Bacillus subtilis genetically engineered bacterium and application thereof in spermidine production

Abstract

The invention discloses a bacillus subtilis genetically engineered bacterium and application thereof in spermidine production, and belongs to the field of synthetic biology. A metabolic engineering modification method is adopted, a novel exogenous pathway is introduced, product inhibition of a spermidine synthesis pathway is relieved, a spermidine transport system is changed, the enzyme expression quantity of a key pathway is enhanced, the bacillus subtilis engineering bacterium with high spermidine yield is obtained, the spermidine concentration in a shake flask supernatant is 11.4 g / L, and the spermidine concentration in the shake flask supernatant is 11.4 g / L; good industrial application prospects are realized.

Description

Technical Field

[0001] The invention relates to a Bacillus subtilis genetic engineering bacterium and application thereof in spermidine production, belonging to the technical field of bioengineering. Background Art

[0002] Spermidine is a natural multifunctional polyamine that is widely present in microorganisms, plants and animals. It is an important physiologically active substance. In terms of physiological function, spermidine plays a key role in cell growth and division, helping to maintain the normal cell life cycle. Spermidine also has antioxidant properties, can extend animal lifespan, and can treat cardiovascular diseases, neurodegenerative diseases and cancer.

[0003] There are currently two main pathways for the synthesis of spermidine found in organisms:

[0004] The first is the synthesis of spermidine from decarboxylated S-adenosylmethionine and putrescine under the action of spermidine synthetase. This pathway involves adenosylmethionine synthetase, S-adenosylmethionine decarboxylase, and spermidine synthetase. The function of adenosylmethionine synthetase (SAMS) is to catalyze the synthesis of S-adenosylmethionine from methionine, the function of S-adenosylmethionine decarboxylase (SAMDC) is to catalyze the decarboxylation of S-adenosylmethionine to generate decarboxylated S-adenosylmethionine, and the function of spermidine synthetase (SRM) is to transfer the aminopropyl group of decarboxylated S-adenosylmethionine to butanediamine to form spermidine. However, the substrate adenosylmethionine involved in the pathway is expensive and difficult to industrialize.

[0005] The second is the synthesis of spermidine from aspartate-β-semialdehyde and putrescine under the catalysis of carboxyspermidine dehydrogenase (CasDH) and carboxyspermidine decarboxylase (CasDC). This pathway involves aspartate kinase (AK), aspartate-β-semialdehyde dehydrogenase (ASADH), CasDH and CasDC. Aspartate is catalyzed by AK to produce aspartate-β-phosphate, and aspartate-β-phosphate is catalyzed by ASADH to produce aspartate-β-semialdehyde, which is catalyzed by CasDH and putrescine to produce carboxyspermidine, and finally spermidine is produced under the catalysis of CasDC.

[0006] Most microorganisms only have the first synthetic pathway, but the enzymes in this pathway are highly regulated, resulting in extremely low spermidine content in the microorganisms. Currently, there is no existing technology for using Bacillus subtilis as a host to produce spermidine, but Bacillus subtilis has unique advantages in producing spermidine as an expression host. Bacillus subtilis is generally considered to be a food-grade safe strain with an efficient secretion pathway and does not produce endotoxins. The spermidine produced by it can be used in the medical or food fields. Therefore, constructing a Bacillus subtilis genetically engineered bacterium with high spermidine production by means of genetic engineering and realizing industrial production is an effective way to solve the current low spermidine production. Summary of the invention

[0007] The present invention provides a genetically engineered bacillus subtilis and its application in the production of spermidine, the purpose of which is to achieve efficient production of spermidine. The present invention uses Bacillus subtilis as a host, introduces an exogenous new spermidine synthesis pathway, reduces contact inhibition, reduces substrate shunting in the spermidine synthesis pathway, and enhances the activity of key enzymes in the synthesis pathway to efficiently produce spermidine.

[0008] The first object of the present invention is to provide a genetically engineered bacterium of Bacillus subtilis, wherein the engineered bacterium has introduced an exogenous spermidine synthesis pathway and contains genes of carboxyaminopropylagmatine dehydrogenase, carboxyaminopropylagmatine decarboxylase and aminopropylagmatine urea hydrolase.

[0009] In one embodiment, the carboxyaminopropylagmatine dehydrogenase may be a carboxyaminopropylagmatine dehydrogenase from any source; alternatively, it may be a carboxyaminopropylagmatine dehydrogenase from Spirochaeta thermophila, Denitrovibrioacetiphilus, Geobacter sulfurreducens, Ilumatobacter coccineus, etc.

[0010] Further optionally, it is from Spirochaeta thermophila DSM 6578 or Denitrovibrioacetiphilus DSM 12809 or Geobacter sulfurreducens KN400 or Ilumatobactercoccineus YM16-304.

[0011] In one embodiment, the carboxyaminopropylagmatine decarboxylase may be a carboxyaminopropylagmatine dehydrogenase from any source; alternatively, it may be a carboxyaminopropylagmatine dehydrogenase from Spirochaeta thermophila, Denitrovibrioacetiphilus, Geobacter sulfurreducens, Ilumatobacter coccineus, and the like.

[0012] Further optionally, it is from Spirochaeta thermophila DSM 6578 or Denitrovibrioacetiphilus DSM 12809 or Geobacter sulfurreducens KN400 or Ilumatobactercoccineus YM16-304.

[0013] In one embodiment, the aminopropylagmatine urea hydrolase may be a carboxyaminopropylagmatine dehydrogenase from any source; alternatively, it may be a carboxyaminopropylagmatine dehydrogenase from Spirochaeta thermophila, Denitrovibrioacetiphilus, Geobacter sulfurreducens, Ilumatobacter coccineus, etc.

[0014] Further optionally, it is from Spirochaeta thermophila DSM 6578 or Denitrovibrioacetiphilus DSM 12809 or Geobacter sulfurreducens KN400 or Ilumatobactercoccineus YM16-304.

[0015] In one embodiment, the engineered bacteria also knocks out the gene of the repressor protein argR.

[0016] In one embodiment, the engineered bacteria also use a strong promoter to replace the natural promoters of the gene thrD encoding aspartate kinase, the gene asd encoding aspartate semialdehyde dehydrogenase, the argC gene encoding N-acetyl-γ-glutamyl phosphate reductase, the argJ gene encoding acetyl-ornithine aminotransferase, the argB encoding N-acetyl-glutamate kinase, and the argD gene encoding N-acetyl-ornithine 5-aminotransferase. For example, the strong promoter trc is used to replace the natural promoters of speA, thrD, asd, argC, argJ, argB, and argD to enhance the expression of aspartate kinase, aspartate semialdehyde dehydrogenase, N-acetyl-γ-glutamyl phosphate reductase, acetyl-ornithine aminotransferase, N-acetyl-glutamate kinase, and N-acetyl-ornithine 5-aminotransferase.

[0017] In one embodiment, the strong promoter is the trc promoter.

[0018] Optionally, the strong promoter sequence is shown as SEQ ID NO.71.

[0019] In one embodiment, the engineered bacteria also integrates a gene encoding a transport protein MdtJI into the genome of Bacillus subtilis, and a strong promoter enhances the expression of MdtJI to improve the ability of spermidine to be transported outside the cell.

[0020] Optionally, the gene encoding the transporter protein MdtJI is from Escherichia coli.

[0021] In one embodiment, the genetically engineered bacteria express gene integration through homologous recombination.

[0022] In one embodiment, the gene is knocked out using homologous recombination technology.

[0023] In one embodiment, the gene is knocked out using Crispr / Cas9 gene editing technology.

[0024] The second object of the present invention is to provide an application of a genetically engineered bacterium of Bacillus subtilis in producing spermidine.

[0025] The third object of the present invention is to provide a method for constructing a genetically engineered bacterium of Bacillus subtilis, the method comprising:

[0026] (1) integrating exogenous carboxyaminopropylagmatine dehydrogenase, carboxyaminopropylagmatine decarboxylase and aminopropylagmatine urea hydrolase genes into a plasmid, and integrating the plasmid into Bacillus subtilis;

[0027] (2) constructing a gene knockout plasmid to knock out the argR gene;

[0028] (3) using the strong promoter trc to replace the natural promoters of argC, argJ, argB, argD, thrD, asd, and speA;

[0029] (4) Integrate the trc and transporter protein MdtJI genes into Bacillus subtilis.

[0030] Beneficial Effects

[0031] The present invention constructs a Bacillus subtilis that uses glucose as raw material to produce high spermidine based on synthetic biology methods. The production process is simple and the raw materials are easy to obtain and low in cost, and has good prospects for industrial application. The details are as follows:

[0032] (1) Bacillus subtilis produces almost no spermidine without genetic engineering modification, and the yield is extremely low, close to zero. The traditional spermidine synthesis pathway in Bacillus subtilis synthesizes spermidine through carboxylated-S-adenosylmethionine and putrescine under the action of spermidine synthase, and the synthesis pathway of carboxylated-S-adenosylmethionine has low production efficiency. Compared with the traditional production pathway, the genetically engineered Bacillus subtilis bacteria of the present invention can greatly increase the yield of spermidine. When only the exogenous pathway is introduced, the spermidine concentration reaches 4.6 g / L.

[0033] (2) The present invention relieves the inhibition of ArgR on the synthesis pathway, and the production of spermidine after optimization reaches 6.7 g / L.

[0034] (3) The present invention strengthens the expression of key enzymes. Arginine decarboxylase encoded by the speA gene, aspartate kinase encoded by the thrD gene, and aspartate semialdehyde dehydrogenase encoded by the asd gene are key enzymes that catalyze the synthesis of aspartate semialdehyde from aspartate. N-acetyl-γ-glutamyl phosphate reductase, acetyl-ornithine aminotransferase, N-acetyl-glutamate kinase, and N-acetyl-ornithine 5-aminotransferase encoded by the speA, argC, argJ, argB, and argD genes are key enzymes in the arginine synthesis pathway. Strengthening the expression of these seven enzymes can increase the yield of spermidine to 7.4 g / L.

[0035] (4) The present invention improves the transport pathway of spermidine. MdtJI protein is a protein that transports spermidine out of cells. By enhancing the expression of MdtJI, the production of spermidine can be increased to 11.4 g / L. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 The method for synthesizing spermidine by Bacillus subtilis in the present invention is DETAILED DESCRIPTION

[0037] 1. Strains and plasmids involved in the present invention

[0038] pEC-XK99E shuttle plasmid, T19 plasmid, pK18mobsacB plasmid purchased from Novagen, and Bacillus subtilisACCC11025 preserved in our laboratory.

[0039] 2. Culture medium and fermentation conditions

[0040] B. subtilis and its recombinant strains were cultured at 37°C and 100 r / min. Under specific conditions, Amp with a mass concentration of 100 μg / mL or Kan with a mass concentration of 50 μg / mL was added to screen the recombinant strains of E. coli and B. subtilis.

[0041] LB medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, pH 7.0.

[0042] SPⅠ culture medium (20mL): 9.8mL SPⅠ-A salt solution (i.e. Na3C6H5O7·2H2O 2g / L, (NH4)2SO4 4g / L, K2HPO4 3H2O 28g / L, KH2PO4 12g / L, sterilized at 0.1MPa for 20min); 9.8mL SPⅠ-B solution (i.e. MgSO4·7H2O0.4g / L, sterilized at 0.1MPa for 20min); 200μL 100×CAYE solution (i.e. casein hydrolysate 20g / L, yeast extract 100g / L, sterilized at 0.1MPa for 20min); 200μL glucose solution (500g / L).

[0043] SPⅡ medium (6mL): 5.88mL SPⅠ medium, 60μL CaCl2 solution (50mmol / L), 60μL MgCl2 solution (250mmol / L). Fermentation medium: glucose 80g / L, corn syrup 35g / L, beet molasses 12g / L, (NH4)2SO4 36g / L, MgSO4·7H2O 1.5g / L, K2HPO4 1g / L, KH2PO4 1g / L, FeSO4 0.02g / L, MnSO4 0.02g / L, betaine 0.05g / L, nicotinamide 0.008g / L, thiamine 0.00045g / L, biotin 0.00085g / L, CaCO3 40g / L.

[0044] All culture media were adjusted to pH 7.0-7.2 with 0.2 g / mL NaOH solution and sterilized at 121°C for 20 min, while fermentation culture media were sterilized at 115°C for 10 min.

[0045] 3. Induced expression of recombinant bacteria

[0046] Recombinant Bacillus subtilis was inoculated from an agar plate into 50 mL LB seed culture and grown overnight. The cells were collected by centrifugation (4000 rpm, 10 min) and washed once with CGXⅡ basic medium lacking a carbon source, then inoculated into 50 mL of CGXⅡ basic medium containing 20 g / L glucose, 25 μg / mL carbamate resistance, (100 μg / mL ampicillin resistance), cultured until OD600 reached 0.5, and the inducer IPTG was added to 1 mM. After induction at 20°C for 24 h, the supernatant was collected by centrifugation at 4°C, 8000 rpm, and 20 minutes.

[0047] 4. Determination of spermidine content

[0048] Preparation of OPA derivatization reagent: OPA reagent was prepared by Uren method and Karababa (15). 0.20 g of OPA was dissolved in 9.0 mL of methanol, and 1.0 mL of 0.40 M (pH 9.0) borate buffer and 160 μL of 2-mercaptoethanol (reducing agent) were added. OPA reagent was stored at 4°C.

[0049] Spermidine was first derivatized with o-phthalaldehyde (OPA; Sigma, St. Louis, MO). 50 μL of sample and 450 μL of water were added to 400 μL of methanol. After adding 100 μL of OPA reagent, the mixture was filtered through a 0.2-μm filter membrane and 20.0 μL of the filtrate was immediately injected into the HPLC instrument.

[0050] HPLC detection conditions: Spermidine was detected by the method in reference (Qian, ZG, XXXia, and SYLee, Metabolic engineering of Escherichia coli for the production of putrescine: a fourcarbon diamine. Biotechnol Bioeng, 2009. 104 (4): p. 651-662): Luna 5-μm C18 (2) 100A column (250 × 4.6 mm; Phenomenex) operated at 25 ° C and 0.8 mL / min mobile phase was used for all sample separations. The mobile phase consisted of solvent A (55% methanol in 0.1 M sodium acetate, pH 7.2) and solvent B (methanol). The following gradient was applied: 1-6 min, 100% A; 6-10 min, linear gradient of B from 0% to 30%; 10-15 min, linear gradient of B from 30% to 50%; 15-19 min, linear gradient of B from 50% to 100%; 19-23 min, 100% B; 23-25 ​​min, linear gradient of B from 100% to 30%; 25-28 min, linear gradient of B from 30% to 0% (all in vol %).

[0051] 5. Preparation of Competent Cells

[0052] (1) Select Bacillus subtilis strains and streak them onto LBG plate medium, and culture them in a 30°C incubator for 30 to 48 hours;

[0053] (2) Pick a single colony from the plate and inoculate it into the seed medium for 12 to 24 hours. Inoculate it into LBGT medium at a 2% inoculation rate and incubate it in a 30°C incubator for a certain period of time. When the OD600 reaches about 0.9, take the bacterial solution and put it into a centrifuge tube and place it on ice for 15 minutes.

[0054] (3) After the ice bath, collect the cells by centrifugation at 4500 rpm for 10 min at 4°C, and wash the cells four times with 20 mL of pre-cooled 10% glycerol, centrifuging at 4500 rpm for 5 min each time to collect the cells. After washing, resuspend the cells with 500 μL of 10% sterile glycerol and dispense 100 μL into a 1.5 mL centrifuge tube for direct electroporation or storage at -80°C for later use.

[0055] 6. Transformation of Bacillus subtilis Competent Cells

[0056] (1) Add 2-4 μL of plasmid to each tube of competent cells, mix well, and incubate on ice for 10 min.

[0057] (2) Transfer the transformation solution into a pre-cooled electroporation cup and electroporate at 2.5 kV for 4 seconds. Immediately after the electroporation, add it to LBGT growth medium, mix gently, aspirate it, place it in a 1.5 mL centrifuge tube, incubate it in a 46 °C water bath for 5 minutes, and then culture it in a 30 °C shaker for 1.5 hours.

[0058] (3) Centrifuge at 5000 rpm / min for 1 min, discard the supernatant, and keep about 100-150 μL of the bacterial solution. Mix well and spread on a LBGT solid plate containing 40 μg / mL carnamycin, and culture at 30°C for 36-48 h.

[0059] 7. Enzyme digestion, ligation, purification, DNA extraction and other operations

[0060] (1) Enzyme digestion reaction system: 10×Q Cut Buffer 5 μL, DNA 20 μL, ddH2O 33 μL, endonuclease-1 1 μL, endonuclease-2 1 μL, mix well, and heat in a 37°C water bath for 0.5 to 1 h.

[0061] (2) Ligation reaction system: 5 μL of Lightning Cloning Enzyme, 1-2 μL of double-enzyme-cut plasmid (10-100 ng), 4-5 μL of homologous target fragment, add ddH2O to 10 μL, mix well, and heat in a 50°C water bath for 30 min.

[0062] (3) PCR amplification of target gene reaction system (50 μL): DNA template 1 μL, 5× PrimeSTAR Buffer 10 μL, dNTP Mixture 4 μL, amplification primer 1 μL, amplification primer 1 μL, PrimeSTAR HSDNA Polymerase 0.5 μL, ddH2O 32.5 μL. PCR amplification program: 30 cycles (98°C 10 s, 55°C 10 s, 72°C 1 kb / min), 72°C 10 min, 4°C storage.

[0063] (4) Colony PCR reaction system: 2×Fastag PCR SuperMix 25μL, upstream primer (concentration 10μM) 1μL, downstream primer (concentration 10μM) 1μL, ddH2O to 50μL, a small amount of colonies or bacterial liquid as template. PCR amplification program: 30 cycles (98℃10s, 55℃10s, 72℃4kb / min), 72℃10min, 4℃ storage.

[0064] Example 1: Exogenous expression of spermidine synthesis pathway

[0065] In this example, Bacillus subtilis ACCC11025 was used as a wild bacterium, and on the basis of its production of multiple amino acids such as glutamate, ornithine, arginine, and methionine, genes related to the synthesis of spermidine were exogenously integrated to construct a polyamine-synthesizing strain.

[0066] The present invention introduces the CAPADH / CAPADC / APAUH pathway from different microbial strains into Bacillus subtilis for heterologous expression. The carboxyaminopropyl agmatine dehydrogenase encoded by CAPADH directly uses aspartate semialdehyde and agmatine as precursors to synthesize carboxyaminopropyl agmatine, and then decarboxylates and synthesizes aminopropyl agmatine under the action of the carboxyaminopropyl agmatine decarboxylase encoded by CAPADC, and finally generates spermidine under the action of the aminopropyl agmatine urea hydrolase encoded by APAUH. First, carboxyaminopropyl agmatine dehydrogenase, carboxyaminopropyl agmatine decarboxylase and aminopropyl agmatine urea hydrolase from various sources are expressed in Bacillus subtilis through plasmids. The enzyme with the highest catalytic efficiency is further selected, and the CAPADH / CAPADC / APAUH pathway is exogenously integrated. The genome integration position selected by the present invention is upstream of the argB gene of Bacillus subtilis ACCC11025.

[0067] The specific process is as follows:

[0068] The carboxyaminopropylagmatine dehydrogenase genes stcapadh, dacapadh, gscapadh and iccapadh were cloned from the genomes of Spirochaeta thermophila DSM 6578, Denitrovibrio acetiphilus DSM 12809, Geobacter sulfurreducens KN400 and Ilumatobacter coccineusYM16-304 using amplification primers. The amino acid sequences of the genes were WP_014623968.1, WP_013011851.1, WP_010943175.1 and WP_015442124.1 on NCBI, respectively; The carboxyaminopropylagmatine decarboxylase genes stcapadc, dacapadc, gscapadc, and iccapadc were cloned from the genome of YM16-304, and the amino acid sequences were numbered WP_014623969.1, WP_013011852.1, WP_004513933.1, and WP_015442123.1 in NCBI, respectively; The aminopropylagmatine urea hydrolase genes stapauh, daapauh, lbapauh, and icapauh were cloned from the genome of YM16-304, and the amino acid sequences were numbered WP_014623970.1, WP_013011853.1, WP_015770028.1, and WP_015442122.1 in NCBI, respectively. First, the three target genes of carboxyaminopropylagmatine dehydrogenase, carboxyaminopropylagmatine decarboxylase, and aminopropylagmatine urea hydrolase from different strains were connected to the multiple cloning site of the shuttle plasmid pEC-XK99E by homologous recombination to obtain the pEC-XK99E plasmid with enhanced expression.

[0069] CAPADH and CAPADC in the above-mentioned microorganisms are located in adjacent positions of a gene cluster. Using stcapadh-EcoRⅠ-F and stcapadc-SacⅠ-R as primers and the Spirochaeta thermophila DSM 6578 genome as a template, the target fragment stcapadh-stcapadc was amplified; the multiple cloning site of the plasmid pEC-XK99E was treated with double enzymes EcoRⅠ and SacⅠ, and after purification of the enzyme digestion product, the cut plasmid was connected with the amplified target fragment stcapadh-stcapadc, and the connection product pEC-XK99E-stcapadh-stcapadc was transferred into JM109 competent cells, and positive clones were selected on the resistance plate card sodium plate, and its correctness was further verified by colony PCR; using stapauh-XbaI-F and stapauh-HindⅢ-R as primers, Spirochaeta thermophila DSM 6578 genome as a template, amplify the target fragment stapauh, use double enzymes XbaI and HindⅢ to digest the second multiple cloning site of plasmid pEC-XK99E-stcapadh-stcapadc, purify the digestion product, and connect it with the amplified target fragment stapauh. The ligation product pEC-XK99E-stcapadh-stcapadc-stapauh is transformed into JM109 competent cells, and positive clones are selected in the resistance plate card sodium plate. Colony PCR further verifies its correctness. Since the expression plasmid pEC-XK99E has only one multiple cloning site, RBS sequences are added upstream of each gene fragment, and the sequences are SEQ ID NO.69: BBa_B0033 (TCACACAGGAC) and SEQ ID NO.70: BBa_B0034 (AAAGAGGAGAAA).

[0070] Select the JM109 strain with the correct connection, extract the plasmid pEC-XK99E-stcapadh-stcapadc-stapauh and transform it into the competent cell Bacillus subtilis ACCC11025 to construct the Bacillus subtilis-stcapadh-stcapadc-stapauh spermidine synthesis strain. The construction method of the remaining strains is similar to that of Bacillus subtilis-stcapadh-stcapadc-stapauh. Arginine decarboxylase, carboxyaminopropyl agmatine dehydrogenase, carboxyaminopropyl agmatine decarboxylase and aminopropyl agmatine urea hydrolase from different strains are connected to the multiple cloning site of the pEC-XK99E plasmid. The connection of other genes is similar to the above. The primer sequences used are shown in Table 1:

[0071] Table 1 Primer sequences (SEQ ID NO. 1-4)

[0072]

[0073]

[0074] The obtained recombinant bacteria were induced to express, and the induction expression method was carried out according to the above steps. The concentration of spermidine in the supernatant was detected by HPLC, as shown in Table 2.

[0075] Table 2 Spermidine concentration detection

[0076] Recombinant bacteria Spermidine(g / L) B.subtilis-stcapadh-stcapadc-stapauh 4.6 B.subtilis-iccapadh-iccapadc-icapauh 2.6 B.subtilis-dacapadh-dacapadc-daapauh 1.9 B.subtilis-gscapadh-gscapadc-lbapauh 3.1 B.subtilis-stcapadh-gscapadc-stapauh 2.8 B.subtilis-gscapadh-stcapadc-stapauh 2.4 B.subtilis-stcapadh-dacapadc-stapauh 3.5 B.subtilis-dacapadh-stcapadc-stapauh 4.0

[0077] Overexpression of the key gene for spermidine synthesis using an expression vector will cause the thalline to bear a metabolic burden, thereby affecting its growth. In addition, the expression vector has structural instability during thalline propagation, is easy to lose, and has an unstable copy number in the cell. Adding antibiotics will interfere with the growth of the thalline and also pollute the environment. In addition, IPTG induction will increase production costs and restrict the expansion of production scale. Therefore, the strain B.subtilis-stcapadh-stcapadc-stapauh with the best effect of inducing expression of spermidine synthesis is selected, and the best gene combination is integrated into the genome of Bacillussubtilis ACCC11025 in the present invention. Using the genome of Bacillus subtilis ACCC11025 as a template, a 2000 bp fragment upstream of the argB gene was amplified, and 1000 bp of each fragment was taken as the left and right homologous arms, respectively; using pEC-XK99E-stcapadh-stcapadc-stapauh as a template, PCR amplification was performed to obtain the stcapadh-stcapadc-stapauh fragment, which was then digested, ligated, and ligated with pK18mobsacB to construct the pK18mobsacB-stcapadh-stcapadc-stapauh integration plasmid, and the integration plasmid pK18mobsacBstcapadh-stcapadc-stapauh was transferred into the competent state of Bacillus subtilis ACCC11025 by electroporation. The kanamycin-resistant clones that had produced the first recombination were screened on LB plates containing 25 g / mL kanamycin. Select transformants and inoculate them into LB medium. After shaking and culturing overnight at 30°C, spread them on LB plates containing 10% sucrose to screen clones that have produced the second recombination. Inoculate the transformants on plates containing 25g / mL kanamycin and 10% sucrose to verify the kanamycin and sucrose resistance of the transformants. Among them, clones with sucrose resistance and kanamycin sensitivity are clones that have been integrated, and are verified by PCR, and genes are extracted and sequenced to verify their correctness. Construct a genome-integrated strain B. subtilis-stcapadh-stcapadc-stapauh, named B1, and use it as a basic strain for subsequent research.

[0078] The production of C1 spermidine was verified by shake flask culture, and the spermidine concentration in the shake flask supernatant was measured to be 4.6 g / L.

[0079] Example 2: Knockout of the repressor protein ArgR

[0080] In the important intermediate process of aspartate semialdehyde and arginine synthesis, there is an important repressor protein that inhibits the synthesis of intermediates and final products. The DNA-binding dual transcriptional regulator encoded by the argR gene (the amino acid sequence accession number on NCBI is WP_003230265.1) inhibits the expression of the arg series genes and the excessive synthesis of the required important intermediates ornithine and arginine. Therefore, in order to ensure the stable and high-speed synthesis of each intermediate, the gene encoding the repressor protein was deleted to increase the metabolic flux, and the engineered bacteria B. subtilisΔArgR was obtained, which was named B2.

[0081] The specific process is as follows:

[0082] Knockout of the repressor protein ArgR

[0083] The knockout of this gene was carried out by constructing a plasmid for gene knockout using overlapping PCR. Using the genomic DNA of Bacillus subtilis as a template, PCR reaction was performed, and argR-1 and argR-2 were used as primers to amplify a 1000bp fragment upstream of the argR gene, wherein argR-1 had a BamHⅠ restriction site, and argR-3 and argR-4 were used as primers to amplify a 1000bp fragment downstream of the argR gene, wherein argR-4 had a SalⅠ restriction site, and primers argR-2 and argR-3 had a complementary sequence of about 20bp. The two PCR products were recovered by gel, mixed in equal amounts and used as templates, and the second round of PCR was performed with primers argR-1 and argR-4, because the two fragments had a complementary sequence of about 20bp, so that the upstream PCR product and the downstream PCR product formed overlapping chains, and the upstream and downstream PCR products were spliced ​​together to obtain a product of 2000bp in size. The obtained PCR product was ligated with plasmid pK18mobsacB after double digestion with BamHI and SalⅠ to obtain recombinant plasmid pK18mobsacB-argR.

[0084] The argR gene was knocked out using the constructed knockout plasmid pK18mobsacB-argR. The knockout plasmid pK18mobsacB-argR was transferred into the competent Bacillus subtilis by electroporation. The kanamycin-resistant clones that have produced the first recombination were screened on an LB plate containing 25g / mL kanamycin. The transformants were selected and inoculated into LB medium, and after shaking and culturing overnight at 30°C, they were spread on an LB plate containing 10% sucrose to screen the clones that have produced the second recombination. The transformants were inoculated onto a plate containing 25g / mL kanamycin and a plate containing 10% sucrose, respectively, to verify the kanamycin and sucrose resistance of the transformants. Among them, the clones with sucrose resistance and sensitivity to kanamycin are clones that have undergone knockout, and are verified by PCR, and the genes are extracted and sequenced to verify their correctness. Among them, the primer design is shown in Table 3:

[0085] Table 3 Primer sequences (SEQ ID 5-8)

[0086] Primer name Primer sequence 5'-3' SEQ ID argR-1 TCTAGAGGATCGTGACTCGCACTGCACGC NO.5 argR-2 CAACTGCTCTAAGCAGTAACTGGGCCGACCGCGTAGT No.6 argR-3 TTTACTGCTTAGAGCAGTTGTTTCTACAGATCATTCCG No.7 argR-4 CTGCAGGTCGACTTAAGTGGTGCGCCCGCT No.8

[0087] The production of B2 arginine was verified by shake flask culture, and the arginine concentration in the shake flask supernatant was measured to be 6.7 g / L.

[0088] Example 3: Enhanced expression of key enzymes in the pathway

[0089] The invention utilizes a strong promoter trc to replace its natural promoter, strengthens the expression of speA, thrD, asd, argC, argJ, argB and argD genes, promotes the synthesis of arginine metabolic flux, and accumulates more target products. Among them, the trc promoter (sequence: SEQ ID NO.71: 5'-TTGACAATTAATCATCCGGCTCGTATAATG-3') is derived from the pTrc99a plasmid.

[0090] B2 was used as the starting bacterium to further enhance the expression of key enzymes in the synthesis pathway: thrD (the accession number of the amino acid sequence on NCBI is WMA44643.1), asd (the accession number of the amino acid sequence on NCBI is WP_015715894.1), argC (the accession number of the amino acid sequence on NCBI is WP_009966985.1), argJ (the accession number of the amino acid sequence on NCBI is WP_024571947.1), argB (the accession number of the amino acid sequence on NCBI is WP_014476417.1), argD (the accession number of the amino acid sequence on NCBI is WP_003232985.1), and speA (the accession number of the amino acid sequence on NCBI is WP_029317749.1). The strong trc promoter was used to replace the natural promoter of the gene to obtain the engineered bacterium B2-P.trc speA-P trc thrD-P trc asd-P trc argCJBD strain.

[0091] The specific process is as follows:

[0092] According to the thrD of B.subtilisACCC11025 in NCBI, Primer Premier5 was used to design the relevant fragment primers (Table 4). Using the B.subtilisACCC11025 genome as a template and thrD-KZ-F / R as primers, PCR amplified the target gene fragment lysC, and added restriction sites EcoRI and HindⅢ in the upstream and downstream, respectively, and purified the PCR fragment. The pTrc99a plasmid was double-digested with EcoRI and HindⅢ, the digested plasmid was purified, and the purified thrD fragment was connected and transformed into E.coli JM109 competent cells, and the positive transformants were selected. Colony PCR and sequencing were performed using the verification primer thrD-99a-YZ-F / R to verify its correctness. The successfully transformed plasmid pTrc-thrD was extracted and used as a template. BamHI-trc-thrD-F and trc-thrD-SacI-R were used as primers to amplify the target fragment trc-thrD sequence, which was verified to be about 1353bp by gel running and purified. The T19 vector plasmid was double-digested with BamHI and SacI enzymes, and after purification, it was connected and transformed with the trc-thrD fragment. The verification primers trc-thrD-T19-YZF / YZR were used for colony PCR and company sequencing to verify the correct positive transformant T19-trc-thrD. Using the thrD genome in B. subtilisACCC11025 as a template, thrD-LA-EcoRI and BamHI-thrD-LA were used as primers to amplify the left arm fragment LA, and thrD-RA-XbaI and HindⅢ-thrD-RA were used as primers to amplify the right arm fragment RA. After purification, they were connected to the left and right arms of the double-enzyme-cut and purified plasmid T19-trc-thrD, respectively, and sent to the company for sequencing to find the plasmid T19-LA-trc-thrD-RA that correctly connected the left and right arms. The plasmid T19-LA-trc-thrD-RA with the left and right arms connected was extracted and used as a template. Using thrD-LA-EcoRI and HindⅢ-thrD-RA as primers, the target fragment LA-trc-thrD-RA was amplified, with a size of about 3400bp. After the PCR product was purified, the restriction endonuclease DpnI was used to eliminate the template effect. The product after enzyme digestion was further purified and then connected with the pK18mobsacB plasmid digested with double enzymes to construct the pK18mobsacB-LA-trc-thrD-RA plasmid, which was transferred into C2 competent cells. The thrD gene with the trc strong promoter in the recombinant plasmid was replaced with the original thrD gene by using the principle of homologous recombination, and the trc strong promoter was integrated to enhance the expression of the thrD operon.The promoter-enhanced bacteria were verified and sequenced using ThrD-YZ-F and ThrD-YZ-R.

[0093] According to the above method, the promoters of the genes speA, asd, argCJBD were replaced in sequence. trc speA-P trc thrD-P trc asd-P trc argCJBD, named B3. The primers used are as shown in Table 4:

[0094] Table 4 Primer sequences (SEQ ID NO.9~64)

[0095]

[0096]

[0097] The production of B3 spermidine was verified by shake flask culture, and the spermidine concentration in the shake flask supernatant was measured to be 7.4 g / L.

[0098] Example 4: Enhancing the spermidine transport pathway

[0099] In order to make spermidine synthesized in the cytoplasm transferred out of the cell faster and reduce the impact of excessive spermidine synthesis on it, the present invention integrates the well-characterized spermidine transporter MdtJI from Escherichia coli to increase the content of spermidine transferred out of the cell.

[0100] The integration scheme is the same as described in Example 1. First, the target gene cluster mdtJI is cloned from Escherichia coli and connected to the shuttle plasmid pEC-XK99E to construct the plasmid pEC-XK99E-mdtJI;

[0101] Then, the target fragment trc-mdtJI with a strong promoter was amplified using the plasmid pEC-XK99E-mdtJI as a template, and the fragment was connected to the plasmid pK18mobsacB to construct the integration plasmid pK18mobsacB-trc-mdtJI;

[0102] The integration plasmid pK18mobsacB-trc-mdtJI was transferred into the competent cell B3 of Bacillus subtilis, and the target gene fragment trc-mdtJI was integrated into the genome through the principle of homologous recombination to construct the strain B3-mdtJI, which was named B4.

[0103] The obtained recombinant bacteria B4 were subjected to shake flask fermentation, and the spermidine production in the fermentation broth was detected by HPLC. The spermidine concentration in the shake flask supernatant was measured to be 11.4 g / L. The introduction of the transporter protein significantly improved the ability of Bacillus subtilis to produce spermidine, and transported more intracellular spermidine to the extracellular space.

[0104] Table 5 Primer sequences (SEQ ID NO.65~56)

[0105] Primer name Sequence 5'-3' SEQ JI-F GAATTCATGTATATTTATTGGATTTT No.65 JI-R AAGCTTTCAGGCAAGTTTCACCATGA No.66 Trc-MdtJI-F ACCAGGGAACATGGCCTTATGGCATttgacaattaatcatccg No.67 Trc-MdtJI-R AGCTTCACCCCAGTGCTTGCACCGT No.68

[0106] The production of spermidine of B4 was verified by shake flask culture, and the spermidine concentration in the shake flask supernatant was measured to be 11.4 g / L.

[0107] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A genetically engineered bacterium of Bacillus subtilis, characterized in that: The engineering bacteria express exogenous carboxyaminopropylagmatine dehydrogenase, carboxyaminopropylagmatine decarboxylase and aminopropylagmatine urea hydrolase.

2. The engineered bacteria according to claim 1, characterized in that The engineered bacteria has a gene encoding the repressor protein argR knocked out.

3. The engineered bacteria according to claim 1, characterized in that The engineered bacteria utilizes a strong promoter to replace the natural promoters of the gene thrD encoding aspartate kinase, the gene asd encoding aspartate semialdehyde dehydrogenase, the gene speA encoding arginine decarboxylase, the argC gene encoding N-acetyl-γ-glutamyl phosphate reductase, the argJ gene encoding acetyl-ornithine aminotransferase, the argB gene encoding N-acetylglutamate kinase, and the argD gene encoding N-acetyl-ornithine 5-aminotransferase.

4. The engineered bacteria according to claim 2, characterized in that The engineered bacteria utilizes a strong promoter to replace the natural promoters of the gene thrD encoding aspartate kinase, the gene asd encoding aspartate semialdehyde dehydrogenase, the gene speA encoding arginine decarboxylase, the argC gene encoding N-acetyl-γ-glutamyl phosphate reductase, the argJ gene encoding acetyl-ornithine aminotransferase, the argB gene encoding N-acetylglutamate kinase, and the argD gene encoding N-acetyl-ornithine 5-aminotransferase.

5. The engineered bacteria according to any one of claims 1 to 4, characterized in that The engineering bacteria integrates the transporter MdtJI gene for transferring spermidine to the extracellular space, and a strong promoter enhances the expression of MdtJI.

6. The engineered bacteria according to any one of claims 3 to 4, characterized in that The strong promoter is trc.

7. The engineered bacteria according to claim 5, characterized in that The strong promoter is trc.

8. Use of the engineered Bacillus subtilis bacteria according to any one of claims 1 to 4 in producing spermidine.

9. Use of the Bacillus subtilis engineered bacteria according to claim 5 in producing spermidine.

10. A method for constructing a genetically engineered bacterium of Bacillus subtilis, characterized in that: The method comprises: (1) integrating exogenous carboxyaminopropylagmatine dehydrogenase, carboxyaminopropylagmatine decarboxylase and aminopropylagmatine urea hydrolase genes into a plasmid, and integrating the plasmid into Bacillus subtilis; (2) constructing a gene knockout plasmid to knock out the argR gene; (3) using the strong promoter trc to replace the natural promoters of argC, argJ, argB, argD, thrD, asd, and speA; (4) Integrate the trc and transporter protein MdtJI genes into Bacillus subtilis.

Images