Muscari mushroom strains ZJXX001, ZJXX002, ZJXX003 and ZJXX004 and SSR molecular marker identification method of muscari mushroom strains ZJXX001, ZJXX002, ZJXX003 and ZJXX004

Abstract

The invention discloses muscarinic strains ZJXX001, ZJXX002, ZJXX003 and ZJXX004 and an SSR (Simple Sequence Repeat) molecular marker identification method of the muscarinic strains ZJXX001, ZJXX002, ZJXX003 and ZJXX004, and relates to the technical field of muscarinic planting. The preservation number of the muscarinic strains ZJXX001 is CGMCC (China General Microbiological Culture Collection Center) No.41450; the preservation number of the muscarinic acid ZJXX002 is CCTCC (China Center For Type Culture Collection) NO: M 20242444; the preservation number of the fragrant mushroom ZJXX003 is CCTCC (China Center For Type Culture Collection) NO: M 20242445; the preservation number of the muscarinic acid ZJXX004 is CCTCC (China Center For Type Culture Collection) NO: M 20242446; the four strains have the advantages of high temperature resistance, high hypha growth rate, high yield, rich nutrient substances and high nutrient substance content.

Description

Technical Field

[0001] The present application relates to the technical field of champignon mushroom cultivation, and in particular to champignon mushroom strains ZJXX001, ZJXX002, ZJXX003, ZJXX004 and SSR molecular marker identification methods thereof. Background Art

[0002] Small mushrooms ( Lentinula edodes ) belongs to the order Agaricales ( Agaricales ), Omphalaceae ( Omphalotaceae ), Lentinula ( Lentinula ), also known as shiitake mushroom, fragrant mushroom, fragrant fungus. China is the region with the richest shiitake germplasm resources and the highest genetic diversity in the world, and shiitake mushrooms are distributed in most provinces of my country. Shiitake mushrooms are high in protein and low in fat, and taste delicious; they are also rich in active molecules such as polysaccharides and ergosterol, and have pharmacological effects such as anti-tumor, anti-virus, antioxidant, and immunomodulatory.

[0003] Shiitake mushrooms are "Chinese mushrooms" and are widely planted in my country. According to statistics, the national output of shiitake mushrooms reached 12.9548 million tons in 2022, ranking first, accounting for about 30.68% of the total output of edible fungi in the country, and is the world's largest edible fungus. According to the existing survey of shiitake mushroom varieties on the market in my country, the shiitake mushrooms currently circulating on the market are mainly large shiitake mushrooms, which are all descendants of the earliest shiitake mushroom varieties introduced from Japan, and the shiitake mushroom varieties are single.

[0004] In order to solve the problem of single variety, in recent years, domestic research institutes have selected and bred a variety of large shiitake mushroom varieties, such as the Shenxiang and Huxiang series developed by the Institute of Edible Fungi of Shanghai Academy of Agricultural Sciences, and the Zhejiangxiang series developed by the Horticulture Institute of Zhejiang Academy of Agricultural Sciences. However, there are few research reports on the small mushroom variety.

[0005] Large shiitake mushrooms have a high degree of tissue fibrosis, which results in a poor taste when eaten, while small shiitake mushrooms have a low degree of tissue fibrosis, and are fresh, tender and delicious, with a good taste, and are favored by consumers. The price of small shiitake mushrooms sold on the market is 2 to 4 times higher than that of ordinary large shiitake mushrooms, and large-scale planting has good economic value.

[0006] Existing wild shiitake mushrooms generally come from the wild or are cultivated on logs, and the yield is extremely small.

[0007] In recent years, although many edible fungi research workers have carried out domestication and cultivation work on shiitake mushrooms, the results have not been obvious and many problems have been encountered. For example, the existing shiitake mushroom varieties are not resistant to high temperatures, have long fungal age, poor flower shape, poor resistance, and low yield during artificial cultivation, which seriously hinder the industrialization and large-scale cultivation of shiitake mushrooms.

[0008] The information disclosed in the background technology section is only intended to enhance the understanding of the overall background of the invention and should not be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art. Summary of the invention

[0009] In view of the above technical problems, the present application provides a shiitake mushroom strain ZJXX001, ZJXX002, ZJXX003, ZJXX004 and an SSR molecular marker identification method thereof, which can be used together with the molecular marker to conveniently and quickly distinguish the four shiitake mushroom strains.

[0010] The present application provides a small mushroom strain ZJXX001, ZJXX002, ZJXX003, ZJXX004 SSR, the small mushroom ZJXX001 has a preservation number of CGMCC No.41450; the small mushroom ZJXX002 has a preservation number of CCTCC NO: M 20242444; the small mushroom ZJXX003 has a preservation number of CCTCC NO: M 20242445; the small mushroom ZJXX004 has a preservation number of CCTCC NO: M20242446; the taxonomic name of the small mushroom strains ZJXX001, ZJXX002, ZJXX003, and ZJXX004 is Lentinus edodes Lentinula edodes; The SSR molecular markers used to identify the Lentinula edodes strains ZJXX001, ZJXX002, ZJXX003, and ZJXX004 are shown in SEQ NOs. 7 to 24.

[0011] Preferably, the cultivation method comprises: The propagation mother strains of the shiitake mushroom strains ZJXX001, ZJXX002, ZJXX003 and ZJXX004 are inoculated into a liquid culture medium to obtain liquid strains, which are then inoculated into sterilized cultivation materials for dark culture, color change management and mushroom fruiting management until the shiitake mushroom fruiting bodies are picked before their caps are flattened.

[0012] Preferably, the cultivation material is prepared by weighing raw materials according to the cultivation material ratio of 70-80 parts of sawdust, 15-20 parts of bran and 1-3 parts of lime, adding water and mixing well, and the moisture content of the obtained cultivation material is 50-65%.

[0013] Preferably, the culture conditions are 23-28° C., 50-60% air humidity, dark culture for 30-35 days; and the inoculation volume is 10-20 ml / bag.

[0014] Preferably, the color change management is to move the cultivation material covered with mycelium to a greenhouse and perform color change management at 20-25°C under diffuse light; The mushroom production management is as follows: 16~30℃, air humidity 80%~95%, light 200~500lx, CO2 concentration 450~1500ppm.

[0015] Another aspect of the present application further provides a method for SSR molecular marker identification of the above-mentioned Lentinula edodes strains ZJXX001, ZJXX002, ZJXX003, and ZJXX004, comprising the following steps: Step S1: transferring the mycelium or fruiting body of the tested Champignon mushroom strain to a potato dextrose agar solid medium, and collecting the mycelium after culturing at 25° C. for 15 days; Step S2: extracting the genomic DNA of the obtained mycelium, and using a biological spectrophotometer to detect whether the purity and concentration of the obtained total genomic DNA meet the detection requirements, if so, proceed to step S3, if not, increase the mass of the mycelium sample and repeat steps S1-2; Step S3: performing PCR amplification of SSR markers on the total genomic DNA obtained in step 2 using SSR molecular markers to obtain amplified products; Step S4: using capillary electrophoresis to detect the amplified product obtained in step S3, the number of allelic fragments obtained and the molecular weight of each fragment, determining the SSR allelic fragment number combination of the sample to be tested according to the number of allelic fragments and the molecular weight of each fragment, and judging whether the strain to be tested is at least one of the edodes shiitake mushroom strains ZJXX001, ZJXX002, ZJXX003, and ZJXX004 according to the obtained SSR allelic fragment number combination; The SSR molecular marker pairs include: a first SSR molecular marker pair, as shown in SEQ NO.7~8; a second SSR molecular marker pair, as shown in SEQ NO.9~10; a third SSR molecular marker pair, as shown in SEQ NO.11~12; a fourth SSR molecular marker pair, as shown in SEQ NO.13~14; a fifth SSR molecular marker pair, as shown in SEQ NO.15~16; a sixth SSR molecular marker pair, as shown in SEQ NO.17~18; a seventh SSR molecular marker pair, as shown in SEQ NO.19~20; an eighth SSR molecular marker pair, as shown in SEQ NO.21~22; and a ninth SSR molecular marker pair, as shown in SEQ NO.23~248.

[0016] Preferably, the strain that meets the SSR allele number combination of (1+4) / (1+5) / (1+4) / (4+5) / (1+2) / (2+3) / 1 / 3 / (5+6) is the Champignon mushroom ZJXX001 strain; "1+4" in (1+4) / (1+5) / (1+4) / (4+5) / (1+2) / (2+3) / 1 / 3 / (5+6) refers to allelic fragment numbers 1 and 4 of SEQ ID NOs: 7-8, the molecular weight of allelic fragment number 1 is 205-205.99 bp, and the molecular weight of allelic fragment number 4 is 220-220.99 bp; "1+5" refers to allelic fragment numbers 1 and 5 of SEQ ID NOs: 9 and 10, wherein the molecular weight of allelic fragment number 1 is 206 to 206.99 bp, and the molecular weight of allelic fragment number 5 is 233 to 233.99 bp; "1+4" refers to allelic fragment numbers 1 and 4 of SEQ ID NOs: 11 and 12, wherein the molecular weight of allelic fragment number 1 is 236 to 236.99 bp, and the molecular weight of allelic fragment number 4 is 248 to 248.99 bp; "4+5" refers to allelic fragment numbers 4 and 5 of SEQ ID NOs: 13 and 14, wherein the molecular weight of allelic fragment number 4 is 214 to 214.99 bp, and the molecular weight of allelic fragment number 5 is 217 to 217.99 bp; "1+2" ​​refers to allelic fragment numbers 1 and 2 of SEQ ID NOs: 15 and 16, wherein the molecular weight of allelic fragment number 1 is 268 to 268.99 bp, and the molecular weight of allelic fragment number 2 is 274 to 274.99 bp; "2+3" refers to allelic fragment numbers 2 and 3 of SEQ ID NOs: 17 and 18, wherein the molecular weight of allelic fragment number 2 is 282 to 282.99 bp, and the molecular weight of allelic fragment number 3 is 290 to 290.99 bp; "1" is the allele number 1 of SEQ ID NO: 19, 20, and the molecular weight of the allele number 1 is 308 to 308.99 bp; "3" is the allele number 3 of SEQ ID NO: 21, 22, and the molecular weight of allele number 3 is 273 to 273.99 bp; "5+6" refers to allelic fragment numbers 5 and 6 of SEQ ID NOs: 23 and 24, wherein the molecular weight of allelic fragment number 5 is 297 to 297.99 bp, and the molecular weight of allelic fragment number 6 is 300 to 300.99 bp.

[0017] Preferably, the strain that meets the SSR allele number combination of 2 / 3 / (2+3) / (1+3) / (2+3) / 4 / (2+4) / 1 / (1+3) is the Champignon mushroom ZJXX002 strain; "2" in 2 / 3 / (2+3) / (1+3) / (2+3) / 4 / (2+4) / 1 / (1+3) is the allelic fragment number 2 of SEQ ID NO: 7, 8, and the molecular weight of the allelic fragment number 2 is 211 to 211.99 bp; "3" is the allele number 3 of SEQ ID NO: 9, 10, and the molecular weight of the allele number 3 is 212 to 212.99 bp; "2+3" refers to allelic fragment numbers 2 and 3 of SEQ ID NOs: 11 and 12, wherein the molecular weight of allelic fragment number 2 is 239 to 239.99 bp, and the molecular weight of allelic fragment number 3 is 242 to 242.99 bp; "1+3" refers to allelic fragment numbers 1 and 3 of SEQ ID NOs: 13 and 14, wherein the molecular weight of allelic fragment number 1 is 199 to 199.99 bp, and the molecular weight of allelic fragment number 3 is 211 to 211.99 bp; "2+3" refers to allelic fragment numbers 2 and 3 of SEQ ID NOs: 15 and 16, wherein the molecular weight of allelic fragment number 2 is 274 to 274.99 bp, and the molecular weight of allelic fragment number 3 is 280 to 280.99 bp; "4" is the allele number 4 of SEQ ID NO: 17, 18, and the molecular weight of the allele number 4 is 326 to 326.99 bp; "2+4" refers to allelic fragment numbers 2 and 4 of SEQ ID NOs: 19 and 20, wherein the molecular weight of allelic fragment number 2 is 320 to 320.99 bp, and the molecular weight of allelic fragment number 4 is 336 to 336.99 bp; "1" is the allele number 1 of SEQ ID NO: 21, 22, and the molecular weight of the allele number 1 is 267 to 267.99 bp; "1+3" refers to allelic fragment numbers 1 and 3 of SEQ ID NOs: 23 and 24, wherein the molecular weight of allelic fragment number 1 is 261 to 261.99 bp, and the molecular weight of allelic fragment number 3 is 282 to 282.99 bp.

[0018] Preferably, the strain that meets the SSR allele number combination of (1+4) / (4+6) / 2 / 5 / 2 / (1+4) / 3 / (2+4) / (2+7) is the Champignon mushroom ZJXX003 strain; "1+4" in (1+4) / (4+6) / 2 / 5 / 2 / (1+4) / 3 / (2+4) / (2+7) refers to allelic fragment numbers 1 and 4 of SEQ ID NOs: 7 to 8, the molecular weight of allelic fragment number 1 is 205 to 205.99 bp, and the molecular weight of allelic fragment number 4 is 220 to 220.99 bp; "4+6" refers to allelic fragment numbers 4 and 6 of SEQ ID NOs: 9 and 10, wherein the molecular weight of allelic fragment number 4 is 215 to 215.99 bp, and the molecular weight of allelic fragment number 6 is 236 to 236.99 bp; "2" is the allele number 2 of SEQ ID NO: 11, 12, and the molecular weight of the allele number 2 is 239 to 239.99 bp; "5" is the allele number 5 of SEQ ID NO: 13, 14, and the molecular weight of the allele number 5 is 217 to 217.99 bp; "2" is the allele number 2 of SEQ ID NO: 15, 16, and the molecular weight of the allele number 2 is 274 to 274.99 bp; "1+4" refers to allelic fragment numbers 1 and 4 of SEQ ID NOs: 17 and 18, wherein the molecular weight of allelic fragment number 1 is 270 to 270.99 bp, and the molecular weight of allelic fragment number 4 is 326 to 326.99 bp; "3" is the allele number 3 of SEQ ID NO: 19, 20, and the molecular weight of the allele number 3 is 328 to 328.99 bp; "2+4" refers to allelic fragment numbers 2 and 4 of SEQ ID NOs: 21 and 22, wherein the molecular weight of allelic fragment number 2 is 270 to 270.99 bp, and the molecular weight of allelic fragment number 4 is 276 to 276.99 bp; "2+7" refers to allelic fragment numbers 2 and 7 of SEQ ID NOs: 23 and 24, wherein the molecular weight of allelic fragment number 2 is 270 to 270.99 bp, and the molecular weight of allelic fragment number 7 is 315 to 315.99 bp.

[0019] Preferably, the strain that meets the SSR allele number combination of (3+5) / (1+4) / (2+3) / (4+6) / 2 / (3+4) / 5 / 1 / (1+4) is the Champignon mushroom ZJXX004 strain; "3+5" in (3+5) / (1+4) / (2+3) / (4+6) / 2 / (3+4) / 5 / 1 / (1+4) refers to allelic fragment numbers 3 and 5 of SEQ ID NOs: 7-8, the molecular weight of allelic fragment number 3 is 217-217.99 bp, and the molecular weight of allelic fragment number 5 is 241-241.99 bp; "1+4" refers to allelic fragment numbers 1 and 4 of SEQ ID NOs: 9 and 10, wherein the molecular weight of allelic fragment number 1 is 206 to 206.99 bp, and the molecular weight of allelic fragment number 4 is 215 to 215.99 bp; "2+3" is allele number 2 of SEQ ID NO: 11, 12, the molecular weight of allele number 2 is 239 to 239.99 bp, and the molecular weight of allele number 2 is 242 to 242.99 bp; "4+6" refers to allelic fragment numbers 4 and 6 of SEQ ID NOs: 13 and 14, wherein the molecular weight of allelic fragment number 4 is 214 to 214.99 bp, and the molecular weight of allelic fragment number 6 is 220 to 220.99 bp; "2" is the allele number 2 of SEQ ID NO: 15, 16, and the molecular weight of the allele number 2 is 274 to 274.99 bp; "3+4" refers to allelic fragment numbers 3 and 4 of SEQ ID NOs: 17 and 18, wherein the molecular weight of allelic fragment number 3 is 290 to 290.99 bp, and the molecular weight of allelic fragment number 4 is 326 to 326.99 bp; "5" is the allele number 5 of SEQ ID NO: 19, 20, and the molecular weight of the allele number 5 is 344 to 344.99 bp; "1" is the allele number 1 of SEQ ID NO: 21, 22, and the molecular weight of the allele number 1 is 267 to 267.99 bp; "1+4" refers to allelic fragment numbers 1 and 4 of SEQ ID NOs: 23 and 24, wherein the molecular weight of allelic fragment number 1 is 261 to 261.99 bp, and the molecular weight of allelic fragment number 4 is 285 to 285.99 bp.

[0020] The beneficial effects of this application include: 1) The mushrooms ZJXX001, ZJXX002, ZJXX003 and ZJXX004 provided by the present invention are resistant to high temperature, have fast mycelial growth rate, high yield, and are rich in nutrients and have high content. At 25°C, the mycelial growth rates of the four mushrooms are 0.33cm / d, 0.33cm / d, 0.34cm / d, and 0.24cm / d, respectively; at 30°C, the mycelial growth rates are 0.34cm / d, 0.33cm / d, 0.33cm / d, and 0.29cm / d, respectively. After being cultured at 35°C for 9 days and then restored to 25°C, the mushrooms ZJXX001, ZJXX003 and ZJXX004 can still germinate.

[0021] 2) The identification method provided by the present invention can realize the identification and detection of the above-mentioned 4 strains of Champignon mushrooms, with low detection cost, high efficiency, convenient operation and accurate results. It can be used for the rapid identification of Champignon mushrooms ZJXX001, ZJXX002, ZJXX003 and ZJXX004 strains, and has good application prospects.

[0022] 3) The accurate identification method of the shiitake mushroom ZJXX001, ZJXX002, ZJXX003 and ZJXX004 strains provided by the present invention can prevent the selected shiitake mushroom and shiitake mushroom fine strains from being mixed with other similar varieties during production, operation and market circulation, thereby effectively protecting their intellectual property rights, which is of great significance for the authenticity identification of varieties in the production process of shiitake mushrooms.

[0023] Deposit information: The corresponding biological material of the mushroom ZJXX001 is ZJXX001 (Longxiang No. 1-ZJXX001), the deposit number is CGMCC No.41450, and the taxonomic name is: Lentinus edodes Lentinula edodes ; Deposit date: September 9, 2024; Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101, deposited in the General Microbiology Center of China Microbiological Culture Collection Administration; Lentinus edodes ZJXX002, ZJXX003 and ZJXX004 were deposited in China Center for Type Culture Collection (CCTCC) on November 6, 2024, address: Wuhan University, Wuhan, China; postal code: 430072; the taxonomic name of each strain is: Lentinus edodes Lentinula edodes; The preservation number of Champignon edodes ZJXX002 is CCTCC NO: M 20242444; the preservation number of Champignon edodes ZJXX003 is CCTCC NO: M 20242445; and the preservation number of Champignon edodes ZJXX004 is CCTCC NO: M 20242446. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 For this application, we collected photos of the living environment of the wild mushroom ZJXX001; Figure 2 Phylogenetic tree of the Champignon mushroom ZJXX001, ZJXX002, ZJXX003 and ZJXX004 strains provided in this application; Figure 3 The relative molecular weight peaks of alleles detected by primer LESSR010 in the selected mushrooms ZJXX001, ZJXX002, ZJXX003 and ZJXX004 respectively; Figure 4 The relative molecular weight peaks of alleles detected by primer LESSR020 in the selected mushrooms ZJXX001, ZJXX002, ZJXX003 and ZJXX004 respectively; Figure 5 The relative molecular weight peaks of alleles detected by primer LESSR029 in the selected mushrooms ZJXX001, ZJXX002, ZJXX003 and ZJXX004 respectively; Figure 6 The relative molecular weight peaks of allele sites detected by primer LESSR062 in the selected mushrooms ZJXX001, ZJXX002, ZJXX003 and ZJXX004 in sequence; Figure 7 The relative molecular weight peaks of allele sites detected by primer LESSR099 in the selected mushrooms ZJXX001, ZJXX002, ZJXX003 and ZJXX004 in sequence; Figure 8 The relative molecular weight peaks of alleles detected by primer LESSR123 in the selected mushrooms ZJXX001, ZJXX002, ZJXX003 and ZJXX004 in sequence; Fig. 9 The relative molecular weight peaks of alleles detected by primer LESSR127 in the selected mushrooms ZJXX001, ZJXX002, ZJXX003 and ZJXX004 respectively; Fig.10 The relative molecular weight peaks of alleles detected by primer LESSR137 in the selected mushrooms ZJXX001, ZJXX002, ZJXX003 and ZJXX004 in sequence; Fig.11 The relative molecular weight peaks of alleles detected by primer LESSR188 in the selected mushrooms ZJXX001, ZJXX002, ZJXX003 and ZJXX004 respectively; Fig.12 UPGMA cluster tree of genetic distances of four small mushrooms and four large mushrooms strains constructed based on SSR molecular markers Fig.13 The liquid strain of the Champignon mushroom strain ZJXX001 obtained in at least one embodiment provided by the present invention; Fig.14 This is a picture of the artificially cultivated fruiting bodies of the Champignon mushroom strains ZJXX001, ZJXX002 and ZJXX003 obtained in at least one embodiment provided in the present application. DETAILED DESCRIPTION

[0025] The present invention is further described in detail below in conjunction with the accompanying drawings and embodiments, but the present invention is not limited in any way. Any changes or improvements made based on the teachings of the present invention fall within the protection scope of the present invention.

[0026] Example Unless otherwise specified, the materials and instruments used in the following examples were obtained from commercial channels; the detection methods used were all existing methods unless otherwise specified.

[0027] Example 1 Obtaining the ZJXX001, ZJXX002, ZJXX003 and ZJXX004 strains of Champignon edodes Liu Qimeng, a member of the research team, collected fruiting body specimens of the ZJXX001, ZJXX002, ZJXX003 and ZJXX004 strains of the mushroom at the time and place shown in the table below, and then separated the tissues, picked small pieces of tissue and inoculated them into the enriched PDA medium, and cultured them in the dark at 25°C for 8 days to obtain the mother strains for propagation. Figure 1 shown.

[0028] Table 1 Biological material collection table The formula of the enriched PDA culture medium used is: 200 g / L potato, 20 g / L glucose, 15-18 g / L agar, 6 g / L peptone, 3 g / L yeast powder, 1 g / L potassium dihydrogen phosphate, and 0.5 g / L magnesium sulfate, prepared with 1 L of distilled water (the same below).

[0029] Example 2 Molecular Identification of Champignon mushroom strains ZJXX001, ZJXX002, ZJXX003 and ZJXX004 (1) DNA extraction The mushroom strains ZJXX001, ZJXX002, ZJXX003 and ZJXX004 were respectively transferred to the enriched PDA medium and cultured at 25°C for 15 days before collecting the mycelia. The genomic DNA of the mycelia was extracted using the Qingke TSP101-200 kit according to its instructions. The purity and concentration of the obtained DNA were detected by agarose gel electrophoresis and biospectrophotometer. After the purity and concentration of the obtained DNA met the requirements for subsequent amplification, the obtained DNA was subjected to subsequent operations. If the purity and concentration of the obtained DNA did not meet the requirements, step (1) was repeated.

[0030] (2) ITS amplification and detection The ITS universal primers are ITS4 (5'-TCCTCCGCTTATTGATATGC-3' sequence as shown in SEQ NO.1) and ITS5 (5'-GGAAGTAAAAGTCGTAACAAGG-3' sequence as shown in SEQ NO.2). The 25μL amplification system includes: 20ul of Gold Mix (green, Qingke TSE101), 0.5μmol / L upstream and downstream primers, and 50ng of genomic template DNA.

[0031] The PCR amplification program is: 94℃2min; 94℃15s, 60℃30s, 72℃60s, 30 cycles; 72℃10min. After PCR is completed, add 5μL of 6× loading buffer and mix well, and detect by 1.0% agarose gel electrophoresis. After passing the test, sequencing is performed.

[0032] (3) Sequence Blast alignment and phylogenetic analysis The obtained ITS sequences were compared with the NCBI database using BLAST software. The identities of the corresponding sequences of the ZJXX001, ZJXX002, ZJXX003 and ZJXX004 strains of Lentinus edodes and the existing strains of Lentinus edodes in the GenBank database were all over 99.2%. The ITS sequences of the ZJXX001, ZJXX002, ZJXX003 and ZJXX004 strains of Lentinus edodes are shown in SEQ NO.3, SEQ NO.4, SEQ NO.5 and SEQ NO.6: SEQ NO.3: ggaagtaaaa gtcgtaacaa ggtttccgta ggtgaacctg cggaaggatc attattgaat 60 tttttggtgg tggattgttg ctggcctttg ggtatgtgca catcctcctc cgatttctat 120 tcatccacct gtgcactttt tgtaggagtt ctttcatcgg gtttttgaag gtgctcatta 180 tgagttatactt gaaaagacta gttgacaagg cttctatgtt cttataaacc attgaagtat 240 gttatagaat gatcttgtta ttgggacttt attgaccctt taaacttaat acaactttca 300 gcaacggatc tcttggctct cccatcgatg aagaacgcag cgaaatgcga taagtaatgt 360 gaattgcaga attcagtgaa tcatcgaatc tttgaacgca ccttgcgccc tctggtattc 420 cggagggcat gcctgtttga gtgtcattaa attctcaact ttataagtttt ttacttatca 480 aagcttggat gttgaggt tgtgagttc tcttaattg agetaggtg 540 accctgtttt gttagttcta accttggtgt gataattatc tacattttgg tggaacctta 600 caatataaa gctctattgg ttgggttgt tgcatttagt tgctcaatc tgttctattc 660 attggagcac aagggaagtc ccgctttcta actgtcttga ttgactatat ataacttatt 720 tgcttgacct caatcaggt aggattaccc gctgaactta agcatca taagcggagg 780 at 782 QUESTION NO.4: gatatgctta agttcagcgg gtaatcctac ctgatttgag gtcaagcaaa tagttatat 60 atagtcaata aagacagtta gaaagcagac ttccctttt tctccaatga gtagaacaga 120 ttgagcatat taaaatgcaastorm catagagct tattattgt agattaca 180 accaaaatgt agatagttat cacaccaagg ttgaaacca acaaaacagg gttccactaa 240 taaatttaag aggagctgac aaacgcctgc aaacctccaa tatccaagct ttacaagta 300 aaaacttata aagttgagaa tttaatgaca ctcaaacagg catgccctcc ggaataccag agggcgcaag gtgcgttcaa agttcgatg attcactgaa ttctgcaatt cacattactt atcgcatttc gctgcgttct tcatcgatgg gagagccaag agatccgttg ctgaaagttg 480 tattagttt aaagggtcaa taagtccca father cattcta catacttca tagtttataa gacatagaa gtatcttcaa ctagtccctc ccaagttaac tcgtaatgag cacctgttca aaacctgatg aaaaaactcc tacaaaaagt gcacaggtgg atgaatagaa tcagaggagg atgtgcacat acccaaaggc cagcacaat ccaccacca aaaattcaat aatgatcctt ccgcaggttc acctacgga accttgttac 760 SEQ NO.5: ggagtaaaa gtcgtaacaa ggtttccgta ggtgaacctg cggaaggatc attattgaat tttttggtgg tggattgttg ctggcctttg ggtatgtgca catcctcctccgatttctat 120 tcatccacct gtgcactttt tgtaggagtt ctttcatcgg gtttttgaag gtgctcatta 180 240. tgagttactt gaaaagacta gttgacaagg cttctatgtt cttataaacc attgaagtat gttatagaat gatcttgtta ttgggactt gttgacctt taaacttaat acaactttca 300 gcaacggatc tcttggctct cccatcgatg aagaacgcag cgaatgcga taagtaatgt 360 gattgcaga attcagtgaa tcatcgaatc tttgaacgca ccttgcgccc tctggtattc 420 cggagggcat gcctgtttga gtgtcattaa attctcaact ttataagtttt ttacttatca 480 aagcttggat gttgaggt tgtgagttc tcttaattg agetaggtg 540 accctgtttt gttagttcta accttggtgt gataattatc tacattttgg tggaacctta 600 caatataaa gctctattgg ttgggttgt tgcatttagt tgctcaatc tgttctattc 660 attggagcac aagggaagtc ccgctttcta actgtcttga ttgactatat ataacttatt 720 tgcttgacct caatcaggt aggattaccc gctgaactta agcatca taagcggagg 780 at 782 QUESTION NO.6: cctgatttga ggtcagcaaa taagttatat atagtcaatc aagacagtta gaaagcggga 60 cttcccttgt gctccaatga atagaacaga tgagcaac taatgcaac aacccaacc 120 aatagagctttattattgta aggttccacc aaaatgtaga taattatcac accaaggtta 180 gaactaacaa aacagggttc ccactaatca atttaagagg agctgacaaa cgcctgcaag 240 cctccaacat ccaagctttg ataagtaaaa acttataaag ttgagaattt aatgacactc 300 aaacaggcat gccctccgga ataccagagg gcgcaaggtg cgttcaaaga ttcgatgatt 360 cactgaattc tgcaattcac attacttatc gcatttcgct gcgttcttca tcgatggggag 420 agccaagaga tccgttgctg aaagttgtat taagtttaaa gggtcaataa agtcccaata 480 acaagatcat tctataacat acttcaatgg tttataagaa catagaagcc ttgtcaacta 540 gtcttttcaa gtaactcata atgagcacct tcaaaaaccc gatgaaagaa ctcctacaaa 600 aagtgcacag gtggatgaat agaaatcgga ggaggatgtg cacataccca aaggccagca 660 acaatccacc accaaaaaat caataa 686 At the same time, the ITS sequences of Lentinus edodes species were downloaded from the database, and the ML phylogenetic tree was constructed using IQTREE software, using default parameters and 1000 Bootstrap tests. The resulting phylogenetic tree is shown in Figure 2 As shown by Figure 2 It can be seen that the ITS sequences of the mushroom strains ZJXX001, ZJXX002, ZJXX003 and ZJXX004 are clustered together with those of Lentinus edodes, indicating that the mushroom strains ZJXX001, ZJXX002, ZJXX003 and ZJXX004 belong to Lentinus edodes. Lentinula edodes.

[0033] Based on the above results, it can be concluded that the mushroom strains ZJXX001, ZJXX002, ZJXX003 and ZJXX004 belong to the family Omphalaceae ( Omphalotaceae )、Lantinus ( Lentinula ) Lentinula edodes ).

[0034] Example 3 Acquisition of SSR molecular markers for identifying Champignon mushroom strains ZJXX001, ZJXX002, ZJXX003 and ZJXX004 1. The biological materials to be tested are: 1) Lentinus edodes strains ZJXX001, ZJXX002, ZJXX003 and ZJXX004 and 4 Lentinus edodes strains.

[0035] 2) Lentinus edodes strains: The names of the Lentinus edodes varieties are LE0912 (Large Lentinus edodes 01), F6 (Large Lentinus edodes 02), QK212 (Large Lentinus edodes 03), and YXXG01 (Large Lentinus edodes 04). The taxonomic names are Lentinula edodes The collected information is as follows. The collector is Liu Qimeng.

[0036] Table 2 Collection information of biological materials of Lentinus edodes 2. Operation process: The eight biological samples shown in Table 2 were submitted to Wuhan Tianyi Huayu Gene Technology Co., Ltd. (address: 3F-4F, Building C12, Phase 3, Biomedical Enterprise Accelerator, No. 388, Gaoxin 2nd Road, Jiangxia District, Wuhan) for SSR genetic diversity analysis. The samples were analyzed using a 96-channel fully automatic ABI 3730xL genetic analyzer, and the SSR molecular marker group shown in Table 3 was screened.

[0037] A total of 1310 SSRs were found in 128 sequences; 92 sequences of all SSR-containing sequences popA contained more than one SSR; and 55 SSRs existed in a composite form. Through the SSR site resequence type, number of repetitions, and polymorphism in the population, 192 SSR sites shared by the four strains and with polymorphism were screened as candidate SSR sites for the development of polymorphic markers. Finally, 9 SSR polymorphic markers were screened, and the specific information of the 9 SSR sites is shown in the following table: Table 3 SSR marker primer information The screening experiment process is the same as the existing operation, including the following steps: 1. Sample sorting and verification; 2. Nucleic acid extraction and testing; 3. Synthesis of typing primers; 4. Fluorescence PCR amplification; 5. Primer polymorphism screening; 6. Group typing pre-experiment; 7. Group typing test; 8. Result analysis; The specific steps include: (1) Design and synthesis of SSR marker primers Primers were designed for SSR loci typing using the Primer 3 program based on simplified genome data (NCBI genome database: GCF_021015755.1). Primer design parameters: (1) primer sequence length 18-22 bp; (2) amplification product length 110-350 bp; (3) annealing temperature (Tm value) 50℃-60℃; (4) amplification product GC content 40%-60%.

[0038] SSR site screening criteria: (1) Remove sites where primers cannot be designed based on the above parameters (indicating that there are complex structural sequences upstream and downstream of the site); (2) Remove sites with single-base repeat units and compound repeat units (such sites are difficult to accurately interpret in subsequent typing tests); (3) Remove sites where the repeat units are composed entirely of G / C bases (high GC will affect the success rate of site detection); (4) Remove SSR markers with the same upstream or downstream primer sequences (to reduce primer mismatch); (5) The priority of repeat unit screening is 3n, 4n, 5n, 6n, and 2n; (6) The number of repeats is selected from most to least (theoretically, the more repeats, the higher the probability of polymorphism); (7) Prioritize site selection from different gene sequences (avoid selecting sites that are too close physically); (8) Try to include sites with different repeat units.

[0039] 192 pairs of primers were randomly selected from the SSR markers that met the above conditions for primer screening experiments. The primers were synthesized using the adapter method, that is, a 21bp adapter sequence was added to the upstream primer during synthesis. When the adapter method was used for PCR amplification, in the first step, the upstream primer with the adapter and the downstream primer were combined with the template to obtain a PCR product with an adapter sequence. In the second step, the adapter primer with a fluorescent group and the downstream primer were combined with the PCR product of the first step to obtain a PCR product with a fluorescent group and a 21bp adapter sequence.

[0040] (2) SSR marker primer screening 192 pairs of primers were amplified from the genomic DNA of 8 samples. The 10μL amplification system included: 2×Taq PCR Master Mix 5uL, 0.5μmol / L upstream and downstream primers, 1uL genomic template DNA, and 3uL ddH2O. The PCR amplification program was: 95℃ 5min; 95℃ 30s, 62-52℃ 30s, 72℃ 30s, 25 cycles; 72℃ 20min. The amplified fluorescent PCR products were detected by amplification electrophoresis, and 2μL PCR products were taken for agarose gel electrophoresis (1% concentration). The specificity of each SSR primer amplification was determined by the band pattern of the PCR product, and the amplification efficiency of each SSR primer was determined by the brightness of the PCR product band. Through the fluorescent capillary electrophoresis technology, the linker method was used to verify and screen the candidate sites to obtain 9 polymorphic markers for variety differentiation.

[0041] Example 4 Using the above SSR molecular markers to identify the mushroom strains ZJXX001, ZJXX002, ZJXX003 and ZJXX004 1. Source of samples to be tested: the same as in Example 3; 2. Determine the SSR allele number combination; (1) DNA extraction The four strains of Champignon mushrooms were transferred to potato dextrose agar solid culture medium and cultured at 25°C for 15 days before collecting mycelium. The genomic DNA of the mycelium was extracted using the Qingke TSP101-200 kit, and the purity and concentration of the obtained DNA were detected by agarose gel electrophoresis and biospectrophotometer at a wavelength of 280 nm. The DNA of each strain was used for PCR amplification in step (2).

[0042] (2) PCR amplification Using the SSR molecular markers of SEQ NO. 7 to 24 obtained in Example 3, respectively, the DNA of each strain extracted in step (1) was subjected to PCR amplification of the SSR markers to obtain amplified products; The PCR amplification system was as follows: total volume 20ul, including: Qingke TSE101-Gold Medal Mix (green) 16.45ul, 10 μMTag DNase 1.2ul, 10umol / L SSR marker forward primer and reverse primer 1.2uL each, template DNA 1uL. PCR reaction conditions: 98℃ 2 min; 98℃ 10 second, 60℃ 10 second, 72℃ 10 second, 35 cycles; 72℃ 5 min. To ensure the accuracy of identification, each sample was repeated three times.

[0043] (3) Detect the amplified product by capillary electrophoresis: ABI HiDi Formamide buffer and GeneScan 500LIZ Size Standard internal standard reagent were mixed at a ratio of 130:1 to prepare a mix; the mix was dispensed into a 96-well reaction plate, and 10ul of the mix was added to each well; 0.5ul of sample template (the sample was the amplified product) was added to the 96-well plate, and the plate was centrifuged at 4000 rpm and then stopped; the mixing plate was pre-denatured at 95°C for 5 minutes using a metal bath heater, and immediately placed in -20°C after being taken out; after cooling, the plate was taken out, centrifuged at 4000 rpm, thawed, and mixed; a 3730 sequencer was used for capillary tube electrophoresis, with 2ul of sample and 6ul of bromophenol blue added, a voltage of 300 V, and a time of 12 minutes.

[0044] The relative molecular weight peaks of the allele sites detected by the primers in the selected mushroom ZJXX001, ZJXX002, ZJXX003 and ZJXX004 were obtained as shown in Table 3. Figures 3~11 .

[0045] 2. Results Analysis: (1) Comparative analysis of fluorescence detection peak graphs of capillary electrophoresis For example Figures 3~11 The electrophoresis detection peak diagram of the four Lentinula edodes strains shown in the figure shows that the peaks of each fluorescent marker of the four strains are clearly distinguishable.

[0046] Figure 3 This is the result of amplification with primers LESSR010-F and LESSR010-R. The sizes of the fragments corresponding to ZJXX001, ZJXX002, ZJXX003, and ZJXX004 are 205+220, 211, 205+220, and 217+241, respectively; Figure 4 This is the result of amplification with primer LESSR020. The sizes of the fragments corresponding to ZJXX001, ZJXX002, ZJXX003, and ZJXX004 are 206+233, 212, 215+236, and 206+215, respectively; Figure 5 This is the result of amplification with primer LESSR029. The sizes of the fragments corresponding to ZJXX001, ZJXX002, ZJXX003, and ZJXX004 are 236+248, 239+242, 239, and 239+242, respectively; Figure 6 This is the result of amplification with primer LESSR062. The sizes of the fragments corresponding to ZJXX001, ZJXX002, ZJXX003, and ZJXX004 are 214+217, 199+211, 217, and 214+220, respectively; Figure 7 This is the result of amplification with primer LESSR099. The sizes of the fragments corresponding to ZJXX001, ZJXX002, ZJXX003, and ZJXX004 are 268+274, 274+280, 274, and 274, respectively; Figure 8 This is the result of amplification with primer LESSR123. The sizes of the fragments corresponding to ZJXX001, ZJXX002, ZJXX003, and ZJXX004 are 282+290, 326, 270+326, and 290+326, respectively; Fig. 9 This is the result of amplification with primer LESSR127. The sizes of the fragments corresponding to ZJXX001, ZJXX002, ZJXX003, and ZJXX004 are 308, 320+336, 328, and 344, respectively; Fig.10 This is the result of amplification with primer LESSR137. The sizes of the fragments corresponding to ZJXX001, ZJXX002, ZJXX003, and ZJXX004 are 273, 267, 270+276, and 267, respectively; Fig.11 This is the result of amplification with primer LESSR188. The fragment sizes corresponding to ZJXX001, ZJXX002, ZJXX003 and ZJXX004 are 297+300, 261+282, 270+315 and 261+285, respectively.

[0047] Figures 3~11 The results show that the SSR molecular marker primer combination provided by the present invention can accurately distinguish ZJXX001, ZJXX002, ZJXX003 and ZJXX004 strains from other existing strains.

[0048] (2) Analysis of band combinations amplified by SSR primers The allelic fragments amplified by the 9 pairs of SSR primers in the 4 tested Lentinula edodes strains were coded according to their molecular weights and numbered. The strain that met the SSR allelic fragment number combination of (1+4) / (1+5) / (1+4) / (4+5) / (1+2) / (2+3) / 1 / 3 / (5+6) was the Lentinula edodes ZJXX001 strain; The strain that meets the SSR allele number combination of 2 / 3 / (2+3) / (1+3) / (2+3) / 4 / (2+4) / 1 / (1+3) is the Champignon mushroom ZJXX002 strain; The strain that meets the SSR allele number combination of (1+4) / (4+6) / 2 / 5 / 2 / (1+4) / 3 / (2+4) / (2+7) is the Champignon edodes ZJXX003 strain; The strain that meets the SSR allele number combination of (3+5) / (1+4) / (2+3) / (4+6) / 2 / (3+4) / 5 / 1 / (1+4) is the Champignon mushroom ZJXX004 strain.

[0049] The information on the number of allele fragments and molecular weight of the above SSR primers is shown in Table 4: Table 4 3. Cluster analysis using the above SSR allele number combination Based on the polymorphic fragments amplified by the above SSR molecular markers, the genetic diversity of 4 small mushrooms and 4 large mushrooms was analyzed. The genetic similarity coefficient was calculated using NTSYS-PC2.10 software, and the 8 sample individuals were clustered based on the UPGMA method to construct a UPGMA cluster tree. Fig.12 ).

[0050] from Fig.12 It can be seen that the SSR molecular markers provided by the present invention clustered the small mushroom ZJXX001, ZJXX002, ZJXX003 and ZJXX004 into one group, and the large mushroom LE0912, F6, QK212, YXXG01 strains into another group. The small mushroom ZJXX002 and ZJXX003 strains are each a separate branch and are distinguished from other strains; although the small mushroom ZJXX001 and ZJXX004 strains are clustered into the same branch, the genetic differences are obvious. This shows that the small mushroom ZJXX001, ZJXX002, ZJXX003 and ZJXX004 provided by the present application are not the same strains as the large mushroom LE0912, F6, QK212, YXXG01 strains, which can be separated from the clustering results.

[0051] It can be seen that the 9 pairs of SSR primer combinations provided by the present invention can be applied to distinguish between 4 small mushroom strains and 4 large mushroom strains as well as within 4 different small mushroom strains.

[0052] Example 5 Method for preparing liquid strains of shiitake mushroom strains ZJXX001, ZJXX002, ZJXX003 and ZJXX004 10 to 15 small mushroom blocks were selected from the propagated mother strain and inoculated into the liquid culture medium. The medium was placed in a shaking incubator at 25°C and 160 rpm. After culturing for 8 to 10 days, the small mushroom liquid strain was obtained. Fig.13 The liquid culture medium formula is: corn flour 20g / L, yeast powder 3g / L, potassium dihydrogen phosphate 3g / L, magnesium sulfate 1.5g / L, VB110mg / L, dissolved in distilled water and made up to 1L.

[0053] Example 6 Artificial cultivation method of small mushrooms ZJXX001, ZJXX002, ZJXX003 and ZJXX004 1) Prepare the cultivation material: weigh the raw materials according to the cultivation material ratio of 75 parts of sawdust, 17 parts of bran and 2 parts of lime, add water and mix well. The moisture content of the obtained cultivation material is 50-65%; 2) Sterilization: Put the prepared cultivation materials into cultivation bags (size 15cm×55cm), sterilize with high pressure steam and cool to room temperature; 3) Inoculation: The liquid strain obtained by the method in Example 5 was inoculated onto the bagged bacterial sticks, with an inoculation volume of 15 ml / bag, and cultured in the dark at 25° C. and 55% air humidity for 33 days; 4) Color change: Move the mushroom sticks covered with mycelium to the greenhouse and carry out color change management at 23℃ and diffuse light; 5) Mushroom management: Proper ventilation, temperature of 18°C, air humidity of 90%, light intensity of 300lx, CO2 concentration of 1000ppm, and pick the mushrooms before the caps of the fruiting bodies flatten.

[0054] According to statistics, the biological efficiency of ZJXX001, ZJXX002, ZJXX003 and ZJXX004 were 95.5%, 98.3%, 87.8% and 90.7% respectively.

[0055] Example 7 Determination of mycelial growth rate and high temperature resistance test of ZJXX001, ZJXX002, ZJXX003 and ZJXX004 mushroom strains (1) According to the formula: corn flour 20g / L, yeast powder 3g / L, agar powder 16-20g / L, potassium dihydrogen phosphate 3g / L, magnesium sulfate 1.5g / L, VB110mg / L, dissolve in distilled water and make up to 1L, prepare culture medium and pour test plates; (2) Inoculate the mushroom strains ZJXX001, ZJXX002, ZJXX003 and ZJXX004 on the test plate and culture them at 25°C until the plate is full of hyphae and the age of the fungi is the same. Then use a 0.5 cm diameter hole puncher to take the hyphae round blocks from the test plate; (3) Place the mycelium ball in the center of another plate prepared according to the test plate formula and culture at 25°C, 30°C, and 35°C respectively; (3) After 7 days of culture, the colony radius at each temperature was measured, and the mycelial growth rate was calculated as radius / day. The results are shown in the table below. For strains that did not germinate after 9 days of culture at 35°C, they were transferred to 25°C to observe germination.

[0056] Table 5 shows the mycelial growth rate of four mushroom strains at 25℃, 30℃ and 35℃ / cm·d -1 As can be seen from the above table, the champignon mushroom strains ZJXX001, ZJXX002, ZJXX003 and ZJXX004 can germinate normally at 25 and 30℃, but do not germinate at 35℃ and are in a dormant state. After being cultured at 35℃ for 9 days, they can germinate normally at 25℃ except for champignon mushroom ZJXX002.

[0057] Example 8 Nutrient Detection of Champignon Mushroom Strain ZJXX001 Detection method: Cultivate the fruiting bodies of the mushroom strain ZJXX001 according to the cultivation method of Example 6, collect the fruiting bodies of the mushroom strain ZJXX001, dry them with hot air until the moisture content is less than 10%, and then determine the nutritional components. The results are shown in Tables 6 to 8. For specific test results, see the test report No.: Center (Inspection)

[2024] No. 0135 issued by the Kunming Edible Fungi Quality Supervision and Inspection Center, and the MA number is 200000294394.

[0058] The determination of total sugar shall refer to GB / T 15672-2009 "Determination of total sugar content in edible fungi"; the determination of crude polysaccharides shall refer to NY / T1676-2023 "Spectrophotometric method for determination of crude polysaccharides in edible fungi"; the determination of protein content shall refer to GB5009.5-2016 "National Food Safety Standard Determination of Protein in Foods"; the determination of crude fiber content shall refer to GB 5009.10-2003 "National Standard Determination of Crude Fiber in Plant Foods"; the determination of amino acids shall refer to GB 5009.124-2016 "National Food Safety Standard Determination of Amino Acids in Foods"; the determination of vitamin B2 shall refer to GB 5009.85-2016 "National Food Safety Standard Determination of Vitamin B2 in Foods"; the determination of phosphorus shall refer to GB 5009.87-2016 "National Food Safety Standard Determination of Phosphorus in Foods"; the determination of zinc shall refer to GB 5009.14-2016 2017 "National Food Safety Standard for Determination of Zinc in Foods"; the determination of iron shall refer to GB 5009.90 2016 "National Food Safety Standard for Determination of Iron in Foods"; the determination of manganese shall refer to GB 5009.242 2017 "National Food Safety Standard for Determination of Manganese in Foods"; the determination of magnesium shall refer to GB 5009.241 2017 "National Food Safety Standard for Determination of Magnesium in Foods"; the determination of calcium shall refer to GB 5009.92 2016 "National Food Safety Standard for Determination of Calcium in Foods"; the determination of copper shall refer to GB 5009.13 2017 "National Food Safety Standard for Determination of Copper in Foods"; the determination of potassium and sodium shall refer to GB 5009.91 2017 "National Food Safety Standard for Determination of Potassium and Sodium in Foods"; the determination of selenium shall refer to GB 5009.93 2017 "National Food Safety Standard for Determination of Selenium in Foods".

[0059] Table 6 Statistics of nutrients of Champignon edodes strain ZJXX001 As can be seen from the table above, the edible mushroom strain ZJXX001 is rich in nutrients and elements, including 22.6g / 100g protein, 38.5% total sugar, 108mg / kg trace metal elements zinc, 29.5mg / kg iron, 847mg / kg magnesium, 171mg / kg calcium, and 3927mg / 100g potassium, all at relatively high levels.

[0060] Table 7 Amino acid statistics of Lentinula edodes strain ZJXX001 (unit: g / 100g) Table 8 Statistical analysis of flavor amino acids of Champignon edodes strain ZJXX001 As can be seen from Tables 6 to 8, the Champignon mushroom strain ZJXX001 is rich in various amino acids, with a total amino acid content of 15.15 g / 100 g and a total flavor amino acid content of 13.68 g / 100 g, of which the sweet and fresh amino acids are 4.49 g / 100 g and 4.05 g / 100 g, respectively, accounting for 56.37% of the total amino acids, and has a very good taste.

[0061] Example 9 Sensory Evaluation The test samples used in Example 4 were selected: small mushroom strains ZJXX001, ZJXX002, ZJXX003 and ZJXX004 and 4 large mushroom strains. The names of the large mushroom varieties are LE0912 (large mushroom 01), F6 (large mushroom 02), QK212 (large mushroom 03), and YXXG01 (large mushroom 04); After the fruiting bodies of the above 8 test strains were picked, they were boiled in 100℃ water for 10 minutes, and the umbrella-shaped parts were selected and cut into 1cm thick slices. After cooling to room temperature, they were tasted by the tasters. The taste, taste and chewing toughness angle of each sample were scored according to the following standards. The scoring rules are shown in Table 9: Table 9 Sensory evaluation criteria for fruiting bodies of the tested strains The sensory evaluation results of the test samples are shown in Table 10 Table 10 Sensory evaluation results of the tested samples As can be seen from the table above, the fruiting bodies of the small mushrooms ZJXX001, ZJXX002, ZJXX003 and ZJXX004 provided by the present application are sweet and delicious, have a significant effect of improving chewing toughness, and have a softer and more delicate taste than existing mushrooms, and a significantly reduced fiber feel. Compared with the large mushrooms 01-04, they have better taste, taste and chewing toughness.

[0062] Example 10 The difference from Example 6 is that the cultivation material is a cultivation material prepared by weighing raw materials according to the cultivation material ratio of 70 parts of sawdust, 15 parts of bran, and 1 part of lime, adding water and mixing well, and the moisture content of the obtained cultivation material is 50%; Inoculation: The culture conditions are 23°C, 50% air humidity, dark culture for 30 days; the inoculation volume is 10ml / bag; The color change management was carried out at 20℃ and diffuse light. The mushroom fruiting management was carried out at 16℃, air humidity of 95%, light of 200lx, and CO2 concentration of 450ppm.

[0063] Embodiment 11 The difference from Example 6 is that the cultivation material is a cultivation material prepared by weighing raw materials according to the cultivation material ratio of 80 parts of sawdust, 20 parts of bran and 3 parts of lime, adding water and mixing well, and the moisture content of the obtained cultivation material is 65%; Inoculation: The culture conditions are 28°C, 60% air humidity, dark culture for 35 days; the inoculation volume is 20ml / bag; The color change management was carried out at 25℃ and diffuse light. The mushroom fruiting management was carried out at 30℃, air humidity of 80%, light of 500lx, and CO2 concentration of 1500ppm.

[0064] Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for those skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to make equivalent substitutions for some of the technical features therein. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. Champignon mushroom strains ZJXX001, ZJXX002, ZJXX003, and ZJXX004, characterized in that: The deposit number of champignon mushroom ZJXX001 is CGMCC No.41450; the deposit number of champignon mushroom ZJXX002 is CCTCC NO: M 20242444; the deposit number of champignon mushroom ZJXX003 is CCTCC NO: M 20242445; the deposit number of champignon mushroom ZJXX004 is CCTCC NO: M 20242446; the taxonomic names of champignon mushroom strains ZJXX001, ZJXX002, ZJXX003, and ZJXX004 are all Lentinus edodes Lentinula edodes ; The SSR molecular markers used to identify the Lentinula edodes strains ZJXX001, ZJXX002, ZJXX003, and ZJXX004 are shown in SEQ NOs. 7 to 24.

2. The mushroom strains ZJXX001, ZJXX002, ZJXX003 and ZJXX004 according to claim 1, characterized in that: Cultivation methods include: The propagation mother strains of the shiitake mushroom strains ZJXX001, ZJXX002, ZJXX003 and ZJXX004 are inoculated into a liquid culture medium to obtain liquid strains, which are then inoculated into sterilized cultivation materials for dark culture, color change management and mushroom fruiting management until the shiitake mushroom fruiting bodies are picked before their caps are flattened.

3. The mushroom strains ZJXX001, ZJXX002, ZJXX003 and ZJXX004 according to claim 2, characterized in that: The cultivation material is weighed according to the proportion of 70-80 parts of sawdust, 15-20 parts of bran and 1-3 parts of lime, and water is added to mix well. The moisture content of the obtained cultivation material is 50-65%.

4. The mushroom strains ZJXX001, ZJXX002, ZJXX003 and ZJXX004 according to claim 2, characterized in that: The culture conditions are dark culture at 23~28℃ and air humidity of 50~60% for 30~35 days; the inoculation volume is 10~20ml / bag.

5. The mushroom strains ZJXX001, ZJXX002, ZJXX003 and ZJXX004 according to claim 2, characterized in that: The color change management is to move the cultivation material covered with mycelium to the greenhouse and carry out color change management at 20-25℃ and diffuse light; The mushroom production management is as follows: 16~30℃, air humidity 80%~95%, light 200~500lx, CO2 concentration 450~1500ppm.

6. A method for identifying the edodes mushroom strains ZJXX001, ZJXX002, ZJXX003, and ZJXX004 by SSR molecular markers according to claim 1, characterized in that: The following steps are involved: Step S1: transferring the mycelium or fruiting body of the tested Champignon mushroom strain to a potato dextrose agar solid medium, and collecting the mycelium after culturing at 25° C. for 15 days; Step S2: extracting the genomic DNA of the obtained mycelium, and using a biological spectrophotometer to detect whether the purity and concentration of the obtained total genomic DNA meet the detection requirements, if so, proceed to step S3, if not, increase the mass of the mycelium sample and repeat steps S1-2; Step S3: performing PCR amplification of SSR markers on the total genomic DNA obtained in step 2 using SSR molecular markers to obtain amplified products; Step S4: using capillary electrophoresis to detect the amplified product obtained in step S3, the number of allelic fragments obtained and the molecular weight of each fragment, determining the SSR allelic fragment number combination of the sample to be tested according to the number of allelic fragments and the molecular weight of each fragment, and judging whether the strain to be tested is at least one of the edodes shiitake mushroom strains ZJXX001, ZJXX002, ZJXX003, and ZJXX004 according to the obtained SSR allelic fragment number combination; The SSR molecular marker pairs include: a first SSR molecular marker pair, as shown in SEQ NO.7~8; a second SSR molecular marker pair, as shown in SEQ NO.9~10; a third SSR molecular marker pair, as shown in SEQ NO.11~12; a fourth SSR molecular marker pair, as shown in SEQ NO.13~14; a fifth SSR molecular marker pair, as shown in SEQ NO.15~16; a sixth SSR molecular marker pair, as shown in SEQ NO.17~18; a seventh SSR molecular marker pair, as shown in SEQ NO.19~20; an eighth SSR molecular marker pair, as shown in SEQ NO.21~22; and a ninth SSR molecular marker pair, as shown in SEQ NO.23~248.

7. The method according to claim 6, characterized in that The strain that meets the SSR allele number combination of (1+4) / (1+5) / (1+4) / (4+5) / (1+2) / (2+3) / 1 / 3 / (5+6) is the C. edodes ZJXX001 strain; "1+4" in (1+4) / (1+5) / (1+4) / (4+5) / (1+2) / (2+3) / 1 / 3 / (5+6) refers to allelic fragment numbers 1 and 4 of SEQ ID NOs: 7-8, the molecular weight of allelic fragment number 1 is 205-205.99 bp, and the molecular weight of allelic fragment number 4 is 220-220.99 bp; "1+5" refers to allelic fragment numbers 1 and 5 of SEQ ID NOs: 9 and 10, wherein the molecular weight of allelic fragment number 1 is 206 to 206.99 bp, and the molecular weight of allelic fragment number 5 is 233 to 233.99 bp; "1+4" refers to allelic fragment numbers 1 and 4 of SEQ ID NOs: 11 and 12, wherein the molecular weight of allelic fragment number 1 is 236 to 236.99 bp, and the molecular weight of allelic fragment number 4 is 248 to 248.99 bp; "4+5" refers to allelic fragment numbers 4 and 5 of SEQ ID NOs: 13 and 14, wherein the molecular weight of allelic fragment number 4 is 214 to 214.99 bp, and the molecular weight of allelic fragment number 5 is 217 to 217.99 bp; "1+2" ​​is the allelic fragment numbers 1 and 2 of SEQ ID NO: 15 and 16, the molecular weight of allelic fragment number 1 is 268 to 268.99 bp, and the molecular weight of allelic fragment number 2 is 274 to 274.99 bp; "2+3" refers to allelic fragment numbers 2 and 3 of SEQ ID NOs: 17 and 18, wherein the molecular weight of allelic fragment number 2 is 282 to 282.99 bp, and the molecular weight of allelic fragment number 3 is 290 to 290.99 bp; "1" is the allele number 1 of SEQ ID NO: 19, 20, and the molecular weight of the allele number 1 is 308 to 308.99 bp; "3" is the allele number 3 of SEQ ID NO: 21, 22, and the molecular weight of allele number 3 is 273 to 273.99 bp; "5+6" refers to allelic fragment numbers 5 and 6 of SEQ ID NOs: 23 and 24, the molecular weight of allelic fragment number 5 is 297 to 297.99 bp, and the molecular weight of allelic fragment number 6 is 300 to 300.99 bp.

8. The method according to claim 6, characterized in that The strain that meets the SSR allele number combination of 2 / 3 / (2+3) / (1+3) / (2+3) / 4 / (2+4) / 1 / (1+3) is the Champignon mushroom ZJXX002 strain; "2" in 2 / 3 / (2+3) / (1+3) / (2+3) / 4 / (2+4) / 1 / (1+3) is the allelic fragment number 2 of SEQ ID NO: 7, 8, and the molecular weight of the allelic fragment number 2 is 211-211.99 bp; "3" is the allele number 3 of SEQ ID NO: 9, 10, and the molecular weight of allele number 3 is 212 to 212.99 bp; "2+3" refers to allelic fragment numbers 2 and 3 of SEQ ID NOs: 11 and 12, wherein the molecular weight of allelic fragment number 2 is 239 to 239.99 bp, and the molecular weight of allelic fragment number 3 is 242 to 242.99 bp; "1+3" refers to allelic fragment numbers 1 and 3 of SEQ ID NOs: 13 and 14, wherein the molecular weight of allelic fragment number 1 is 199 to 199.99 bp, and the molecular weight of allelic fragment number 3 is 211 to 211.99 bp; "2+3" refers to allelic fragment numbers 2 and 3 of SEQ ID NOs: 15 and 16, wherein the molecular weight of allelic fragment number 2 is 274 to 274.99 bp, and the molecular weight of allelic fragment number 3 is 280 to 280.99 bp; "4" is the allele number 4 of SEQ ID NO: 17, 18, and the molecular weight of allele number 4 is 326 to 326.99 bp; "2+4" refers to allelic fragment numbers 2 and 4 of SEQ ID NOs: 19 and 20, wherein the molecular weight of allelic fragment number 2 is 320 to 320.99 bp, and the molecular weight of allelic fragment number 4 is 336 to 336.99 bp; "1" is the allele number 1 of SEQ ID NO: 21, 22, and the molecular weight of the allele number 1 is 267 to 267.99 bp; "1+3" refers to allelic fragment numbers 1 and 3 of SEQ ID NO: 23 and 24, the molecular weight of allelic fragment number 1 is 261 to 261.99 bp, and the molecular weight of allelic fragment number 3 is 282 to 282.99 bp.

9. The method according to claim 6, characterized in that The strain that meets the SSR allele number combination of (1+4) / (4+6) / 2 / 5 / 2 / (1+4) / 3 / (2+4) / (2+7) is the Champignon mushroom ZJXX003 strain; "1+4" in (1+4) / (4+6) / 2 / 5 / 2 / (1+4) / 3 / (2+4) / (2+7) refers to allelic fragment numbers 1 and 4 of SEQ ID NOs: 7 to 8, wherein the molecular weight of allelic fragment number 1 is 205 to 205.99 bp, and the molecular weight of allelic fragment number 4 is 220 to 220.99 bp; "4+6" refers to allelic fragment numbers 4 and 6 of SEQ ID NOs: 9 and 10, wherein the molecular weight of allelic fragment number 4 is 215 to 215.99 bp, and the molecular weight of allelic fragment number 6 is 236 to 236.99 bp; "2" is the allele number 2 of SEQ ID NO: 11, 12, and the molecular weight of allele number 2 is 239 to 239.99 bp; "5" is the allele number 5 of SEQ ID NO: 13, 14, and the molecular weight of allele number 5 is 217 to 217.99 bp; "2" is the allele number 2 of SEQ ID NO: 15, 16, and the molecular weight of allele number 2 is 274 to 274.99 bp; "1+4" refers to allelic fragment numbers 1 and 4 of SEQ ID NOs: 17 and 18, wherein the molecular weight of allelic fragment number 1 is 270 to 270.99 bp, and the molecular weight of allelic fragment number 4 is 326 to 326.99 bp; "3" is the allele number 3 of SEQ ID NO: 19, 20, and the molecular weight of allele number 3 is 328 to 328.99 bp; "2+4" refers to allelic fragment numbers 2 and 4 of SEQ ID NOs: 21 and 22, wherein the molecular weight of allelic fragment number 2 is 270 to 270.99 bp, and the molecular weight of allelic fragment number 4 is 276 to 276.99 bp; "2+7" refers to allelic fragment numbers 2 and 7 of SEQ ID NOs: 23 and 24, wherein the molecular weight of allelic fragment number 2 is 270 to 270.99 bp, and the molecular weight of allelic fragment number 7 is 315 to 315.99 bp.

10. The method according to claim 6, characterized in that The strain that meets the SSR allele number combination of (3+5) / (1+4) / (2+3) / (4+6) / 2 / (3+4) / 5 / 1 / (1+4) is the Champignon mushroom ZJXX004 strain; "3+5" in (3+5) / (1+4) / (2+3) / (4+6) / 2 / (3+4) / 5 / 1 / (1+4) refers to allelic fragment numbers 3 and 5 of SEQ ID NOs: 7-8, the molecular weight of allelic fragment number 3 is 217-217.99 bp, and the molecular weight of allelic fragment number 5 is 241-241.99 bp; "1+4" refers to allelic fragment numbers 1 and 4 of SEQ ID NOs: 9 and 10, wherein the molecular weight of allelic fragment number 1 is 206 to 206.99 bp, and the molecular weight of allelic fragment number 4 is 215 to 215.99 bp; "2+3" is the allele number 2 of SEQ ID NO: 11, 12, the molecular weight of allele number 2 is 239 to 239.99 bp, and the molecular weight of allele number 2 is 242 to 242.99 bp; "4+6" refers to allelic fragment numbers 4 and 6 of SEQ ID NOs: 13 and 14, wherein the molecular weight of allelic fragment number 4 is 214 to 214.99 bp, and the molecular weight of allelic fragment number 6 is 220 to 220.99 bp; "2" is the allele number 2 of SEQ ID NO: 15, 16, and the molecular weight of allele number 2 is 274 to 274.99 bp; "3+4" refers to allelic fragment numbers 3 and 4 of SEQ ID NOs: 17 and 18, wherein the molecular weight of allelic fragment number 3 is 290 to 290.99 bp, and the molecular weight of allelic fragment number 4 is 326 to 326.99 bp; "5" is the allele number 5 of SEQ ID NO: 19, 20, and the molecular weight of allele number 5 is 344 to 344.99 bp; "1" is the allele number 1 of SEQ ID NO: 21, 22, and the molecular weight of the allele number 1 is 267 to 267.99 bp; "1+4" refers to allelic fragment numbers 1 and 4 of SEQ ID NOs: 23 and 24, the molecular weight of allelic fragment number 1 is 261 to 261.99 bp, and the molecular weight of allelic fragment number 4 is 285 to 285.99 bp.

Images