Streptomyces 891-dc with high production of aureusidin a and its use

Abstract

The application discloses streptomyces 891-DC with high aurovertin A yield and application thereof. The application uses CRISPR-Cas9 technology to first change an incomplete attB site sequence in the genome of streptomyces 891 into a complete attB site sequence, promote a plasmid containing a target gene chry, an integrase phiC31 gene and an attP site, and improve the integration rate of the target gene through specific combination of the attP site and the attB site on the genome. Secondly, a promoter capable of obviously improving the yield is screened to express the aurovertin biosynthesis gene cluster, so that the more stable and higher-yield streptomyces 891-DC is obtained. The aurovertin A shake flask fermentation yield is 1411.23+ / -29 mg / L, which is 60% higher than that of the original strain, and the genetic stability is good, thereby laying a technical foundation for industrial production of aurovertin.

Description

(I) Technical Field

[0001] This invention belongs to the field of microbial pharmaceuticals and relates to a Streptomyces strain 891-DC that produces a high amount of chlortetracycline A and its applications. (II) Background Technology

[0002] Aureomycin A, discovered in 1955, is a glycoside compound with a benzonaphthylpyranone structure. Aureomycin A exhibits potent antibiotic, antitumor, antituberculosis, and anti-neuroinflammatory activities. It effectively inhibits the proliferation, viability, migration, and invasion of U251 and U87-MG glioblastoma cells via the Akt / GSK-3β / β-catenin pathway. Furthermore, aureomycin A is a rapid bactericidal agent with high activity against persistent Staphylococcus aureus, demonstrating strong biofilm clearance in vitro and maintaining sustained bactericidal efficacy in vivo. Therefore, as a lead compound, aureomycin A has great potential for application in the pharmaceutical industry, and an increasing number of chemists, biologists, and pharmacologists are paying attention to aureomycin-like substances. In recent years, significant progress has been made in the development of aureomycin A derived from the marine sediment strain Streptomyces sp. 891 as a potential therapeutic agent through improvements in production conditions and preparation techniques. However, existing aureomycin production processes mainly rely on fermentation production using naturally isolated wild-type Streptomyces strains. But these natural strains usually have the following problems: the antibiotic yield of natural strains is generally low, which limits their application in large-scale industrial production; traditional random mutagenesis breeding methods are difficult to significantly increase the yield of strains in a short period of time and the obtained mutant strains are not stable enough; due to changes in natural conditions and culture medium composition, the yield of metabolites of natural strains may fluctuate.

[0003] In recent years, with the development of synthetic biology and genetic engineering technologies, increasing antibiotic production through genetic engineering has become a new research hotspot. In this regard, target gene cluster duplication is an effective strategy. By introducing additional antibiotic biosynthetic gene clusters into the host bacteria, the synthesis efficiency of the target product can be significantly improved. Simultaneously, it can be combined with other strategies to further increase antibiotic production, such as overexpressing positive regulators or knocking out negative regulators, replacing promoters with different strengths, increasing precursor supply, knocking out non-target gene clusters, eliminating byproducts, multiple copies of gene clusters, and chassis modification.

[0004] Therefore, constructing engineered strains that produce high levels of chlortetracycline A can provide strong support for industrial production. (III) Summary of the Invention

[0005] The purpose of this invention is to provide a high-yield Streptomyces 891-DC strain of chlortetracycline A and its applications. This invention employs a gene cluster duplication engineering strategy. By pre-inserting a specific attB site into the original strain Streptomyces 891, and then, under the action of integrase and a specific promoter, the chlortetracycline biosynthesis gene cluster is integrated into the genome of the original strain, successfully achieving stable duplication of the chlortetracycline gene cluster in Streptomyces. This engineered strain can significantly increase the yield of chlortetracycline A, providing strong support for its application in industrial production.

[0006] The technical solution adopted in this invention is:

[0007] This invention provides a Streptomyces sp. 891-DC that produces a high amount of chlortetracycline A, which is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO:M 20241963, deposit date September 13, 2024, and address Wuhan University, Wuhan, China, 430072, China.

[0008] The Streptomyces 891-DC strain described in this invention is constructed by introducing the chlortetracycline biosynthesis gene cluster into Streptomyces 891 strain pre-inserted at a specific attB site under the action of a specific promoter. The specific steps are as follows:

[0009] (1) Using CRISPR-Cas9 gene editing technology, the cluster 22, which is the same type of gene cluster as the chlortetracycline biosynthesis gene cluster in Streptomyces 891, was knocked out and an attB site was inserted in situ to construct the plasmid vector pCRI-22 containing the attB sequence. The nucleotide sequence of the cluster 22, which is the same type of gene cluster as the chlortetracycline biosynthesis gene cluster, is shown as 6857070-6865015bp in NCBI Seq:CP050693.1; the nucleotide sequence of the attB site is shown as SEQ ID NO.4.

[0010] (2) The promoter gapdh was added before the chrysanthemum biosynthesis gene cluster using Redαβ homologous recombination technology to obtain the recombinant plasmid p15A-chry-gapdh-phiC31; the nucleotide sequence of the promoter gapdh is shown in SEQ ID NO.1 from 41 to 325 bp.

[0011] (3) The plasmid obtained in step (1) was introduced into E. coli ET12567 / pUZ8002 by electroporation;

[0012] (4) The plasmid extracted in step (3) was introduced into the genome of Streptomyces 891 by conjugation transfer to obtain an engineered strain containing an attB site;

[0013] (5) Under the action of integrase, the plasmid in step (2) is introduced into the genome of the engineered strain containing an attB site in step (4) through conjugation transfer to obtain the chloramphenicol gene cluster multiplication engineered strain 891-DC.

[0014] The present invention also provides the application of the Streptomyces 891-DC in the production of chlortetracycline A. The method of application is as follows: the Streptomyces 891-DC is inoculated into a fermentation medium and cultured at 28°C and 220 rpm for at least 13 days to obtain a fermentation broth containing chlortetracycline A; the composition of the fermentation medium is: 5.0 g / L starch, 20.0 g / L glucose, 10.0 g / L soybean flour, 2.0 g / L calcium carbonate, and natural pH.

[0015] Furthermore, before inoculating the Streptomyces 891-DC into the fermentation medium, a seed culture was first carried out. Then, the seed culture was inoculated into the fermentation medium at a volume concentration of 5%. The seed culture step was as follows: Streptomyces 891-DC was inoculated into MS agar medium containing 50 μg / mL apramycin and activated at 28°C for 5-6 days. Then, it was inoculated into ISP2 liquid medium containing 50 μg / mL apramycin and cultured at 28°C and 220 rpm for 48-72 hours to obtain the seed culture.

[0016] The MS agar medium consisted of 20.0 g / L mannitol, 25.0 g / L cooked soybean flour, 20.0 g / L agar, and natural pH; the ISP2 liquid medium consisted of 4.0 g / L glucose, 4.0 g / L yeast extract, 10 g / L malt extract, and natural pH.

[0017] This invention first transforms the incomplete attB site sequence (GTGCCGGGGCGGCCCTTGG) in the Streptomyces 891 genome into a complete attB site sequence (GTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCG), promoting the integration of the target gene into plasmids containing the target gene chry, the integrase phiC31 gene, and the attP site. This is achieved by specifically binding the attP site to the attB site on the genome, thereby increasing the integration rate of the target gene. Secondly, by screening for promoters that significantly increase yield, the expression of the chlortetracycline biosynthesis gene cluster is carried out to obtain a more stable and higher-yielding Streptomyces 891-DC.

[0018] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0019] This invention constructs a high-yield aureomycin A-producing Streptomyces 891-DC by modifying the original Streptomyces 891 strain to add a specific attB site and a strong promoter. This strain has good genetic stability and the plasmid is not lost after multiple generations.

[0020] This invention utilizes Streptomyces 891-DC to produce chlortetracycline A through fermentation. The operation is simple, and the yield of chlortetracycline A is as high as 1411.79±29.8 mg / L, which is 60% higher than that of the original strain.

[0021] The Streptomyces 891-DC provided by this invention can be applied to the industrial production of chlortetracycline A, providing an effective technical means to improve the fermentation potency of other antibiotics. (iv) Description of the attached drawings

[0022] Figure 1 Gel electrophoresis images of PCR products from plasmids p15A-chry-gapdh-phiC31 and p15A-chry-gapdh-cml-ccdb-phiC31. M: 2000 DNA marker. Lanes 1-2: PCR products using the successfully constructed plasmids p15A-chry-gapdh-cml-ccdb-phiC31 and p15A-chry-gapdh-phiC31 as templates and T-gapdh-F and T-gapdh-R as primers, respectively. The target band is 285 bp.

[0023] Figure 2 Gel electrophoresis image of PCR products from the genome of Streptomyces 891 after artificial insertion of one attB site. M: 2000 DNA marker, lanes 1-4: PCR products using the genome of Streptomyces after knock-in attB site as template, with 22attB-F and 22attB-R as primers, respectively. The target band is 409 bp.

[0024] Figure 3 Gel electrophoresis images of the PCR products of the engineered strain Streptomyces sp. 891-DC, obtained by integrating the original strain Streptomyces 891 and plasmid p15A-chry-gapdh-phiC31 into Streptomyces. a represents the original strain Streptomyces 891, M: 2000 DNA marker; lanes 1 and 2: PCR products using the original strain genome as templates with primers T-P15A-F / R and T-P15A-f / r as primers, with a target band of 1589 bp; b represents the engineered strain, M: 2000 DNA marker; lanes 1 and 2: PCR products using the engineered strain genome as templates with primers T-P15A-F / R and T-P15A-f / r as primers, with target bands of 1589 and 1785 bp, respectively.

[0025] Figure 4HPLC chromatogram of fermentation products from engineered strain 891-DC. Peaks B, A, and C, according to their elution times, represent chloramphenicol B, chloramphenicol A, and chloramphenicol C, respectively.

[0026] Figure 5 Bar graph showing the average yield of aureomycin A after 13 and 15 days of fermentation of engineered strains and original strains. (V) Detailed Implementation

[0027] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0028] The culture medium and solvent used in the examples were all water.

[0029] (1) Seed culture medium (ISP2 medium): 4.0 g / L glucose, 4.0 g / L yeast extract, 10 g / L malt extract, pH natural.

[0030] (2) Fermentation medium: 5.0 g / L soluble starch, 20.0 g / L glucose, 10.0 g / L soybean flour, 2.0 g / L calcium carbonate, pH natural.

[0031] (3) MS solid culture medium: 16.0 g / L mannitol, 25.0 g / L cooked soybean powder, 20.0 g / L agar, pH natural.

[0032] (4) LB solid medium: 10.0 g / L tryptone, 5.0 g / L yeast extract, 1.0 g / L sodium chloride, 20.0 g / L agar powder, pH natural.

[0033] (5) LB liquid medium: 10.0 g / L tryptone, 5.0 g / L yeast extract, 1.0 g / L sodium chloride, pH natural.

[0034] Example 1: Construction of recombinant plasmid p15A-chry-gapdh-phiC3 with added promoter elements using Redαβ homologous recombination technology.

[0035] (1) Construction of the heterologous expression plasmid p15A-chry-phiC31 for the chrysanthemum biosynthesis gene cluster

[0036] A. Obtaining the target gene fragment: The genome of the original strain Streptomyces 891 was extracted and digested with the restriction endonuclease BsrGI-HF. After digestion, the chry fragment of the aureomycin biosynthesis gene cluster was recovered. The nucleotide sequence is shown as 6545734-6574668bp in NCBI Seq:CP050693.1.

[0037] B. Obtaining the vector for expressing the target gene: Using the p15A-cm-tetR-tetO-hyg-ccdB plasmid (gifted by Shandong University) as a template, the cloning vector p15A was amplified with primers p15A-chry-F and p15A-chry-R, so that the vector was attached with homologous arms at both ends of the aureomycin biosynthesis gene cluster. The vector fragment was recovered after agarose gel electrophoresis.

[0038] Primer sequences:

[0039] p15A-chry-F:gcagggtcggcctgagcgccggaccggctcccgtgatcctgccggtgaacttcctggtcgacggcc

[0040] gcaccatcgtAGATCCGAAAACCCCAAGTTACG;

[0041] p15A-chry-R:ggccgtagatcgcgcccagcagggccagtttggcctggtcgcggtcgccggagaacgcccgctcggagagggccgt AGATCCTTTCTCTCTTTAGATC.

[0042] C. Obtaining the vector for expressing the target gene: The fragments obtained in A and B were treated with T4 DNA polymerase in vitro, and then electroporated into E. coli GB05-dir containing plasmid pSC101-BAD-ETgA-tet (gifted by Shandong University) induced by arabinose for assembly. The plasmid was extracted and named p15A-chry.

[0043] D. Obtaining heterologous expression plasmids of the target gene: The p15A-chry plasmid was transformed into E. coli GB08-red (a gift from Shandong University) to obtain E. coli GB08-red containing the p15A-chry plasmid. After extracting the plasmid pR6K-oriT-phiC31 (a gift from Shandong University), the oriT-attP-phiC31 fragment was released by restriction endonuclease AseI (phiC31 can promote recombination between the attP site on the plasmid and the attB site in the Streptomyces genome). The fragment was then electroporated into E. coli GB08-red containing the p15A-chry plasmid and cultured at 37℃ for 16-18 h. Single colonies were selected for sequencing verification. The correct clone contained the heterologous expression plasmid p15A-chry-phiC31 for the chrysanthemum biosynthesis gene cluster. The nucleotide sequence of the chrysanthemum biosynthesis gene cluster is shown as 6545734-6574668bp in NCBI Seq:CP050693.1.

[0044] (2) gapdh promoter: Using gapdh-F and gapdh-R primers with pCRISPomyces-2 plasmid (purchased from Miaoling Biotechnology Co., Ltd.) as a template, PCR amplification was performed using the system in Table 1 and the amplification program in Table 2 to obtain the gapdh promoter fragment. This fragment has a 40bp homologous arm on the left side of plasmid p15A-chry-phiC31, denoted as DNA1, and its nucleotide sequence is shown in SEQ ID NO.1. The primer sequences involved are shown below:

[0045] gapdh-F: ATCTacggccctctccgagcgggcgttctccggcgaccgcgctgctccTTcggt;

[0046] gapdh-R: TGTACAgcgtatcccctttcagatac;

[0047] (3) Resistance selection marker gene: Using cml-ccdb-F and cml-ccdb-R primers with p15A-cml-ccdb plasmid (gifted by Shandong University) as template, PCR amplification was performed using the system in Table 1 and the amplification program in Table 2 to obtain the cml-ccdb resistance fragment. BsrGI restriction sites were added to both ends of the fragment. At the same time, the fragment also had a 40bp homologous arm on the right side of plasmid p15A-chry-phiC31, which was denoted as DNA2. The nucleotide sequence is shown in SEQ ID NO.2. The primer sequences involved are shown below:

[0048] cml-ccdb-F:tgaaaggggatacgcTGTACAATGGAGAAAAAAATCACTGG;

[0049] cml-ccdb -R: cccggtgacacaggccagggcgcaagagTGTACATGTACAtattccccagaacatcagg.

[0050] Table 1 PCR amplification system

[0051]

[0052]

[0053] Table 2 PCR amplification program:

[0054]

[0055] (4) Overlap extension PCR:

[0056] Using the overlap extension PCR amplification system in Table 3, the two fragments DNA1 from step (2) and DNA2 from step (3) were fused into one fragment under the action of primers gapdh-F and cml-ccdb-R to obtain the fusion fragment chry-gapdh-cml-ccdb.

[0057] For the first 15 cycles, PCR reactions were performed according to the system in Table 3 and the amplification procedure in Table 2 without adding primers. After the 15 cycles, PCR amplification reactions were performed with upstream and downstream primers gapdh-F and cml-ccdb-R added to the system according to the system in Table 3 for 15 cycles. The gel was then excised and recovered after the reaction.

[0058] Table 3 Overlap Extension PCR Amplification System

[0059]

[0060] (5) Electrotransfer the p15A-chry-phiC31 plasmid constructed in step (1) into E. coli GB08-red.

[0061] (6) Mix the fusion fragment obtained in step (4) with the E. coli containing p15A-chry-phiC31 plasmid in step (5), and perform linear loop recombination at 37°C under the action of Redαβ recombinase. Then, spread the cells on LB double antibody plates containing 50 μg / mL apramycin and 25 μg / mL chloramphenicol, and incubate at 37°C for 16-20 h.

[0062] (7) After extracting plasmids from the single clones grown in step (6), PCR and sequencing verification were performed using T-gapdh-F and T-gapdh-R. The PCR verification electrophoresis diagram is shown below. Figure 1 As shown in lane 1, the recombinant plasmid p15A-chry-gapdh-cml-ccdb-phiC31 with added promoter elements and resistance selection markers was obtained.

[0063] T-gapdh-F:gctgctccttcggtcg

[0064] T-gapdh-R:gcgtatcccctttcagatac

[0065] (8) After the plasmids were extracted from the single clones verified in step (7), the BsrGI enzyme was used to remove the resistance screening markers in the system in Table 4. After the enzyme digestion was completed, the p15A-chry-gapdh-phiC31 linear vector was recovered by electrophoresis gel.

[0066] Table 4. BsrGI digestion system

[0067]

[0068] (9) The vector fragment recovered from the electrophoresis gel in step (8) was ligated overnight at 16°C using the T4 ligase system in Table 5. 10 μL of the ligated product was heat-shocked into E. coli DH5α at 42°C. After recovery, the product was centrifuged at 5000 rpm for 5 min, the supernatant was discarded, and 100 μL was pipetted, mixed, and spread onto LB plates containing 50 μg / mL apramycin. The plates were then incubated at 37°C for 16-20 h.

[0069] Table 5. T4 ligase system

[0070]

[0071] (10) After plasmid extraction from the single clones grown in step (9), PCR and sequencing verification were performed. The PCR verification electrophoresis diagram is shown below. Figure 1 As shown in lane 2, the recombinant plasmid p15A-chry-gapdh-phiC31 with added promoter elements was obtained.

[0072] Under the same conditions, the gapdh(EL) promoter was replaced with the ermEp* promoter (nucleotide sequence shown in SEQ ID NO. 3) to construct the recombinant plasmid p15A-chry-ermEp*-phiC31 as a control.

[0073] Example 2: Using CRISPR-Cas9 gene editing technology, a plasmid was constructed for the in situ introduction of the complete attB site into cluster 22, a chlortetracycline-like cluster in Streptomyces 891.

[0074] (1) Using the 22-sgRNA-F and 22-sgRNA-R primers from Streptomyces 891 (nucleotide sequence shown as 6857070-6865015bp in NCBI Seq:CP050693.1) as a template, double-stranded sgRNA was formed by annealing at 95℃ for 5 min in a PCR instrument and then cooling to 4℃ at a rate of 0.1℃ / s. After diluting 10 times with ddH2O, the PCR reaction was carried out according to the system in Table 6 and the procedure in Table 7.

[0075] The primer sequences involved are shown below:

[0076] 22-sgRNA-F: AcgcGGATGAGCAGCCAGGACTAC;

[0077] 22-sgRNA-R:aaacGTAGTCCTGGCTGCTCATCC.

[0078] The assembly system in Kinmen is shown in Table 6 below:

[0079] Table 6 Kinmen Assembly System

[0080]

[0081] Table 7 Kinmen Assembly Reaction Procedure

[0082]

[0083] (2) Take 10 μL of the product assembled in step (1) and heat shock it at 42℃ to transform it into Escherichia coli DH5α. After recovery, centrifuge at 5000 rpm for 5 min, remove the supernatant, take 100 μL, pipette and mix well, and spread it on a blue-white screening plate containing 50 μg / mL apramycin (spread 40 μL 20 mg / mL Bluo-gal and 10 μL 0.5 M IPTG on the surface of LB plate), and incubate at 37℃ for 12-16 h.

[0084] (3) The white single clones grown in step (2) were extracted by plasmid extraction and sequenced to obtain the vector that knocked out the aureomycin-like cluster 22 in Streptomyces 891.

[0085] (4) Using 22-up-F / R and 22-down-F / R primers, with the Streptomyces 891 genome as a template, PCR amplification was performed according to the system in Table 1 to obtain 1000bp upstream and downstream homologous arms of the aureomycin-like cluster 22. The upstream and downstream homologous arms were fused into a single fragment according to the overlap extension PCR system in Table 3.

[0086] 22-up-F:gcgttttttatctagccgcgaggagctcgac;

[0087] 22-up-R:agtcgtccgctccgtcac.

[0088] 22-down-F:Gacggagcggacgact GTGCCAGGGCGTGCCCTTGGGCCTCCCCGGGCGCG tcatggctac ccacaac (underlined attB site, SEQ ID NO.4);

[0089] 22-down-R: Gttcctggcctctagcgggcaacatgtttacgcc.

[0090] (5) The vector in step (3) was digested with XbaI enzyme and recovered by electrophoresis according to the enzyme digestion system in Table 4. The fragment in step (4) was ligated to it according to the instructions of the seamless cloning kit. It was heat-shocked to DH5α at 42℃. After recovery, it was centrifuged at 5000rpm for 5min, the supernatant was removed, and 100μL was taken, mixed and spread on LB plates containing 50μg / mL apramycin. It was incubated in a 37℃ incubator for 12-16h.

[0091] (6) The single clones grown in step (5) were extracted and sequenced to obtain the plasmid pCRI-22, which completely knocked out the same type of cluster 22 as chloramphenicol and introduced the complete attB site in situ.

[0092] Example 3: Insertion of the attB site into Streptomyces 891 using CRISPR-Cas9 gene editing technology.

[0093] (1) The plasmid pCRI-22 obtained in Example 2 was electroporated into E. coil ET12567 / pUZ8002 strain, inoculated onto LB agar plates containing 50 μg / mL apramycin, and cultured at 37°C for 12-16 h. Positive strains were screened to obtain E. coil ET12567 / pUZ8002 strain containing the attB site, which was used as the donor strain.

[0094] (2) Inoculate Streptomyces 891 onto IPS2 plates and incubate at 28°C for 3-4 days. Add 5-6 mL of ddH2O to the plates, then spread the spores onto 5-6 plates using sterile cotton balls of uniform size. Add the spore suspension to a funnel lined with cotton balls, and aliquot the filtrate into 1.5 mL centrifuge tubes. Centrifuge at 12000 rpm for 2 min, discard the supernatant, and add 500 μL of the supernatant.

[0095] 20% glycerol, as the recipient bacteria.

[0096] (3) Take 200 μL of the donor bacteria and recipient bacteria prepared in steps (1) and (2) respectively, mix them well and spread them on MS plate medium (70 mM MgCl2, 90 mM CaCl2), and incubate the plates in an incubator at 28 ℃ overnight for 12-16 h.

[0097] (4) Spread 800 μL of sterile ddH2O (containing 500 μg / mL naphthylpyridinol and 1 mg / mL apramycin antibiotic) onto the plate from step (3), and then incubate it in a 28°C incubator until spores grow, which takes about 5-7 days.

[0098] (5) After selecting single colonies and culturing them for 3 generations, genomic DNA was extracted. Primers 22attB-F and 22attB-R were designed upstream and downstream of the knockout chlortetracycline cluster 22 for PCR and sequencing verification. The PCR verification results are as follows: Figure 2 The study showed that an engineered Streptomyces 891 strain with an attB site inserted in situ into the 22 cluster of chlortetracycline was obtained. This improved the recognition of the artificially inserted attB site by the integrase phiC31 on the plasmid, promoted the specific binding of the attP site on the plasmid to the artificially inserted attB site, and further improved the integration efficiency of the chlortetracycline gene cluster.

[0099] 22attB-F: ctacatgctgccgcactcg;

[0100] 22attB-R: cgagaccggagacctg.

[0101] Example 4: Obtaining Streptomyces 891-DC strain

[0102] (1) The p15A-chry-gapdh-phiC31 plasmid obtained in Example 1 was electroporated into E. coil ET12567 / pUZ8002 strain and inoculated onto LB agar plates containing 50 μg / mL apramycin. The plates were then incubated at 37°C for 12-16 h. Positive strains were screened to obtain E. coil ET12567 / pUZ8002 strain containing the p15A-chry-gapdh-phiC31 plasmid, which was used as the donor strain.

[0103] (2) The engineered Streptomyces 891 successfully inserted into the attB site obtained in Example 3 was used to prepare the recipient bacteria according to step (2) of Example 3.

[0104] (3) Take 200 μL of the donor bacteria and recipient bacteria prepared in steps (1) and (2) respectively, mix them well and spread them on MS plate medium (70 mM MgCl2, 90 mM CaCl2), and incubate the plates in an incubator at 28 ℃ overnight for 12-16 h.

[0105] (4) Spread 800 μL of sterile ddH2O (containing 500 μg / mL naphthylpyridinol and 1 mg / mL apramycin antibiotic) onto the plate from step (3), and then incubate it in a 28°C incubator until spores grow, which takes about 5-7 days.

[0106] (5) After selecting single colonies and culturing them for three generations, genomic DNA was extracted. Primers T-P15A-F / R and T-P15A-r / f were designed from two gene sequences not found in Streptomyces 891 on the plasmid for PCR amplification and sequencing verification. The original Streptomyces 891 genome was used as a control. The results are as follows: Figure 3 The engineered strain *Streptomyces* sp. 891-DC, containing the chrysogenin biosynthesis gene cluster, was obtained. It is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCCNO:M 20241963, dated September 13, 2024. Under the same conditions, the plasmid p15A-chry-gapdh-phiC31 was replaced with plasmid p15A-chry-ermEp*-phiC3, and all other operations were the same. The resulting engineered strain served as the control strain.

[0107] T-P15A-F:ggtaggaagcagggagtgac T-P15A-R:cgaaaggcaggaacagga

[0108] T-P15A-f:aggaccagccgaggagtt T-P15A-r:cgaccacgatgaccgagt

[0109] Example 5: Detection of fermentation products from engineered strains

[0110] (1) The engineered strain 891-DC was inoculated into MS agar medium containing 50 μg / mL apramycin, activated at 28℃ for 5 days, and then inoculated into ISP2 liquid medium. After culturing at 28℃ and 220 rpm for 48-72 h, the seed culture was obtained.

[0111] (2) The seed culture obtained in step (1) was inoculated into the fermentation medium at a volume concentration of 5%, and cultured at 28°C and 220 rpm for 13 days to obtain the fermentation broth. The mycelium was collected by centrifugation. Three replicates were set up.

[0112] (3) The mycelium obtained in step (2) was suspended in two volumes of methanol and sonicated at 40 kHz and 100 W for 30 min. After passing through a 0.22 μm filter membrane, the supernatant was collected and the content of chlortetracycline A was detected by HPLC. Its potency was calculated. The detection graph is shown in the figure. Figure 4 As shown.

[0113] (4) Chloramphenicol A standard was prepared into solutions with a certain concentration gradient using methanol. The peak area was determined by HPLC, and a standard curve of chloramphenicol A was plotted. The chloramphenicol A in the fermentation product was then quantitatively analyzed. The total titer of chloramphenicol A in shake-flask fermentation of engineered strain 891-DC was 1411.23±29 mg / L. The total titer of chloramphenicol A in shake-flask fermentation of the control engineered strain was 1161.35±74 mg / L.

[0114] The HPLC detection conditions were as follows: a Phenomenex (Luna, 250×4.6mm) C18 column was used; the mobile phase was 50% acetonitrile aqueous solution; the detection wavelength was 254 nm; and the injection volume was 5 μL.

[0115] Example 6: Potency Detection of Chloramphenicol A by Engineered Strains After 13 and 15 Days of Fermentation

[0116] The engineered strain 891-DC and the original strain 891 obtained in Example 6 were fermented under the conditions of Example 5, with three replicates. Samples were taken on days 13 and 15 for testing. At day 13, the yield of chlortetracycline A from the original strain was 885.25±61.24 mg / L, and that from the engineered strain 891-DC was 1039.49±57.5 mg / L, both higher than the yield of the original strain. At day 15, the yield of chlortetracycline A from the original strain was 881.84±43.08 mg / L, and that from the engineered strain 891-DC was 1411.79±29.8 mg / L, representing a 60% increase compared to the original strain. The average yield analysis is shown in the figure below. Figure 5 As shown.

[0117] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the present invention in any way. Any modifications, substitutions, and improvements made based on the present invention should be included within the scope of protection of the present invention.

Claims

1. Streptomyces that produce high levels of aureomycin A ( Streptomyces sp.) 891-DC, deposited at the China Center for Type Culture Collection, accession number CCTCC NO: M 20241963, deposited on September 13, 2024, at Wuhan University, Wuhan, China, 430072, China.

2. A method for constructing the Streptomyces 891-DC of claim 1, comprising the following steps: (1) using CRISPR-Cas9 gene editing technology, knocking out Cluster 22 which is the same type of gene cluster as the aureusidin biosynthesis gene cluster in Streptomyces 891 and inserting an attB site in situ to construct plasmid vector pCRI-22 containing attB sequence; the nucleotide sequence of the attB site is shown in SEQ ID NO. 4; (2) using Red aB homologous recombination technology to add the promoter gapdh in front of the aureusidin biosynthesis gene cluster to obtain recombinant plasmid p15A-chry-gapdh-phiC31; the nucleotide sequence of the promoter gapdh is shown in SEQ ID NO. 1 at 41-325 bp; the nucleotide sequence of the aureusidin biosynthesis gene cluster chry is shown in NCBI Seq: CP050693.1 at 6545734-6574668 bp; (3) the plasmid obtained in step (1) is introduced into ET12567 / pUZ8002 by electroporation E. coli ET12567 / pUZ8002; (4) introducing the plasmid extracted in step (3) into the genome of Streptomyces 891 by conjugation transfer to obtain an engineering strain containing an attB site; (5) introducing the plasmid in step (2) into the genome of the engineering strain containing an attB site in step (4) by conjugation transfer under the action of integrase to obtain Streptomyces 891-DC.

3. Use of the Streptomyces 891-DC of claim 1 in the fermentation production of aureusidin A.

4. Use according to claim 3, wherein the compound is ###0002### The method of use is: inoculating the Streptomyces 891-DC into a fermentation medium, culturing at 28°C, 220 rpm for at least 13 days to obtain a fermentation broth containing aureusidin A; the composition of the fermentation medium is: 5.0 g / L starch, 20.0 g / L glucose, 10.0 g / L soybean meal, 2.0 g / L calcium carbonate, pH natural.

5. The use according to claim 4, wherein the compound is ###0002### Before inoculating the Streptomyces 891-DC into the fermentation medium, seed expansion culture is performed, then the seed liquid is inoculated into the fermentation medium at a volume concentration of 5%; the seed expansion culture step: inoculating Streptomyces 891-DC into MS agar medium containing 50 µg / mL apramycin, activating at 28°C for 5-6 d, then inoculating into ISP2 liquid medium containing 50 µg / mL apramycin, culturing at 28°C, 220 rpm for 48-72 h to obtain the seed liquid; the composition of the MS agar medium is: 20.0 g / L mannitol, 25.0 g / L cooked soybean meal, 20.0 g / L agar, pH natural; the composition of the ISP2 liquid medium is: 4.0 g / L glucose, 4.0 g / L yeast extract, 10 g / L malt extract, pH natural.

Images