Bruselle delbrueckii K221011F1 and application thereof

Abstract

The invention relates to the technical field of fruit and vegetable preservation and food fermentation, in particular to bruselle yeast K221011F1 from food and application of the bruselle yeast K221011F1. The classification name of the bruxellensis is Dekkera bruxellensis K221011F1, the preservation number of the bruxellensis K221011F1 is CCTCC No: M 2024251, the antibacterial spectrum of the bruxellensis K221011F1 is wide, the antagonism is strong, the growth of fruit and vegetable pathogenic fungi can be effectively inhibited, and the bruxellensis K221011F1 is applied to the field of agricultural biological control. Meanwhile, the bruselle yeast can also be used for a food fermentation process, the content of active substances in food is increased, and the bruselle yeast is a strain with excellent performance and has good development and application prospects.

Description

Technical Field

[0001] The invention relates to the technical field of fruit and vegetable preservation and food fermentation, in particular to a strain of Dekkera brussels yeast K221011F1 derived from food and an application thereof. Background Art

[0002] Fruits and vegetables have a high water content and are easily infected by microorganisms and rot in the post-harvest stage, resulting in quality deterioration and a short shelf life. The general loss rate is about 25%. In particular, small berry fruits have thin peels and are mostly ripened in the open field during high temperature and high humidity seasons. They are more susceptible to environmental and microbial stresses, resulting in large losses. Fungi such as Alternaria spp., Botrytis spp., Penicillium spp., Colletotrichum spp., Pestalotiopsis spp., and Fusarium spp. are the main types of decay pathogens in fruits and vegetables in the post-harvest stage. Using biological control methods to control fruit and vegetable diseases has always been one of the research hotspots.

[0003] In addition, yeast fermentation is widely used in food processing to improve the flavor and nutritional content of food. Fermenting plant products with microorganisms can increase the dissolution and extracellular release of their functional substances. Therefore, this field has been committed to developing and screening new strains that are non-toxic, safe, antibacterial, and have good fermentation effects. Summary of the invention

[0004] The present invention separates a strain of Dekkera brussels yeast K221011F1 from food, which has excellent effects in conventional preservation of fruits and vegetables, rot control, improvement of functional substance content, increase of stress resistance, etc., and also shows good fermentation ability in food fermentation, improves flavor, increases the content of functional substances, and K221011F1 is safe and non-toxic.

[0005] To achieve the purpose of the present invention, the following technical solution is provided:

[0006] The first aspect of the present invention provides a strain of Dekkera bruxellensis K221011F1, which was deposited in the China Center for Type Culture Collection, abbreviated as CCTCC, on January 29, 2024, with an address of Luojia Mountain, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and a deposit number of CCTCC No: M 2024251.

[0007] The second aspect of the present invention provides a microbial agent, which comprises the Dekkera bruxellensis K221011F1 and / or its metabolites described in the first aspect.

[0008] In the above technical solution, further, the microbial agent is a liquid or solid preparation.

[0009] The third aspect of the present invention provides a composition, which comprises the Dekkera bruxellensis K221011F1 as described in the first aspect, or comprises the microbial agent as described in the second aspect.

[0010] In the above technical solution, further, the composition is a food or pharmaceutical composition, which comprises the Dekkera bruxellensis K221011F1 as described in the first aspect, or comprises the microbial agent as described in the second aspect, and a food or pharmaceutically acceptable carrier.

[0011] The fourth aspect of the present invention provides the following use of the Dekkera bruxellensis K221011F1 described in the first aspect, the microbial agent described in the second aspect, and the composition described in the third aspect:

[0012] (1) Application in preventing and controlling fruit and vegetable rot.

[0013] Furthermore, fungi of the genera Alternaria spp., Botrytis spp., Penicillium spp., Pestalotiopsis spp., Fusarium spp., and Colletotrichum spp. are inhibited.

[0014] Furthermore, the present invention inhibits Alternaria tenuissma, Alternaria dumosa, Botrytis fabiopsis, Botrytis cinerea, Penicillium rubens, Penicillium chermesinum, Pestalotiopsis clavispora, Fusarium oxysporum and Colletotrichum nymphaeae.

[0015] Furthermore, the invention can be used in the preparation of drugs for preventing and treating fruit and vegetable rot.

[0016] Furthermore, it is used in preventing and controlling blueberry fruit rot and tomato fruit rot.

[0017] Furthermore, the Dekkera bruxellensis K221011F1 bacteria itself, its metabolites and the volatile substances produced all have the effect of inhibiting the above-mentioned pathogens.

[0018] Furthermore, Dekkera bruxellensis K221011F1 has the ability to secrete extracellular proteases and β-1,3-glucanase (GLU), which can inhibit the above-mentioned pathogens.

[0019] (2) Application in the preservation of fruits and vegetables.

[0020] Furthermore, the invention can be used in the preparation of fruit and vegetable preservatives.

[0021] Furthermore, it is used in the preservation of kiwifruit, blueberries and tomatoes.

[0022] (3) Application in increasing the content of functional substances in post-harvest fruits and vegetables. It can be used before and after harvest to increase the content of functional substances in fruits, including flavonoids and anthocyanins.

[0023] (4) Its application in improving the stress resistance of postharvest fruits and vegetables. It can be used to treat fruits and vegetables to increase the activities of antioxidant enzymes CAT, SOD, APX, and POD, and the activities of disease-resistant related enzymes PAL and GLU, thereby enhancing their antioxidant and disease resistance properties.

[0024] (5) Its application in the preparation of fermented foods. The fermentation conditions are relatively mild, which is conducive to maximizing the retention of the activity of functional substances.

[0025] Furthermore, it is used in the fermentation of red yeast rice wine.

[0026] Furthermore, it is used in fermenting tangerine peel to increase the total flavonoid content.

[0027] Beneficial effects of the present invention:

[0028] The brussels yeast K221011F1 screened from food has an antibacterial effect on Alternaria tenuissma and Alternaria dumosa, Botrytis fabiopsis and Botrytis cinerea, Penicillium rubens and Penicillium chermesinum, Pestalotiopsis clavispora, Fusarium oxysporum and Colletotrichum nymphaeae, especially at a concentration of 1×10 7cfu / mL has the best inhibitory effect on the growth of Alternaria and Botrytis. Dekkera bruxellensis K221011F1 significantly reduces the incidence of blueberry Alternaria fruit rot and tomato gray mold, and significantly improves the preservation effect of soft-fruited kiwifruit, and is safe and non-toxic. In addition, Dekkera bruxellensis K221011F1 can be used in the fermentation of red yeast rice wine to reduce the total acid in the wine, making the red yeast rice wine taste better; it can be used in the fermentation of tangerine peel to increase the content of active substances total flavonoids. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 In vitro initial screening: plate confrontation experiment screening diagram; A: CK; B: K221011F1;

[0030] Figure 2 In vivo rescreening: Effects of strain K221011F1 treatment on the morbidity of inoculated blueberry fruits on the 5th day; A: CK; B: post-harvest soaking of K221011F1;

[0031] Figure 3 Colony morphology of K221011F1 after culturing at 28°C for 3 days in solid medium;

[0032] Figure 4 Colony morphology of K221011F1 after culturing at 28°C for 3 days in liquid medium;

[0033] Figure 5 Phylogenetic tree based on 26S rDNA gene;

[0034] Figure 6 ISSR amplification test results of K221011F1 with different primer pairs; M: DL2000 Plus DNA Marker;

[0035] Figure 7 K221011F1 has inhibitory effects on Alternaria, Botrytis cinerea and Fusarium; A. Alternaria 712E1; B. Alternaria 632C1; C. Botrytis cinerea 928G1; D. Botrytis cinerea 929D1; E. Fusarium 719A2;

[0036] Figure 8 The inhibitory effect of K221011F1 on Penicillium, Pseudomonas and Colletotrichum; A. Penicillium 722I1; B. Penicillium 929D2; C. Pseudomonas 710B1; D. Pseudomonas 710B2; E. Colletotrichum 728H;

[0037] Fig. 9The inhibitory effect of K221011F1 bacteria and its metabolites on Alternaria alternata; A. Normal Alternaria alternata growth state; B. Antibacterial effect of K221011F1 blend solution; C. Antibacterial effect of K221011F1 bacterial living cell solution; D. Antibacterial effect of K221011F1 secretion solution;

[0038] Fig.10 The inhibitory effect of volatile antibacterial substances of K221011F1 on Alternaria alternata; A. Normal growth state of Alternaria alternata; B. The inhibitory effect of K221011F1 on Alternaria alternata;

[0039] Fig.11 Production of extracellular hydrolases in K221011F1; A. Chitinase (CHI); B. β-1,3-glucanase (GLU); C. Protease;

[0040] Fig.12 Effect of strain K221011F1 treatment on the morbidity of blueberry fruits inoculated with Alternaria on the 5th day; A. CK; B. K221011F1 sprayed before harvest;

[0041] Fig.13 Effect of strain K221011F1 treatment on the morbidity of tomato fruits inoculated with Botrytis cinerea on the 5th day; A.CK; B. K221011F1 post-harvest soaking;

[0042] Fig.14 Effect of strain K221011F1 treatment on the preservation of Actinidia arguta from 0 to 5 days; A: CK; B: post-harvest soaking of K221011F1;

[0043] Fig.15 Effects of K221011F1 treatment on flavonoids in blueberry fruit (P<0.05);

[0044] Fig.16 Effect of K221011F1 treatment on anthocyanins in blueberry fruit (P<0.05);

[0045] Fig.17 Effects of K221011F1 treatment on blueberry fruit activity (P<0.05); A. CAT; B. SOD; C. POD; D. APX;

[0046] Fig.18 Effect of K221011F1 treatment on blueberry fruit activity (P<0.05); A. PAL; B. GLU;

[0047] Fig.19 The morphology of red yeast rice wine after fermentation; A. control group (without yeast); B. treatment group (with added Dekkera brussels yeast K221011F1);

[0048] Fig. 20 Comparison of different cold-infused liquors of dried tangerine peel; A. Unfermented dried tangerine peel; B. Dermatophyte fermented with Dekkera brusselsii K221011F1. DETAILED DESCRIPTION

[0049] The present invention is further described below in conjunction with specific embodiments, but the present invention is not limited in any way.

[0050] Example 1 Screening and Identification of Dekkera bruxellensis K221011F1

[0051] 1. Screening:

[0052] The strains were isolated from fermented foods, purified to obtain a test strain library, and the strains of the invention were obtained through in vitro primary screening and in vivo rescreening.

[0053] (1) In vitro initial screening: The plate confrontation method is used. Place the test strain and the target pathogen (Alternaria tenuissima) on the plate at the same time to observe whether the test strain has an inhibitory effect on the growth of the target bacteria. Draw a straight line in the middle of the PDA plate with the test strain and the target pathogen cake on both sides of the straight line. Place the inoculated PDA plate in a 25℃ constant temperature box to observe the antibacterial effect. Figure 1 .

[0054] (2) In vivo rescreening: Blueberry fruits were soaked in 2% (v / v) sodium hypochlorite solution for 3 min, washed with water and dried for 30 min. The fruits were then divided into two groups, and blueberries in each group were placed in 1×10 7 cfu / mL K221011F1 and sterile water (CK control) for 15-30 min, and each treatment was repeated 3 times. After 3 h, the blueberry fruit stems were inoculated with 10 μL of the target pathogen (A. tenuissima) spore suspension (1×10 5 cfu / mL), and carefully put them in transparent fresh-keeping bags after inoculation and store them in a constant temperature box at 20℃ and 85-90%RH. Observe and count the disease conditions of blueberries at 0d, 1d, 2d, 3d, 4d, and 5d after inoculation.

[0055] Determination method: Calculate the incidence of blueberry fruit using the following formula:

[0056]

[0057] Where X is the incidence of blueberry fruit, N0 is the number of diseased blueberry fruits, and N is the total number of blueberry fruits observed and measured.

[0058] The plate confrontation test was used to conduct a preliminary screening of the inhibition of pathogenic fungal hyphae growth test ( Figure 1 ) and obtained the antagonistic strain K221011F1. In addition, in vivo rescreening was used, and K221011F1 was used to soak blueberries after harvest to observe the disease of blueberries and analyze the effect of K221011F1. With the increase of storage days, the incidence of blueberry fruit gradually increased, but the incidence of the group treated with strain K221011F1 was significantly lower than that of the control group. On the 5th day, the incidence of the group treated with strain K221011F1 after harvest was 31.5% lower than that of the control group (Table 1). According to the in vitro initial screening and in vivo rescreening, strain K221011F1 can effectively inhibit the growth of Alternaria alternata ( Figure 2 ).

[0059] Table 1 Incidence of rescreening in vivo with strain K221011F1

[0060]

[0061] 2. Morphological Observation

[0062] (1) Solid culture characteristics: The candidate strain to be identified was inoculated into NYDA medium by streaking, cultured at 28°C for 3 days, and the size, color, edge shape and other characteristics of the colonies were observed.

[0063] K221011F1 was streaked on NYDA solid medium and cultured at 28°C for 3 days. The colonies were round and mucous. The surface was observed to be moist and smooth. The edges of the colonies were relatively neat, opaque and milky white, and easy to pick up. Figure 3 ).

[0064] (2) Liquid culture characteristics: Plant a ring of the candidate strain to be identified in NYDB medium and culture it at 28°C for 3 days to observe its turbidity and the presence of floating films, rings or islands.

[0065] In NYDB liquid medium, after culturing at 28℃ for 3 days, there was a floating film, the bacterial solution was turbid, and most of the bacteria were precipitated at the bottom ( Figure 4 ).

[0066] 3. Physiological and biochemical characteristics

[0067] (1) Sugar fermentation experiment: The sugar substances to be tested include sucrose, glucose, maltose, trehalose, raffinose, D-lactose and D-galactose. The above sugar substances are prepared into a mother solution with a mass concentration of 0.2g / mL for standby use. Bean sprout juice is used as the basic culture medium for sugar fermentation. 7.2mL of the basic culture medium is added to each test tube, and then 0.8mL of the mother solution of the sugar to be tested is added. After mixing, it is placed in a Dulbecco's tube and sterilized at 121℃ for 20min; 100μL of yeast antagonist bacterial solution is added to each test tube, gently mixed, and cultured at 28℃. Observe regularly every day; the basic culture medium without any sugar substances is used as the control, and each group of experiments is repeated 3 times.

[0068] The K221011F1 strain could ferment sucrose and glucose, but could not ferment maltose, trehalose, raffinose, D-lactose and D-galactose (Table 2).

[0069] Table 2 Sugar fermentation of K220111F1

[0070]

[0071] (2) Carbon source assimilation experiment: The carbon sources to be tested include D-lactose, D-galactose, trehalose, raffinose, citric acid, succinic acid, cellobiose, xylose, erythritol, inositol, and soluble starch. The liquid culture medium test tube method was used to detect the assimilation of yeast to different carbon sources: 10 mL of carbon source liquid culture medium was added to the test tube, and 0.05 g of different carbon sources and a concentration of 1×10 7 cfu / mL, with 100 μL yeast antagonist suspension, with glucose added as positive control and culture medium without carbon source as negative control, cultured at 26°C, observed daily, and the test tube was gently shaken during observation, and continued to observe for about 1 week. The liquid became turbid, proving that the yeast could assimilate and utilize the carbon source, and each group of experiments was repeated 3 times.

[0072] The K221011F1 strain could utilize glucose, D-galactose, D-xylose, inositol and soluble starch, but could not utilize the other tested carbon sources (Table 3).

[0073] Table 3 Carbon source assimilation of K221011F1

[0074]

[0075] (3) Nitrogen source assimilation experiment: The nitrogen sources to be tested include ammonium sulfate, urea, and potassium nitrite. The specific test method is similar to the carbon source assimilation experiment, except that the added carbon source is replaced with a nitrogen source.

[0076] K221011F1 could utilize ammonium sulfate and urea, but could not utilize the other tested nitrogen sources (Table 4).

[0077] Table 4K221011F1 Nitrogen source assimilation

[0078]

[0079] 4. Molecular Biological Identification

[0080] ITS sequence and 26S rDNA sequence were used for analysis in this strain identification.

[0081] The antagonistic bacteria were taken out from the -80°C incubator and activated. 1-2 rings of the activated antagonistic bacteria were placed in PD medium and cultured overnight at 28°C and 180 rpm. 1 mL of fresh bacterial solution was taken and DNA was extracted using the Genomic DNA Extraction Kit (Wanlei Biotechnology Co., Ltd.).

[0082] ITS sequence primers: ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') and ITS4 (5'-TCCTCCGCTTATTGATATGC-3') primers were used to amplify the ITS sequence.

[0083] The PCR amplification reaction system of ITS was as follows: each 25 μL reaction system included 2 μL of template DNA, 1 μL each of fungal universal primers ITS1 and ITS4, 8.5 μL of dd H2O, and 12.5 μL of 2×Taq Master Mix DNA polymerase.

[0084] The PCR reaction program conditions of primers ITS1 and ITS4 were as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, for a total of 36 cycles; and finally extension at 72°C for 10 min and storage at 4°C.

[0085] 26S rDNA sequence primers: NL1 (5'-GCATATCAATAAGCGGAGGAAAA-3') and NL4 (5'-GGTCCGTGTTTCAAGACGG-3') primers were used to amplify the 26S rDNA sequence.

[0086] The PCR amplification reaction system of 26S rDNA was as follows: each 25 μL reaction system included 2 μL of template DNA, 1 μL each of yeast universal primers NL1 and NL4, 8.5 μL of dd H2O, and 12.5 μL of 2×Taq Master Mix DNA polymerase.

[0087] The PCR reaction program conditions of primers NL1 and NL4 were as follows: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 1 min, annealing at 53°C for 1 min, extension at 72°C for 1 min, for a total of 36 cycles; and finally extension at 72°C for 7 min and storage at 4°C.

[0088] Sequencing: After the reaction was completed, DL2000Plus was selected as the DNA Marker, the sample volume was 5 μL, and electrophoresis was performed in 1% (w / v) agarose gel for about 20 minutes (120V). Ethidium bromide was used for staining, and the DNA was detected under ultraviolet light. After a single band, the sample was sent for testing. The sequencing work was completed by Shanghai Sangon Biotechnology Co., Ltd.

[0089] Identification method: The ITS sequence of K221011F1 strain was compared with the NCBI database (https: / / www.ncbi.nlm.nih.gov) and identified to the genus level. The 26S rDNA sequence of K221011F1 strain was compared with the known reference strains to construct a phylogeny to effectively refine the strain and genetic tree for species-level identification ( Figure 5 ).

[0090] The 26S rDNA sequence of K221011F1 is shown in SEQ ID NO: 1:

[0091] CGCGGAAGGGGTATTGCCCCAGTAATGGCGAATGAAGCGGCAAGAGCCCAAATTTGAAATCGGGCAACCGAGTTGTAATTTGGAGACGGGACACTAGAGAGGAGGAAGGCGATTAAGTGCCTTGGAACAGGCTGCCGTAGAGGGTGAGAGCCCCGTGAATCGCT GGAGACCGATCAATTAGTGCCCGCCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTATATTCCATCTAAGGCTAAATATTAGCGAGAGACCGATAGCAAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGGAAAGAGAGTGAAATAGTA CGTGAAATTGTTGAAAGGGAAGGGTATTTGATCCGACATGGTGTTTAGCAGCGGCCCGTTCCTCGTGGATGGGTGCACCTGGTTTACACTGGGCCAGCATCGGTTCTGGGAGCCATATACGGGGTTCGTGAATGTGGCCCTTCGATTCTGTCGGAGGGTGTTAT AGCGCGGGCATCTTGTGGCTAGCCGGGACCGGGGACTGCGGTGACTTGTCACCAAGGATGCTGGCAGAACGAGCAAATACCACCCGTCTTGAACACGGACCCCACGGTGACGGAACGCTTCTTTACGCATTTCACAGGTACAGCGACCGTCTTGAAACACGGACC

[0092] The strain K221011F1 is Dekkera bruxellensis, and the asexual state is Brettanomyces bruxellensis. It is named Dekkera bruxellensis K221011F1, and was deposited in the China Center for Type Culture Collection (CCTCC, address: Luojiashan, Bayi Road, Wuchang District, Wuhan City, Hubei Province) on January 29, 2024, with a deposit number of CCTCC No: M 2024251.

[0093] Example 2 ISSR fingerprint of Dekkera bruxellensis K221011F1

[0094] ISSR (Inter-Simple Sequence Repeat) fingerprinting is a molecular marker technology. This embodiment is used to perform fingerprint analysis on bacterial communities in genetic research, using simple repeat sequences to identify and distinguish the genetic characteristics of different bacterial communities.

[0095] The ISSR fingerprint of Dekkera brussels K221011F1 of the present invention is operated as follows: primers refer to the sequences (UBC801-UBC900) provided by Columbia University, and the DNA of K221011F1 is used as a template to screen out 9 primers that can amplify clear bands with polymorphism for ISSR analysis.

[0096] PCR reaction system (total volume 25 μL): DNA 1.5 μL, primer 1.5 μL, dd H2O 9.5 μL, 2×Taq MasterMix DNA polymerase 12.5 μL.

[0097] Amplification procedure: 94℃ pre-denaturation for 5min, 94℃ denaturation for 30s, 52℃ annealing for 45s, 72℃ extension for 90s, 30 cycles, and finally 72℃ extension for 10min, and storage at 4℃. PCR amplification products were electrophoresed at 100V using 1.0% agarose, stained with ethidium bromide, observed on a gel imaging system, and photographed and recorded ( Figure 6 ).

[0098] ISSR is a method very suitable for distinguishing intra-species diversity of microorganisms. The present invention uses ISSR to mark the ISSR genetic map of the invented strain for distinguishing it from other strains of the same species.

[0099] Results: Seven ISSR primers, 808, 827, 836, 857, 873, 881 and 888, were selected to mark the genetic map of the strain. The specific map is shown in Figure 6 shown.

[0100] The amplification pattern of primer 808 showed 6 obvious bands, 4 of which were distributed in the range of 250-750 bp, 1 in the range of 750-1000 bp, and 1 in the range of 1000-2000 bp; primer 827 showed 5 obvious bands, which were concentrated in the range of 1000-2000 bp; primer 836 showed 7 clear bands, 2 in the range of 250-500 bp, 2 in the range of 500-1000 bp, and 3 in the range of 100 Primer 857 has 3 clear bands, which are concentrated in the range of 500-1000bp; Primer 873 amplifies more bands, with a total of 8 clear bands, 4 of which are distributed in the range of 750-1000bp, and 4 are distributed in the range of 1000-2000bp; the amplification pattern of primer 881 is in a particularly clear band at 1000-2000bp; the amplification pattern of primer 888 has 1 clear band at 750bp.

[0101] Example 3 Inhibitory effect of Dekkera bruxellensis K221011F1 on common spoilage fungi of fruits and vegetables

[0102] This example measured the in vitro antibacterial effect of K221011F1 on common decay fungi of fruits and vegetables. The pathogens used were Alternaria tenuissma and Alternaria dumosa, Botrytis fabiopsis and Botrytis cinerea, Penicillium rubens and Penicillium chermesinum, Pestalotiopsis clavispora, Fusarium oxysporum and Colletotrichum nymphaeae, which were previously isolated and identified.

[0103] 1. Operation method:

[0104] (1) Preparation of bacterial suspension: Take out the Dekkera brusselsii K221011F1 from the -80℃ refrigerator, dilute it with sterile water and apply it on the PDA medium plate. After the liquid is completely absorbed, place the plate in a 28℃ constant temperature incubator for incubation. Pick a single yeast colony and perform streak purification twice, and then culture it in a 28℃ constant temperature incubator. Then scrape it with sterile water onto a blood cell counting plate, count it under a microscope and dilute it to 1×10 7 cfu / mL was obtained.

[0105] (2) Control treatment: 200 μL of 1×10 7cfu / mL of K221011F1 bacterial suspension was evenly spread on PDA culture medium, and the control group was spread with an equal amount of sterile water.

[0106] (3) Pathogen treatment: After 2 hours of placement, take the pathogens grown on the PDA plate for 7 days, punch holes at the edge of the colony, and obtain a bacterial cake with a diameter of 6 mm. Place the bacterial cake of the pathogen in the center of the plate coated with the K221011F1 bacterial suspension. Cultivate at a constant temperature of 25°C, measure the diameter of the pathogen colony after 5 days, and evaluate the inhibitory effect of K221011F1 on the pathogen. Repeat the treatment three times for each group.

[0107] (4) Calculation of inhibition rate: inhibition rate / % = (control colony diameter - treated colony diameter) / (control group diameter - bacterial cake diameter) × 100.

[0108] Plate antibacterial test results of strain K221011F1 ( Figure 7 and Figure 8 ), K221011F1 had a good inhibitory effect on blueberry postharvest pathogens Alternaria, Botrytis cinerea, Penicillium, Fusarium, Colletotrichum and Pseudomonas, and could effectively inhibit their mycelial growth. On the 5th day, the control group could grow normally, while the mycelial growth of the K221011F1 treatment group was less. Among them, strain K221011F1 had the best inhibitory effect on the mycelial growth of Alternaria and Botrytis cinerea, with the inhibition rates reaching 97.59%, 94.62%, 94.98% and 97.87%, respectively, and the inhibition rates on Fusarium and Pseudomonas reached 96.00%, 94.84% and 90.71%, respectively, and the inhibition rates on Penicillium and Colletotrichum could also reach 93.79%, 90.54% and 87.84% (see Table 5). The results showed that strain K221011F1 had a wide antibacterial spectrum.

[0109] Table 5 Antibacterial rate of K221011F1 against different pathogens

[0110]

[0111]

[0112] Example 4 Inhibition mechanism of Dekkera bruxellensis K221011F1 on spoilage fungi

[0113] (1) Inhibitory effects of Dekkera bruxellensis K221011F1 bacteria and its metabolites

[0114] After activation and culture of Dekkera brusselsii K221011F1 in NYDB liquid medium for 36 h, the following three treatment solutions a, b, and c were obtained respectively: (a) Mixed solution (live bacterial cells + secretions): The cultured K221011F1 bacterial suspension was prepared with NYDB medium to a volume of 1×107 cfu / mL bacterial suspension; (b) bacterial live cell suspension: the cultured K221011F1 bacterial suspension was centrifuged at 8000g for 10 min, the supernatant was discarded (to remove secretions) and washed with sterile distilled water until there was no culture medium, and then prepared into 1×10 7 cfu / mL bacterial solution; (c) secretion solution: centrifuge the cultured K221011F1 bacterial suspension at 8000g for 10 minutes, and filter and collect the supernatant (keep the secretion). Apply 100μL of the three treatment solutions of K221011F1a, b, and c with the best concentrations to the PDA plate, and then place a 6mm bacterial cake of Alternaria tenuissma 712E1 in the center of the plate after 10 minutes. Place the plate in a constant temperature incubator at 28℃, observe and measure the colony diameter of Alternaria tenuissma after 5 days of incubation, and repeat each treatment 3 times.

[0115] Calculation of inhibition rate: inhibition rate / %=(colony diameter of target bacteria control group-colony diameter of target bacteria treatment group) / (colony diameter of target bacteria control group-bacteria cake diameter)×100%.

[0116] Both the strain K221011F1 bacteria itself and its metabolites exerted an inhibitory effect. When the plates were coated with the K221011F1 strain blend, bacterial live cell solution and secretion solution, the diameter of the Alternaria mycelium was significantly lower than that of the control group. When the a treatment solution and the b treatment solution were inoculated onto the plate, the diameters of the A. tenuissima colonies were 7.80 mm and 9.68 mm, respectively, which were significantly lower than those of the control group (65.37 mm), and the inhibition rates reached 96.97% and 93.80%, respectively. The results showed that the main inhibitory effect was exerted by the cells and their metabolites. Among them, the strain K221011F1 blend had the best antibacterial effect, followed by the bacterial live cell solution ( Fig. 9 ). This indicates that the K221011F1 strain produces strong antibacterial substances during the culture process, that is, the metabolites may produce antibiotics, and both the bacteria themselves and the metabolites play an inhibitory role.

[0117] (2) Antibacterial effect of volatile substances produced by Dekkera bruxellensis K221011F1

[0118] Take 100 μL of 1×10 7The 300 cfu / mL K221011F1 bacterial suspension was evenly spread on the NYDA plate and cultured at 28°C. After 2 days, when the strain grew out, a 6 mm pathogen cake was placed in the center of the PDA plate. Then the two plates were turned upside down and sealed to prevent leakage of volatile substances. The NYDA plate without coating of the candidate strain suspension was used as the control. The plate was cultured in a 28°C incubator. After 5 days, the colony diameter of Alternaria alternata was observed and measured. Each treatment was repeated 3 times. The inhibition rate was calculated and analyzed according to the following formula.

[0119] Inhibition rate / %=(control colony diameter-treated colony diameter) / (control group diameter-bacteria cake diameter)×100.

[0120] Strain K221011F1 can release volatile antibacterial substances and significantly inhibit the growth of Alternaria mycelium ( Fig.10 ), the mycelial diameter of Alternaria in the treatment group was significantly smaller than that in the control group. The treatment group with strain K221011F1 could significantly inhibit the expansion of Alternaria mycelium and significantly affect the growth of mycelium. The mycelium was sparse and the colonies were thinner than those in the control group, which further indicated that the strain released volatile substances and had a significant antibacterial effect.

[0121] (3) Ability of Dekkera brusselsii K221011F1 to secrete extracellular hydrolases

[0122] Chitin is a polysaccharide mainly found in the exoskeleton of insects and the cell walls of fungi. Chitinase hydrolyzes the β-1,4-glycosidic bonds of chitin, breaking it down into smaller sugar molecules; β-1,3-glucanase can destroy the cell walls of pathogens and weaken their structural stability; proteases can decompose key proteins of pathogens, including enzymes and toxins, thereby further inhibiting the activity of pathogens. The disease resistance of Dekkera bruxellensis K221011F1 was analyzed by testing its ability to secrete extracellular hydrolases.

[0123] For chitinase (CHI) production detection: take 10 μL of the optimal concentration of K221011F1 bacterial suspension and spot it in the center of the chitinase detection culture medium. After culturing for 1-7 days, observe the formation of transparent circles. The presence of transparent circles indicates that chitinase is produced, otherwise there is no transparent circle.

[0124] For the detection of β-1,3-glucanase (GLU) production: take 10μL of the optimal concentration of K221011F1 bacterial suspension and spot it in the center of the laminarin solid culture medium. After culturing for 72 hours, stain it with 1g / L Congo red for 90 minutes at room temperature, pour out the unabsorbed Congo red dye, decolorize the plate with 1mol / L NaCl for 15 minutes, and observe the production of yellow hydrolysis circles. The presence of yellow hydrolysis circles indicates the production of β-1,3-glucanase, otherwise there is no yellow hydrolysis circle.

[0125] For the detection of protease production: take 10μL of the optimal concentration of K221011F1 bacterial suspension and spot it in the protease detection culture medium. After culturing at 25℃ for 1-7 days, observe the formation of transparent circles. The presence of transparent circles indicates that protease is produced, otherwise no transparent circles are produced.

[0126] Results Different extracellular hydrolase assays revealed that strain K221011F1 had the ability to secrete β-1,3-glucanase (GLU) and protease, but could not secrete extracellular chitinase (CHI) ( Fig.11 ). It can be inferred that K22011F1 hydrolyzes the cell wall of the target bacteria through the protease and β-1,3-glucanase (GLU) produced, thereby inhibiting the growth of the target bacteria hyphae.

[0127] Example 5 Effect of Dekkera bruxellensis K221011F1 on the preservation of fruits and vegetables

[0128] (1) Dekkera bruxellensis K221011F1 was used to treat blueberries and its antiseptic effect on blueberries was evaluated.

[0129] Pre-harvest spraying: use 1×10 7 cfu / mL K221011F1 and sterile water (CK control) were sprayed on the surface of blueberry fruits 12 h before harvest. After picking, blueberries were divided into sterilized and dried 96-well ice trays, and 10 μL of A. tenuissima spore suspension (1×10 5 cfu / mL) were carefully covered with fresh-keeping transparent bags and stored in a constant temperature box at 20°C and 85-90% RH. The incidence of blueberry after inoculation was observed and counted.

[0130] With the increase of storage days, the incidence of blueberry fruit gradually increased, but the incidence of the strain K221011F1 treatment group was significantly lower than that of the control group, and there was a significant difference (P<0.05). The control group began to get sick on the second day, and the treatment group began to get sick on the third day. On the fifth day, the incidence of the strain K221011F1 pre-harvest treatment group was 23.43% lower than that of the control group. On the fifth day, the degree of blueberry lesions in the treatment group was lower than that in the control group (Table 6, Fig.12 ). In summary, it was shown that the pre-harvest spraying of strain K221011F1 could significantly and effectively control the occurrence of chain rot in blueberry fruit during the storage period.

[0131] Table 6 The incidence of blueberry fruit inoculated with strain K221011F1

[0132]

[0133] (2) Tomatoes were treated with Dekkera bruxellensis K221011F1 to evaluate its antiseptic effect on tomatoes.

[0134] The tomato fruits were soaked in 2% (v / v) sodium hypochlorite solution for 3 min, washed with water and dried for 30 min. The fruits were then divided into two groups, and the tomatoes in each group were placed in 1×10 7 cfu / mL K221011F1 and sterile water (CK control) for 15-30 min, and each treatment was repeated 3 times. After 3 h, the cells were divided into sterilized and dried 96-well ice cube trays, and 10 μL of Botrytis cinerea spore suspension (1×10 5 cfu / mL), carefully put them in transparent fresh-keeping bags after inoculation, and store them in a constant temperature box at 20℃ and 85-90%RH. Observe and count the disease incidence of tomatoes after inoculation.

[0135] The results showed that Dekkera brucellae K221011F1 could effectively control tomato gray mold caused by B. cinerea infection ( Fig.13 ) On the 5th day of storage at room temperature, almost all the control group was diseased, but the incidence of the group treated with postharvest soaking of K221011F1 was significantly lower than that of the control group, 71.87% lower than that of the control group (Table 7), indicating that postharvest soaking of Dekkera brucellae K221011F1 can control the occurrence of postharvest gray mold of tomatoes.

[0136] Table 7 The incidence of tomato fruit inoculated with strain K221011F1

[0137]

[0138] (3) Dekkera brusselsii K221011F1 was used to treat Actinidia arguta and its preservation effect on Actinidia arguta was evaluated.

[0139] Soak the kiwifruit in 2% (v / v) sodium hypochlorite solution for 3 minutes, wash with clean water and air dry for 30 minutes. Then divide the fruit into two groups. Each group of kiwifruit is soaked in K221011F1 bacterial suspension and sterile water (CK control) for 15-30 minutes, and each group is treated 3 times. After 3 hours, pack them on sterilized and dried trays for 30 minutes, and each group is treated 3 times.

[0140] As for the preservation effect of K221011F1, the kiwifruit was treated with natural disease without inoculation. The results showed that with the increase of storage time, the diameter of the lesions in the control group became larger, while the kiwifruit in the group treated with Brucella Dekkera K221011F1 had no obvious lesions ( Fig.14The diameter of the lesion was used as an indicator of the severity of the disease, indicating that the treatment with Dekkera brucellae K221011F1 could keep Actinidia arguta fresh.

[0141] Example 6 Effect of Dekkera bruxellensis K221011F1 on increasing the content of functional substances in fruits and vegetables

[0142] The plant secondary metabolites such as flavonoids and anthocyanins contained in fruit and vegetable tissues are important functional substances, which have anti-oxidation and anti-aging effects on the human body. This example measured the content of flavonoids and anthocyanins in blueberries before and after harvesting in Example 5. The K221011F1 strain treated blueberries, which had an effect of increasing the content of flavonoids and anthocyanins.

[0143] (1) Effect of K221011F1 treatment on the enhancement of blueberry flavonoids

[0144] Flavonoid determination method: Accurately weigh 3.0g of blueberry pulp tissue and add it to 5.0mL of pre-cooled 1% HCL-methanol solution. Grind it into a homogenate in an ice bath. Add the homogenate to a 50mL centrifuge tube and repeatedly rinse the mortar with 1% HCL-methanol solution. Transfer the rinse solution to the centrifuge tube. Make the volume of the liquid in the centrifuge tube to 20mL, shake and mix at 4°C and extract in the dark for 20 minutes. Centrifuge at 4°C and 12000×g to collect the supernatant. The flavonoid content is determined as the absorbance value at a wavelength of 325nm, that is, OD 325 / g.

[0145] The results showed that the flavonoid content of the pre-harvest and post-harvest treatment groups of strain K221011F1 was higher than that of the control group ( Fig.15 ). Among them, the flavonoid content of strain K221011F1 was the highest on the 4th day after inoculation in both pre-harvest and post-harvest treatments. From the 1st to the 5th day after inoculation, the flavonoid content of the pre-harvest treatment was higher than that of the post-harvest treatment group.

[0146] (2) Effect of K221011F1 treatment on the enhancement of anthocyanins in blueberries

[0147] Anthocyanin determination method: The pulp tissue was processed in the same way as the flavonoids. The anthocyanin content (U) was determined as the difference in absorbance at wavelengths of 530 nm and 600 nm, i.e., U = (OD 530 -OD 600 ) / g.

[0148] The results showed that the anthocyanin content of the pre-harvest and post-harvest treatment groups of strain K221011F1 and the control group basically showed a trend of first increasing, then decreasing, and then increasing again. The anthocyanin content of the pre-harvest and post-harvest treatment groups of strain K221011F1 was significantly higher than that of the control group. The anthocyanin content of the pre-harvest and post-harvest treatments of strain K221011F1 was the highest on the second day after inoculation. On the first and second days after inoculation, the anthocyanin content of the pre-harvest treatment was higher than that of the post-harvest treatment group. On the third and fourth days, the anthocyanin content of the pre-harvest treatment group was close to that of the post-harvest treatment group ( Fig.16 ).

[0149] Example 7 Effect of Dekkera bruxellensis K221011F1 on improving fruit stress resistance

[0150] SOD, CAT, POD, and APX are key enzymes for removing ROS in the antioxidant system of fruits and vegetables. PAL is closely related to the resistance of plants to stress and disease. GLU is an important pathogenesis-related protein in plants to resist infection by pathogens. This example measured the antioxidant enzymes and disease resistance-related enzymes of blueberries to reflect the effect of K221011F1 on improving the stress resistance of fruits.

[0151] (1) Dekkera bruxellensis K221011F1 enhances the antioxidant capacity of fruits

[0152] Determination of CAT activity: Accurately weigh 3 g of blueberry fruit sample and add it to 5 mL of 0.1 mol L -1 Sodium phosphate buffer at pH 7.5 (containing 5 mmol L -1 DTT and 5% PVP) in an ice bath until homogenized, centrifuge at 4°C, 12000×g for 30 min, and collect the supernatant. Take 0.1 mL of the supernatant and 2.9 mL of 20 mmol L -1 The enzymatic reaction system was composed of H2O2 solution, and distilled water was used as a blank reference for zeroing. The absorbance value at 240nm when the enzymatic reaction system reacted for 15s was recorded and used as the initial value. Subsequently, the value was measured every 15s for a total of 10 times. The absorbance change value of the CAT enzymatic reaction system at a wavelength of 240nm per gram of fresh weight per minute was reduced by 0.01 as one CAT activity unit.

[0153] Determination of SOD activity: Accurately weigh 3 g of blueberry fruit sample in 5 mL of 0.1 mol L -1 Sodium phosphate buffer at pH 7.8 (containing 5 mmol L -1 DTT and 5% PVP) in an ice bath until homogenized, centrifuge at 4°C, 12000×g for 30 min, collect the supernatant, take 0.1 mL of the supernatant and add 1.7 mL of 50 mmol L -1pH 7.8 sodium phosphate buffer, 0.3 mL 130 mmol L -1 Methionine solution, 0.3 mL 750 μmol L -1 Nitroblue tetrazolium solution, 0.3 mL 100 μmol L -1 EDTA-2Na solution, 0.3mL 20μmol L -1 Riboflavin solution. In addition to the sample tube, two control tubes are set up, and the enzyme solution is replaced by sodium phosphate buffer in the control tubes. After the reaction solution is mixed, one of the control tubes is placed in the dark, and the rest are placed under a 4000lx fluorescent lamp for 15 minutes. After the reaction is completed, it is placed in the dark to terminate. The control tube in the dark is used as a blank reference and zeroed. The absorbance value of the remaining tubes is measured at 560nm and the amount of enzyme required to inhibit 50% of the photochemical reduction of nitroblue tetrazolium is taken as a SOD activity unit.

[0154] Determination of POD activity: Accurately weigh 3 g of blueberry fruit sample and add it to 5 mL of 0.1 mol L -1 Grind in an ice bath in pH 5.5 acetic acid-sodium acetate buffer (containing 1 mmol PEG, 4% PVP and 1% Triton X-100) until homogenized, centrifuge at 4°C, 12000×g for 30 min, and collect the supernatant. Take 0.5 mL of the supernatant, 3.0 mL of 25 mmol L -1 Guaiacol solution and 0.2 mL 0.5 mol L -1 The enzymatic reaction system was composed of H2O2 solution, and distilled water was used as a blank reference to adjust the zero value. The absorbance value of the enzymatic reaction system at 470nm after 15s of reaction was recorded and used as the initial value. Subsequently, the value was measured every 30s for a total of 10 times. The absorbance value change of the POD enzymatic reaction system at a wavelength of 470nm per gram of fresh weight per minute increased by 1 hour as one POD activity unit.

[0155] Determination of APX activity: Accurately weigh 3 g of blueberry fruit sample and add it to 5 mL of 0.1 mol L -1 pH 7.5 potassium phosphate buffer (containing 0.1 mmol L-1 EDTA, 2% PVPP and 1 mmol L -1 Ascorbic acid) in an ice bath until homogenized, centrifuge at 4°C, 12000×g for 30 min, and collect the supernatant. Take 0.1 mL of the supernatant and 2.6 mL of 50 mmol L -1 pH 7.5 potassium phosphate buffer (containing 0.1 mmol L -1 EDTA and 0.5 mmol L -1 Ascorbic acid) and 0.3mL2mmolL -1The enzymatic reaction system was composed of H2O2 solution, and distilled water was used as the blank reference for zeroing. The absorbance value at 290nm after 15s of reaction of the enzymatic reaction system was recorded as the initial value, and then it was measured every 30s for a total of 10 times. The absorbance value per gram of fresh weight per minute decreased by 0.01 as one APX activity unit.

[0156] Catalase, abbreviated as CAT, is an extremely important antioxidant enzyme in plants. It removes H2O2 in plant cells, thereby maintaining the stability of the cell membrane. Fig.17 A It can be seen that the CAT activity of the pre-harvest and post-harvest treatment groups of strain K221011F1 showed a trend of first increasing and then decreasing, and the CAT activity during the storage period after inoculation was higher than that of the control group.

[0157] SOD is superoxide dismutase, which can scavenge superoxide free radicals and work synergistically with enzymes such as CAT and POD to reduce the damage of free radicals to organisms. During the entire storage period of 0 to 5 days after inoculation, the SOD activity of the pre-harvest and post-harvest treatment groups of strain K221011F1 showed a trend of first decreasing, then increasing, and then decreasing, but was generally higher than the control group ( Fig.17 B).

[0158] POD is an oxidoreductase that is extremely important in plants. It can remove reactive oxygen species, thereby delaying fruit senescence and enhancing the defense ability of plant fruits. During the entire storage period after inoculation, the pre-harvest and post-harvest treatment groups of strain K221011F1 were higher than those of the control group ( Fig.17 C), and on the 2nd and 3rd day after inoculation, there were significant differences between the pre-harvest and post-harvest treatment groups of strain K221011F1 and the control group (P<0.05). This indicates that the pre-harvest and post-harvest treatment of strain K221011F1 can play a role in maintaining and inducing the POD activity of blueberry fruit, thereby enhancing the disease resistance of blueberry fruit.

[0159] APX is an important component of the ascorbic acid-glutathione circulation system in plants. When APX activity increases, the disease resistance of plants is further enhanced. From the first day after inoculation, the APX activity of the pre-harvest and post-harvest treatment groups of strain K221011F1 was higher than that of the control group. Among them, there were significant differences in APX activity between the pre-harvest and post-harvest treatment groups of strain K221011F1 and the control group from 1 to 3 days after inoculation (P<0.05). Fig.17 D, indicating that strain K221011F1 plays a role in maintaining and inducing the APX activity of blueberry fruit both before and after harvest, thereby slowing down the senescence of blueberry fruit and preventing the blueberry fruit from rotting.

[0160] (2) Dekkera brusselsii K221011F1 enhances the disease resistance of fruit

[0161] The activities of blueberry fruit pathogenesis-related proteins PAL and CHI were determined using the kit MM-37046O2 (ELISA, Jiangsu, China).

[0162] PAL is closely related to the plant's resistance to stress and disease, and plays an important role in the normal development of plants and in the process of resisting pathogens. The PAL activity of blueberry fruit in the control group and the pre-harvest and post-harvest treatment groups of strain K221011F1 maintained a trend of first decreasing and then increasing. The PAL activity of blueberry fruit in the pre-harvest and post-harvest treatment groups of strain K221011F1 was higher than that in the control group, and the PAL activity of the post-harvest treatment group of strain K221011F1 was higher than that of the pre-harvest treatment group on the 1st, 3rd, 4th and 5th day. Fig.18 A). This indicates that postharvest treatment of strain K221011F1 can induce an increase in PAL activity and improve blueberry disease resistance.

[0163] GLU is an important pathogenesis-related protein in plants to resist infection by pathogens. The trend of GLU activity in blueberry fruits in the control group and the pre-harvest and post-harvest treatment groups of strain K221011F1 was first increased and then decreased. Among them, the GLU activity of the pre-harvest treatment group of strain K221011F1 was significantly different from that of the control group only on the 3rd day (P<0.05), but the GLU activity of the post-harvest treatment group of strain K221011F1 was different from that of the control group throughout the storage period and was higher than that of the pre-harvest treatment group ( Fig.18 B). This indicates that postharvest treatment of strain K221011F1 induced an increase in GLU activity and improved the disease resistance of blueberry.

[0164] Example 8 Effect of using Dekkera brusselsii K221011F1 in red yeast rice wine fermentation products

[0165] Red yeast rice wine has significant pharmacological activities such as regulating blood lipids, anti-fatigue, maintaining cardiovascular and anti-oxidation. This example will study the application effect of adding Dekkera brusselsii K221011F1 to red yeast rice wine fermentation products from the physical and chemical indicators of wine samples, such as alcohol content, reducing sugar, total acid, pH and pigment content.

[0166] Grouping: The red yeast rice wine obtained by fermenting yellow yeast rice and the red yeast rice strain isolated in the laboratory in the early stage was used as the control group; the red yeast rice wine obtained by adding brussels yeast K221011F1 for enhanced fermentation was used as the treatment group.

[0167] 1. Red yeast rice wine brewing process

[0168] (1) Washing rice: Weigh 20 g (accurate to 0.01 g) of high-quality indica rice into a 250 mL conical flask and wash with clean water until the water is no longer turbid;

[0169] (2) Soaking: Add 40 mL of water to a triangular flask containing indica rice and soak for 24 to 48 hours to allow the rice to fully absorb water until there is no white center in the rice grains;

[0170] (3) Steaming: Wash and drain the rice and sterilize it at 115°C for 20 minutes. The cooked rice grains should be transparent but not mushy, and cooked but not sticky.

[0171] (4) Cooling: Shake the flask to keep the rice grains loose, place it in a clean bench and cool it to room temperature. If necessary, use a sterilized glass rod to loosen the rice clumps.

[0172] (5) Inoculation and culture: After the rice has cooled to room temperature in a clean bench, add 1:2 room temperature sterile steam

[0173] Distilled water, 10% red yeast rice, 0.72% medium-temperature saccharifying enzyme, 0.2% yeast solution, sealed and wrapped, placed in a 30℃ constant temperature biochemical incubator for 7 days. Shake the wine every 24 hours or so;

[0174] (6) Filtering and decocting: The fermented wine is squeezed and filtered through 4 layers of gauze and heated in 80°C water.

[0175] In a bath pot, boil the wine for about 15 minutes. After it has completely settled, transfer it to a sterile liquid storage bottle, seal it, and store it at low temperature.

[0176] 2. Detection of physical and chemical indicators of wine samples

[0177] According to GB / T 13662-2018 Yellow Wine, the alcohol content and total acid content in the wine samples were tested; reducing sugar was determined by 3,5-dinitrosalicylic acid (DNS) colorimetric method.

[0178] Analysis of the results of the physical and chemical indicators of red yeast rice wine:

[0179] After the fermentation, the reducing sugar content in the treatment group was slightly lower than that in the control group, because Dekkera brusselsii K221011F1 used some reducing sugar for growth metabolism. The alcohol content of red yeast wine in the treatment group was 0.17% vol higher than that in the control group, and Dekkera brusselsii produced a small amount of alcohol during its growth. There was no significant difference in reducing sugar and alcohol content between the two groups (P>0.05), indicating that the addition of Dekkera brusselsii K221011F1 had no significant effect on the fermentation efficiency and alcohol yield of red yeast wine brewing.

[0180] Total acid and pH are two key indicators for evaluating the sensory quality of wine, which significantly affect the perception of its structure and balance. The total acid in the treatment group was 0.63% lower than that in the control group. In the late fermentation period, some of the acid in the wine reacted with the alcohol produced during the fermentation process, causing the pH value to increase. This indicates that mixed fermentation with Dekker's yeast K221011F1 is beneficial to reducing the total acid in the wine and making the red yeast wine taste better. Fig.19 The appearance of red yeast rice wine after fermentation.

[0181] Table 8 Comparison of physical and chemical indicators of two groups of red yeast rice wine after fermentation

[0182]

[0183] Example 9 Effect of Dekkera bruxellensis K221011F1 on the content of total flavonoids in brewed tangerine peel liquid

[0184] Tangerine peel has multiple characteristics of being both a medicine and a food, and has the effects of relieving asthma and relieving cough, anti-oxidation, and anti-tumor. Generally, consumers obtain the flavonoid active substances therein by brewing tangerine peel. The tangerine peel is fermented with the strain of the present invention, and the fermented tangerine peel is brewed and compared with the unfermented tangerine peel, and the influence of fermentation on the content of functional substances in the tangerine peel brewing liquid is observed.

[0185] The method of fermenting tangerine peel is as follows: 5g tangerine peel is weighed and placed in a fermentation tank, rinsed with clean water for 3-4 times, then drained, sterilized at 115°C for 20 minutes, cooled to room temperature, added with 15% K221011F1 bacterial suspension, placed in a fermentation tank, sealed and stored, cultured in a 30°C constant temperature incubator for 7 days, shaken once every 12 hours, and then dried at 50°C for 4 hours to obtain fermented tangerine peel.

[0186] Take 1.5g of fermented tangerine peel and unfermented tangerine peel respectively, add 13.5mL of room temperature purified water for brewing, and compare the color of the brewing liquid and its total flavonoid content after brewing for 10 minutes.

[0187] Total flavonoids determination method: Take 1 mL of fermented tangerine peel and unfermented tangerine peel infusion, add 5 mL of 70% ethanol, water bath for 1 hour, centrifuge at 8000r for 5 minutes, and collect the supernatant. Measure 0.5 mL of the test solution, add 1 mL of 5% NaNO2, shake well, and let stand for 6 minutes. Add 1 mL of 10% Al(NO3)3, shake well, and let stand for 6 minutes. Finally, add 5 mL of 4% NaOH, make up to volume with 70% ethanol, shake well, and let stand for 15 minutes. Measure its absorbance at a wavelength of 510 nm and calculate the total flavonoids content in mg / mL.

[0188] Fig. 20This is the cold-brewed morphology of tangerine peel after fermentation. The color of the treatment group is darker than that of the control group. The main bioactive substances in tangerine peel are flavonoids, so this study detected the total flavonoid content in tangerine peel fermented by yeast. The total flavonoid content in unfermented tangerine peel is 3.038 mg / mL, and the total flavonoid content in fermented tangerine peel is 4.925 mg / mL, which is 62.11% higher than that in unfermented tangerine peel. It can be seen that after fermenting tangerine peel with this strain, more total flavonoids can be dissolved in water and the color is also darker.

[0189] Example 10 Toxicity test of Dekkera bruxellensis K221011F1 in mice

[0190] Test method:

[0191] The experiment was conducted in accordance with the national food safety standard (GB15193.3-2014) and the limit (GB15193.3-2014). 24 ICR (CD-1) mice, half male and half female, were selected and used for the experiment after adaptive feeding for 1 week. During the period, the mice were free to eat and drink, the ambient temperature was 20℃~26℃, the relative humidity was 40%~60%, and the day and night cycle was 12h / 12h. The mice in the control group were orally gavaged with normal saline at a dose of 0.2mL / mouse; the mice in the experimental group were gavaged with the corresponding bacterial solution at a dose of 0.2mL / mouse, and the gavage was observed once for 7d. After the start of the experiment, the feed was fed on time every day, the bedding was changed, and the weight changes were recorded 1d before gavage and 7d after gavage. The health status, mental state, excretion status, respiration, and poisoning or death of the mice were observed every day.

[0192] The mice in each group were weighed and blood was collected from their eyeballs. After being killed, the hearts, livers, spleens, lungs and kidneys of the mice in each group were taken. The blood on the surface of each organ was wiped off with filter paper, and the conditions of each organ were weighed and recorded. The calculation formula is as follows: Organ index = organ weight (g) / body weight (g) × 100%

[0193] In addition, routine blood tests and liver function tests (ALT and AST tests) were also performed.

[0194] result:

[0195] (1) The results of the mouse status during the observation period are as follows:

[0196] During the observation period, rats gavaged with strain K221011F1 showed no adverse reactions, and no mice died within 7 days. Compared with the control group, the health, mental, excretion and respiratory conditions of the mice in the treatment group were normal within 7 days.

[0197] (2) Results of mouse organ indexes:

[0198] The results of the one-way ANOVA analysis of the organ indexes showed no significant differences compared with the control group. The above results showed that strain K221011F1 had no toxicity to the heart, liver, spleen, lung, kidney and pancreas of mice. The specific results are shown in Table 9.

[0199] Table 9 Mouse organ index test results

[0200]

[0201] Note: The data in the table are mean ± standard deviation (n = 3). P>0.05, compared with the control group, there was no significant difference in the organ indexes of mice in each treatment group.

[0202] (3) Routine blood test results of mice:

[0203] The results of the routine blood test of mice are shown in Table 10. All values ​​were within the normal range, indicating that the bacterial solution had no significant effect on the number of immune cells in the blood of mice, no infection occurred, and no inflammatory response was induced.

[0204] Table 10 Results of blood routine test in mice

[0205]

[0206] Note: The data in the table are mean ± standard deviation (n = 3). P>0.05, compared with the control group, there was no significant difference in the organ indexes of mice in each treatment group.

[0207] The normal range of the number of white blood cells in mouse blood is 0.8 to 6.8 × 10 9 / L, the normal range of lymphocyte count is 0.7~5.7×10 9 The normal reference range of monocyte count is 0 to 0.3×10 9 / L, the normal reference range of neutrophil count is 0.1~1.8×10 9 / L

[0208] (4) ALT and AST test results:

[0209] Alanine aminotransferase (ALT), also known as alanine aminotransferase, is present in various tissues and cells in the body, especially in liver cells. Aspartate aminotransferase (AST), also known as aspartate aminotransferase, is mainly distributed in the myocardium, liver, kidney and other tissues in the body. Under normal circumstances, the concentrations of ALT and AST in the blood are very low. When the liver cells are damaged by inflammation, poisoning, necrosis and other phenomena, the permeability of the cell membrane increases, and ALT and AST can be released through the damaged liver cells, causing ALT and AST activity to increase rapidly. Therefore, ALT and AST are the most sensitive markers for liver function testing. Studies have shown that the range of ALT activity in normal mouse serum varies from 10-100U / L; and the range of AST activity in normal mouse serum varies from 20-150U / L.

[0210] In this experiment, the serum ALT activity of mice in the control group was 36.874±5.163U / L, and the serum AST activity was 62.705±8.785U / L. The serum ALT activity of mice in the treatment group was 38.894±3.981U / L, and the serum AST activity was 67.265±9.896U / L, which was consistent with the serum ALT and AST activities of normal mice. The results showed that the K221011F1 strain had no toxic effect on the liver function of mice.

[0211] The above results show that the acute oral toxicity of the candidate strain K221011F1 is at the "non-toxic" level, and it has no toxic effects on the condition, organs, blood routine, and liver function of mice, further indicating that the K221011F1 strain is safe and non-toxic, providing a theoretical basis for the application of K221011F1 and promoting the subsequent application of the K221011F1 strain.

Claims

1. A strain of Dekkera bruxellensis K221011F1, with a deposit number of CCTCC No: M2024251.

2. A microbial agent, characterized in that: The invention comprises the Dekkera brucellae K221011F1 and / or its metabolites as described in claim 1.

3. The microbial agent according to claim 2, characterized in that: The microbial preparation is a liquid or solid preparation.

4. A composition, characterized in that The composition comprises the Dekkera bruxellensis K221011F1 as claimed in claim 1 , or comprises the microbial agent as claimed in claim 2 or 3 .

5. The composition according to claim 4, characterized in that The composition is a food or pharmaceutical composition, which comprises the Dekkera bruxellensis K221011F1 as claimed in claim 1, or comprises the microbial agent as claimed in claim 2 or 3, and a carrier acceptable to food or medicine.

6. Use of Dekkera bruxellensis K221011F1 according to claim 1, the microbial agent according to claim 2, and the composition according to claim 4 in preventing and controlling fruit and vegetable rot; preferably, the pathogenic bacteria of the fruit and vegetable rot are Alternaria tenuissma, Alternaria dumosa, Botrytis fabiopsis, Botrytis cinerea, Penicillium rubens, Penicillium chermesinum, Pestalotiopsis clavispora, Fusarium oxysporum or Colletotrichum nymphaeae.

7. Use of Dekkera bruxellensis K221011F1 according to claim 6, the microbial agent according to claim 2, and the composition according to claim 4 in the preparation of drugs for preventing and treating fruit and vegetable rot.

8. Use of Dekkera bruxellensis K221011F1 according to claim 1, the microbial agent according to claim 2, and the composition according to claim 4 in the preservation of fruits and vegetables; preferably, use in the preparation of a fruit and vegetable preservative.

9. Use of Dekkera bruxellensis K221011F1 according to claim 1, the microbial agent according to claim 2, and the composition according to claim 4 in increasing the content of functional substances in post-harvest fruits and vegetables, wherein the functional substances include flavonoids and anthocyanins; or in improving the stress resistance of post-harvest fruits and vegetables, including increasing CAT activity, SOD activity, POD activity, APX activity, PAL activity or GLU activity.

10. Use of Dekkera bruxellensis K221011F1 according to claim 1, the microbial agent according to claim 2, and the composition according to claim 4 in the preparation of fermented food; preferably, use in the fermentation of red yeast rice wine, or use in fermenting tangerine peel to increase the total flavonoids content.

Images