Pseudomonas 1504IPR-06 and application thereof

Abstract

The invention relates to the technical field of microbiology and plant growth-promoting bacteria, in particular to pseudomonas 1504IPR-06 and application thereof. The pseudomonas 1504IPR-06 provided by the invention is separated from peanut rhizosphere soil in a peanut and corn intercropping system, is gram-negative bacteria, is free of spores, has strong capacities of producing siderophores, secreting auxin and releasing insoluble phosphorus and potassium, can convert insoluble mineral nutrients such as iron, phosphorus and potassium in the soil into effective nutrients, and can be used for preventing and controlling the growth of the soil. Meanwhile, nodulation and nitrogen fixation of the peanuts can be promoted, absorption of plants to various nutrient elements is promoted, particularly, the bacillus subtilis can be successfully colonized in rhizosphere soil of the peanuts, the photosynthetic capacity of the peanuts is improved, growth is promoted, and the bacillus subtilis has great application potential.

Description

Technical Field

[0001] The invention relates to the technical field of microbiology and plant growth-promoting bacteria, and in particular to Pseudomonas 1504IPR-06 and applications thereof. Background Art

[0002] Peanut is one of the main edible oil crops, an important raw material for the food and oil processing industries, and a high-quality substitute for margarine and olive oil. Plant growth requires various mineral elements to participate in important metabolic activities in the body. The physiological metabolic processes of plants such as photosynthesis, respiration, and DNA synthesis all require the participation of mineral elements. However, most of the mineral elements in the soil exist in a sparingly soluble form with low biological effectiveness, especially in calcareous soils, where the content of soluble mineral nutrients is extremely low. Therefore, plants growing on calcareous soils are prone to symptoms of deficiency that affects photosynthesis, thereby inhibiting growth and yield (nitrogen deficiency, phosphorus deficiency, potassium deficiency, and iron deficiency).

[0003] At present, the main methods of improving peanut nutrition are breeding high-efficiency varieties or applying chemical fertilizers. However, the breeding cycle is long, chemical fertilizers are prone to environmental pollution and have poor fertilizer efficiency. In agricultural production, although the use of chemical fertilizers has increased crop yields, it has also released a large amount of harmful substances into the environment, polluting the soil, water sources and food itself, posing a great threat to human health and the living environment. Therefore, in order to meet the needs of green agriculture and sustainable agricultural development, it is imperative to develop and utilize new fertilizer sources to replace chemical fertilizers.

[0004] In view of this, the present invention is proposed. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a Pseudomonas capable of activating soil mineral nutrients and improving plant nutrition and its application.

[0006] Specifically, the technical solution of the present invention is as follows: In a first aspect, the present invention provides a Pseudomonas ( Pseudomonas sp. )1504IPR-06, its deposit number is CGMCC NO. 32810.

[0007] In a second aspect, the present invention provides a bacterial agent containing the Pseudomonas 1504IPR-06.

[0008] Preferably, the bacterial agent is a plant growth-promoting bacterial agent, a plant lateral root growth-promoting agent or a plant mineral nutrition improving agent.

[0009] Preferably, the bacterial agent contains an effective viable count of Pseudomonas 1504IPR-06 of not less than 1×10 9 CFU / mL.

[0010] In a third aspect, the present invention provides a fermentation product, which is obtained by fermenting the Pseudomonas 1504IPR-06 or the bacterial agent.

[0011] In a fourth aspect, the present invention provides a fertilizer or a fertilizer additive, the main active ingredient of which is the Pseudomonas 1504IPR-06 and / or the fermentation product.

[0012] In a fifth aspect, the present invention provides the use of the Pseudomonas 1504IPR-06, the bacterial agent, the fermentation product, or the fertilizer or fertilizer additive in promoting the conversion of insoluble iron in soil into soluble iron that can be effectively absorbed by plants.

[0013] In a sixth aspect, the present invention provides the use of the Pseudomonas 1504IPR-06, the bacterial agent, the fermentation product, or the fertilizer or fertilizer additive in promoting plant absorption of iron in soil.

[0014] In a seventh aspect, the present invention provides the use of the Pseudomonas 1504IPR-06, the bacterial agent, the fermentation product, or the fertilizer or fertilizer additive in promoting plant root development, promoting plant nutrient absorption capacity, or increasing plant dry weight and yield.

[0015] Preferably, the plant comprises peanut.

[0016] Beneficial effects: The present invention provides a Pseudomonas ( Pseudomonas sp. )1504IPR-06, and its deposit number is CGMCCNO. 32810. The Pseudomonas 1504IPR-06 provided by the present invention is a Gram-negative bacterium, has no spores, has a strong ability to produce iron carriers, secrete auxins, and release insoluble phosphorus and potassium. It can convert insoluble mineral nutrients such as iron, phosphorus, potassium, etc. in the soil into effective nutrients, and can promote peanut nodulation and nitrogen fixation, promote the absorption of various nutrients by plants, and can especially successfully colonize in the rhizosphere soil of peanuts, improve the photosynthetic capacity of peanuts and promote growth, and has a very large application potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the drawings required for use in the embodiments or the description of the prior art will be described below.

[0018] Figure 1 This is a graph showing the growth-promoting ability of Pseudomonas 1504IPR-06.

[0019] Figure 2 Diagram for the improved photosynthesis of Pseudomonas sp. 1504IPR-06.

[0020] Figure 3This is a diagram of mineral nutrients in rhizosphere soil activated by Pseudomonas sp. 1504IPR-06.

[0021] Figure 4 Figure 1 shows the improvement of nutrient absorption in peanut by Pseudomonas sp. 1504IPR-06. DETAILED DESCRIPTION

[0022] The use of rhizosphere beneficial bacteria to promote efficient absorption and utilization of plant nutrients has been a research hotspot in recent years. The development and application of bacterial resources of soil nutrient activation bacteria are the key to increasing peanut yield and improving peanut mineral nutrition. The present invention aims to provide a strain with multi-nutrient synergistic effect and strong growth-promoting function and its application. In an environment lacking mineral nutrients, microorganisms have formed a set of special mechanisms for activation, absorption and transportation of insoluble nutrients during the long-term evolution process to ensure the effective absorption of soluble nutrients. The application of soil nutrient activation bacteria can not only reduce the negative impact of plant deficiency, but also promote plant growth through direct or indirect effects. The present invention uses the intercropped peanut rhizosphere soil in the peanut-corn intercropping system as the screening raw material, resuspends the soil sample in sterile water and then cultures it on CAS solid culture medium, and selects strains with strong growth-promoting ability. After further screening and breeding, a Pseudomonas with efficient activation of soil mineral nutrients, improvement of plant nutrition and promotion of plant growth is finally obtained.

[0023] The Pseudomonas of the present invention was isolated from the rhizosphere soil of peanuts in the peanut-corn intercropping system and named 1504IPR-06 (hereinafter referred to as 1504IPR-06). The 16S rRNA gene sequence analysis showed that the strain 1504IPR-06 was a Pseudomonas ( Pseudomonas sp. The strain was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration (CGMCC, address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code 100101) on November 26, 2024, and was classified and named Pseudomonas ( Pseudomonas sp. ), the deposit number is CGMCC NO.32810.

[0024] The characteristics of the colony and bacteria of the 1504IPR-06 strain are: the colony is round, the center is convex, the color is light yellow, the edges are smooth and neat, and the bacteria are moist and translucent. The body morphology under microscope observation is rod-shaped, single-cell, Gram staining is negative, and there are no spores.

[0025] The physiological and biochemical characteristics of the 1504IPR-06 strain are: it can liquefy gelatin, hydrolyze starch, is catalase positive, catalase positive, can adapt to high temperature environment, but not to low temperature environment.

[0026] The present invention provides a bacterial agent containing the Pseudomonas 1504IPR-06 or its fermentation product. Preferably, the bacterial agent is a plant growth-promoting bacterial agent, a plant lateral root growth-promoting agent or a plant mineral nutrition improving agent. Preferably, the bacterial agent contains an effective live bacterial count of Pseudomonas 1504IPR-06 of not less than 1×10 9 CFU / mL.

[0027] Furthermore, the fermentation product obtained by fermenting the above-mentioned Pseudomonas 1504IPR-06 also falls within the protection scope of the present invention.

[0028] In an optional embodiment provided by the present invention, the medium used for fermentation is LB medium. Its composition is: 5g yeast extract; 10g peptone; 10g sodium oxide; distilled water is added to make up to 1000mL; 15-20g agar; pH=7.0, sterilized at 121°C for 20min; fermentation conditions are: temperature of 30°C, rotation speed of 150-200rpm.

[0029] The present invention experiments found that Pseudomonas 1504IPR-06 has the growth-promoting functions of high-yield iron carrier, phosphorus and potassium solubilization, and growth hormone production. It has the functions of improving the mineral nutrition of peanuts and promoting peanut production. The growth-promoting bacterial agent prepared by Pseudomonas 1504IPR-06 can promote the effectiveness of nutrients such as nitrogen, phosphorus, potassium, and iron in the rhizosphere soil of peanuts, promote root growth, improve the absorption capacity of nutrients such as nitrogen, phosphorus, potassium, and iron, and increase the dry weight of plants.

[0030] The invention also provides a biological fertilizer containing the Pseudomonas 1504IPR-06 or a fermentation product thereof.

[0031] Furthermore, the present invention provides the use of Pseudomonas 1504IPR-06 or its fermentation product or a bacterial agent or biofertilizer containing the same in promoting the conversion of insoluble nutrients in soil into soluble nutrients that can be effectively absorbed by plants.

[0032] Furthermore, the present invention provides the use of Pseudomonas 1504IPR-06 or its fermentation product or a bacterial agent or biofertilizer containing the same in promoting plant absorption of mineral nutrients in soil.

[0033] Furthermore, the present invention provides the use of Pseudomonas 1504IPR-06 or its fermentation product or bacterial agent or biofertilizer containing the same in producing auxin and promoting plant root development, promoting lateral root growth, increasing plant root absorption area, and promoting nutrient absorption capacity.

[0034] Furthermore, the present invention provides the use of Pseudomonas 1504IPR-06 or its fermentation product or a bacterial agent or biofertilizer containing the same in increasing the dry weight and yield of plants.

[0035] Furthermore, the present invention provides the use of Pseudomonas 1504IPR-06 or its fermentation product or a bacterial agent or biofertilizer containing the same in high-yield iron carrier, phosphorus solubilization and potassium solubilization.

[0036] Preferably, in the above application, the plant includes peanut. Those skilled in the art will appreciate that applying the 1504IPR-06 of the present invention to the growth of other crops also has similar growth-promoting effects as described above.

[0037] The present invention isolates a strain of Pseudomonas 1504IPR-06 from the rhizosphere soil of intercropped peanuts in a peanut-corn intercropping system. The strain has the growth-promoting functions of high-yield iron carrier, phosphorus and potassium solubilization, and growth factor production, and converts the insoluble mineral nutrients in the soil into soluble effective nutrients. Experiments have found that the Pseudomonas can promote the absorption of soil nutrients by peanuts, improve the nutrition of peanuts such as nitrogen, phosphorus, potassium, and iron, and improve the root development of peanuts and the aboveground biomass and other growth-promoting functions. The Pseudomonas 1504IPR-06 provided by the present invention is pollution-free and residue-free during the application process, and is biologically environmentally friendly, and is a growth-promoting strain with good application prospects in the field of plant growth promotion.

[0038] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0039] The endpoints and any values ​​of the ranges disclosed in this specification are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0040] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "specific implementations", or "some specific implementations" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the embodiment of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0041] In the examples provided in this specification, if no specific techniques or conditions are specified, the techniques or conditions described in the literature in this field or the product instructions are used. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased through regular channels.

[0042] Unless otherwise specified, the culture medium used in the following examples has the following formula: LB medium: 10 g of tryptone, 5 g of yeast extract, 10 g of sodium chloride, 15-20 g of agar, dilute to 1 L with distilled water, and adjust the pH to 7.0.

[0043] Standard succinate medium (SSM): succinate, 4 g L -1 ; K2HPO4, 6g·L -1 ; KH2PO4, 3g·L -1 ; NH4SO4, 1g·L -1 ;MgSO4, 0.2 g·L -1 , adjust the pH to 7.0 with KOH.

[0044] Preparation of CAS blue detection solution: Dissolve 0.079 chrome azural S (CAS) in 50 mL deionized water, and then add 10 mL 1 mmol / l FeCl3 solution (containing 10 mmol / L HCI) to obtain solution A; dissolve 0.069 hexadecyltrimethylammonium bromide (HDTMA) in 40 mL deionized water to obtain solution B; slowly add solution A into solution B along the wall of the beaker, and shake gently to mix solution A and solution B evenly to obtain CAS blue detection solution.

[0045] Example 1 This example illustrates the screening, separation and identification process of Pseudomonas 1504IPR-06.

[0046] 1. Screening and isolation of strains Pseudomonas 1504IPR-06 was isolated from the rhizosphere soil of intercropped peanuts in the peanut-corn intercropping system. The soil sample was resuspended in sterile water and cultured on CAS solid medium to select strains with strong growth-promoting ability. After further screening and breeding, the Pseudomonas was obtained and the purified bacteria were named 1504IPR-06.

[0047] 2. Determination of morphological, physiological and biochemical characteristics of strain 1504IPR-06 (1) The colony characteristics and bacterial morphology of strain 1504IPR-06 are: the colony is round, with a raised center, light yellow in color, smooth and neat edges, and the bacterial body is moist and translucent. Microscopic observation shows that the bacterial morphology is rod-shaped, single-celled, Gram-negative, and without spores.

[0048] (2) The physiological and biochemical characteristics of strain 1504IPR-06 are as follows: it can liquefy gelatin, hydrolyze starch, is catalase positive, is catalase positive, can adapt to high temperature environments, but cannot adapt to low temperature environments.

[0049] 3. 16S rDNA sequence determination and analysis of strain 1504IPR-06 The 16S rDNA sequence of the 1504IPR-06 strain was amplified by PCR to obtain the 16S rDNA sequence, which is as follows: 1504IPR-06 (5'-3'): TGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAAGGGCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCAACAGAATAAGCACCGGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAA AGCGCGCGTAGGTGGTTTGGTAAGATGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCCATAACTGCCTGACTAGAGTACGGTAGAGGGTGGTGGAATTTCCTGTGTAGCGGTGAAATGCGTAGATAGGAAGGAACACCAGTGGCGAAGGCGACCACCTGGACTGATACTGACACTGAGGTGCGAAAGCGTGGGGAGCAAACAGG (SEQ ID NO.1).

[0050] The 16S rDNA sequence was compared by BLAST, and the results showed that the similarity between 1504IPR-06 and several different strains of Pseudomonas was more than 98%. Combined with the morphology, culture characteristics and physiological and biochemical analysis results of the strain, the strain 1504IPR-06 was identified as Pseudomonas ( Pseudomonas sp. ).

[0051] The strain was deposited on November 26, 2024 at the General Microbiology Center of the China Microbiological Culture Collection Administration (CGMCC, address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, Postal Code 100101), and was classified and named Pseudomonas ( Pseudomonas sp. ), the deposit number is CGMCC No. 32810.

[0052] Example 2 In this example, the growth-promoting ability of Pseudomonas 1504IPR-06 was determined.

[0053] 1. Determination of iron carrier production capacity 1504IPR-06 was cultured in SSM medium at 28°C and 180 rpm for 2 days. After the culture, the culture medium was centrifuged at 9500 rpm for 25 min to remove the bacteria. The supernatant was mixed with CAS detection solution in a 1:1 ratio and the absorbance was measured at 630 nm. A standard curve was constructed using deferoxamine B (DFOB) to evaluate the relative production of siderophores.

[0054] 2. Determination of the ability to produce growth hormone A 1% bacterial suspension (OD600 = 0.8) was inoculated into 100 mL of 100 μg mL -1 The cells were cultured in LB medium containing L-tryptophan at 28°C and 180 rpm for 3 days. After the culture was completed, the cells were centrifuged at 9500 rpm for 25 min, and the supernatant was taken and an equal volume of Salkowski reagent (12 g L -1 FeCl3 was dissolved in 7.9M H2SO4). The mixture was allowed to stand in the dark for 30 min, and then its absorbance at 530 nm was measured. A standard curve was constructed using pure indole-3-acetic acid.

[0055] 3. Determination of phosphorus and potassium solubilization capacity 1% bacterial suspension (OD600 = 0.8) was inoculated into Pikovskaya medium (containing 0.5% tricalcium phosphate) and cultured at 28°C and 180 rpm for 3 days. The soluble phosphorus content in the culture supernatant was determined by inductively coupled plasma emission spectrometry.

[0056] 1% bacterial suspension (OD600 = 0.8) was added to the culture medium containing potassium feldspar and cultured at 28°C and 180 rpm for 3 days. Then 4 mL of H2O2 was added, the mixture was centrifuged at 4000 rpm for 5 min, and the supernatant was taken to measure the potassium concentration by flame photometer.

[0057] 4. Results The results showed that 1504IPR-06 has the ability to secrete a large amount of siderophore, produce indoleacetic acid (IAA), and release insoluble phosphorus and potassium (see Table 1). Therefore, 1504IPR-06 has the potential to promote plant growth and activate nutrients.

[0058] Table 1 Physiological and biochemical characteristics of 1504IPR-06

[0059] Example 3 This example studies the effect of Pseudomonas 1504IPR-06 on peanut growth and mineral nutrients The strain 1504IPR-06 of the present invention was cultured in LB liquid medium at 28°C until 1×10 9 cfu / mL, centrifuge at 5000 rpm for 10 min in a high-speed centrifuge, discard the supernatant, add an equal amount of sterilized 10 g / L NaCl distilled water solution to prepare a bacterial suspension for later use.

[0060] (1) Peanuts were transplanted in the greenhouse of the College of Resources and Environment of China Agricultural University in Beijing. The peanut variety used was Luhua 14. From the first week after thinning, bacterial solution was added every week at a rate of 20 mL / plant. The bacterial solution concentration in the bacterial addition treatment was 1×10 9 CFU / ml, and the control group was added with an equal amount of sterile saline solution of equal concentration. There were 8 pots in each treatment of the two groups, and 2 biological replicates in each pot. Samples were collected twice one month (seedling stage) and three months (full fruit stage) after peanut transplanting, and 4 pots of peanuts were harvested each time. SPAD values ​​of new and old leaves were measured with a SPAD instrument two days before the two samplings, and the net photosynthetic rate, stomatal conductance and transpiration rate of peanuts were measured with a photosynthetic meter two days before the sampling at the full fruit stage. After the two samplings, the total root length and root surface area of ​​peanuts were measured using a root sweeper, and the dry weight of peanuts was measured after the two samplings and drying.

[0061] (2) Determination of nutrient concentration in peanut plants: After crushing the aboveground part of the plant, take 0.1 g of the sample and place it in a digestion tube. Add 5 mL of concentrated H2SO4 and let it stand for 12 hours. Perform low-temperature digestion at 180°C for 0.5 hours, and then perform high-temperature digestion at 360°C for 1 hour. During the digestion process, add H2O2 dropwise until the sample becomes colorless. After cooling, add deionized water to a total volume of 50 mL. Use a continuous flow analyzer to determine the nitrogen content in the digestion solution, and calculate the nitrogen content of the aboveground part based on this.

[0062] The aboveground sample was weighed 0.3 g and 5 mL of concentrated HNO3 was added. The sample was placed in the dark for 12 h, and then 2 mL of 30% H2O2 was added. The sample was then microwave digested. After digestion was completed and cooled, deionized water was added to a total volume of 25 mL. The concentrations of phosphorus and potassium in the supernatant of the digestion solution were determined by inductively coupled plasma emission spectrometry, and the phosphorus and potassium contents of the aboveground were calculated based on this.

[0063] Take about 1g of fresh leaves and cut them into pieces, put them into a centrifuge tube filled with 10mL 1mol / L HCl, tighten the lid, and shake it with an oscillator for 5 hours. Then filter it with qualitative filter paper, collect the supernatant and store it in a refrigerator at -20℃. The iron concentration of the extract was determined by inductively coupled plasma emission spectrometry.

[0064] (3) Determination of soil effective nutrients: The rhizosphere soil samples were air-dried and passed through a 2 mm sieve.

[0065] 5 g of soil sample was mixed with 25 mL of 1 M KCl and shaken at 180 rpm for 2 h. Then, the concentrations of ammonium nitrogen and nitrate nitrogen in the soil were determined and calculated by spectrophotometry.

[0066] 5 g of soil sample was mixed with 50 mL of Mehlich 3 (M3) extract and shaken at 180 rpm for 5 min. The mixture was filtered through filter paper and 10 mL of the filtrate was diluted to 50 mL. Subsequently, the effective concentrations of iron, phosphorus and potassium in the dilution were determined using inductively coupled plasma emission spectrometry.

[0067] The results are as follows Figure 1-4 shown.

[0068] Figure 1The data showed that the aboveground dry weight of peanut plants treated with 1504IPR-06 increased significantly by 44.8% and 23.7% after 30 days and 100 days, respectively, compared with the control group. A significant increase in root dry weight was also observed in the 1504IPR-06 treatment 30 days after sowing. In addition, the root-to-shoot ratio of peanuts inoculated with 1504IPR-06 was slightly reduced compared with the CK treatment. 1504IPR-06 significantly increased the total root length by 83% 30 days after sowing. There was also a slight increase in the root surface area of ​​the 1504IPR-06 irrigation treatment 30 days after sowing compared with the control group. Therefore, 1504IPR-06 significantly promoted the growth of the aboveground part of peanuts and the development of the root system.

[0069] Figure 2 The data showed that 100 days after sowing, the application of 1504IPR-06 significantly increased the SPAD values ​​of new leaves and mature leaves by 11.8% and 15.4%, respectively. In addition, 100 days after sowing, the 1504IPR-06 treatment increased the net photosynthetic rate, stomatal conductance and transpiration rate of new leaves by 86.9%, 54.9% and 48.4%, respectively, and the net photosynthetic rate, stomatal conductance and transpiration rate of mature leaves by 46.3%, 51.7% and 81.9%, respectively. Therefore, the inoculation of 1504IPR-06 significantly promoted the photosynthesis of peanut leaves.

[0070] Figure 3 The data showed that 1504IPR-06 promoted the availability of mineral nutrients in the rhizosphere. The 1504IPR-06 treatment significantly increased the contents of nitrate, ammonium nitrogen, Olsen-phosphorus, available potassium, and available iron in the soil by 46%, 31.3%, 63.2%, 41.3%, and 19.7%, respectively, 100 days after sowing.

[0071] Figure 4 The data showed that 1504IPR-06 increased the nitrogen, phosphorus and potassium concentrations in the aboveground part of peanuts by 19.5%, 18.4% and 57.5% respectively 100 days after sowing. It is worth noting that 1504IPR-06 changed the proportion of macronutrients in the aboveground part compared with the control 100 days after sowing, specifically increasing the proportion of potassium and reducing the proportion of nitrogen. In addition, the concentration of active iron in the new leaves of peanuts treated with 1504IPR-06 also increased by 55% 100 days after sowing. At the same time, inoculation with 1504IPR-06 also increased the number and weight of nodules. Therefore, the application of 1504IPR-06 improved the content of mineral nutrients and promoted the formation of nodules.

[0072] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Pseudomonas ( Pseudomonas sp. )1504IPR-06, its deposit number is CGMCC NO. 32810.

2. A bacterial agent containing the Pseudomonas 1504IPR-06 according to claim 1.

3. The bacterial agent according to claim 2, characterized in that: The invention is a plant growth-promoting bacterial agent, a plant lateral root growth-promoting agent or a plant mineral nutrition improving agent.

4. The bacterial agent according to claim 2 or 3, characterized in that: The effective viable count of Pseudomonas 1504IPR-06 is not less than 1×10 9 CFU / mL.

5. A fermentation product, characterized in that It is obtained by fermenting the Pseudomonas 1504IPR-06 described in claim 1 or the bacterial agent described in any one of claims 2-4.

6. A fertilizer or a fertilizer additive, characterized in that The main active ingredient is the Pseudomonas 1504IPR-06 described in claim 1 and / or the fermentation product described in claim 5.

7. Use of the Pseudomonas 1504IPR-06 of claim 1, the bacterial agent of any one of claims 2 to 4, the fermentation product of claim 5, or the fertilizer or fertilizer additive of claim 6 in promoting the conversion of insoluble iron in soil into soluble iron that can be effectively absorbed by plants.

8. Use of the Pseudomonas 1504IPR-06 of claim 1, the bacterial agent of any one of claims 2 to 4, the fermentation product of claim 5, or the fertilizer or fertilizer additive of claim 6 in promoting plant absorption of iron in soil.

9. Use of the Pseudomonas 1504IPR-06 of claim 1, the bacterial agent of any one of claims 2 to 4, the fermentation product of claim 5, or the fertilizer or fertilizer additive of claim 6 in promoting plant root development, promoting plant nutrient absorption capacity, or increasing plant dry weight and yield.

10. The use according to claim 8 or 9, characterized in that: The plants include peanuts.

Images