGCGGCTAGTGCCCGGGTGCCGGAAGCTGGCGTTCCCGGCGCTCCTGGCGGAGGCGTCGGACTACATTGCTGCGCTGGAGATGCAGGTGCGCGCCATGGCGGCGCTCGCGCAGGCACTCCAGTCCGTGGCACCCGCGCCGCCGCCGCCGC

[0077] CGTCGTCGTCGTGA

[0078] Protein

[0079] >LOC_Os07g48900.1

[0080] Met Ala Ser Ser Pro Thr Ser Thr Ala Pro His Asp Arg Lys Leu Asp ProAla Ala Ser Pro AlaArg Trp Arg Thr Arg Glu Gln Glu Ser Tyr SerLys Leu Leu Asp Ala Leu Arg Leu Val ArgAla Ala Ser Gly Arg Pro Arg Pro AlaSer Arg Arg Arg Ala Glu Ala Arg GlyArg Ser Arg Trp Ser Arg Ala Ile Leu Ala Ser Arg Ala Arg Ala Cys Ala Leu ArgArgVal Arg Leu Gly Ala Pro Pro Pro Ala Ala Arg Pro Ala Pro Arg SerArg Pro Leu Ala SerLys Ala Lys Val Leu Gly Arg Leu Val Pro Gly Ala Serle Arg Le Leu Tyla Leu Ala P Leu GluMet Gln Val Arg Ala Met Ala Ala Leu Alapro Gln Ala Leu Gln SerVal Ala Pro AlaPro Pro Pro Pro Ser Ser Ser*。

Claims

1. Application of a protein with an amino acid sequence as shown in SEQ ID NO: 2 in improving the cold resistance of rice.

2. The application of the protein-related biomaterial of claim 1 in improving the cold resistance of rice, wherein the biomaterial is any one of the following: B1) A nucleic acid molecule encoding the protein described in claim 1; B2) A recombinant vector containing the nucleic acid molecules described in B1); B3) Recombinant microorganisms containing the nucleic acid molecules described in B1) or recombinant microorganisms containing the recombinant vector shown in B2).

3. The biomaterial according to claim 2, characterized in that, B1) The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO:

1.

4. The application of the protein of claim 1 or the biomaterial of claim 2 or 3 in the cultivation of cold-resistant rice.

5. A method for improving the cold resistance of rice, characterized in that, By increasing the expression level of the gene encoding the protein of claim 1 in the target rice.

6. A method for cultivating cold-resistant rice, characterized in that, By increasing the expression level of the gene encoding the protein of claim 1 in the target rice.