Bacterial strain for producing catechol by utilizing terephthalic acid and construction method

Abstract

The invention relates to the technical field of microbial genetic engineering, in particular to a strain for producing catechol by utilizing terephthalic acid and a construction method. According to the invention, tphA123, tphB and aroY are utilized in pseudomonas putida to construct a conversion path from terephthalic acid to catechol, so that terephthalic acid is converted into catechol. The strain has good catechol yield, and the conversion rate can reach 91.22%.

Description

Technical Field

[0001] The invention relates to the technical field of microbial genetic engineering, and in particular to a strain for producing catechol using terephthalic acid and a construction method thereof. Background Art

[0002] Catechol, also known as catechol, is an organic compound with the chemical formula C6H6O2. It is a white crystalline powder and an important chemical intermediate. It can be used as a rubber hardener, electroplating additive, skin preservative and bactericidal agent, hair dye, photographic developer, color photography antioxidant, etc.

[0003] Currently, catechol is mainly obtained through chemical synthesis, but the chemical synthesis process is complex, there are many by-products, and the reaction conditions are difficult to control, which makes the output of catechol always in short supply. The microbial method has gradually attracted attention due to its rapid reaction, suitability for industrial-scale production, environmental protection and solvent-free characteristics. Among them, P. putida KT2440 from the soil has become an excellent base fungus for constructing the lignin conversion pathway because of its multiple metabolic pathways and good tolerance to aromatic substrates.

[0004] Polyethylene terephthalate (PET) is a polyester composed of terephthalic acid (TPA) and ethylene glycol (EG). The incomplete natural decomposition of PET leads to serious environmental problems. Currently, PET is mainly processed by mechanical recycling and chemical recycling, but the cost is high and the benefits are low. Therefore, it is necessary to improve the economic efficiency of PET recycling by converting monomers into products with higher value than PET. Summary of the invention

[0005] In view of this, the technical problem to be solved by the present invention is to provide a strain and a construction method for producing catechol using terephthalic acid.

[0006] The strain provided by the invention is Pseudomonas putida, which expresses phthalate 1,2-dioxygenase, dihydroxy-3,5-cyclohexadiene-1,4-dicarboxylic acid dehydrogenase and protocatechuate decarboxylase.

[0007] The present invention uses phthalate 1,2-dioxygenase (tphA123), dihydroxy-3,5-cyclohexadiene-1,4-dicarboxylic acid dehydrogenase (tphB) and protocatechuate decarboxylase (aroY) in Pseudomonas putida to construct a conversion pathway of terephthalic acid to catechol, broadens the material range of bioconversion of catechol, and achieves a conversion rate of 91.22%.

[0008] The phthalate 1,2-dioxygenase of the present invention is a phthalate 1,2-dioxygenase from Comamonas sp. E6. In the present invention, the phthalate 1,2-dioxygenase is composed of tphA1, tphA2 and tphA3 connected in sequence. The present invention performs codon optimization on the nucleic acid encoding the phthalate 1,2-dioxygenase to make it more consistent with the original genome characteristics of Pseudomonas putida, and adds the RBS sequence TAGAAAACCTCCTTA at the 5' end. The encoding nucleic acid sequence of the phthalate 1,2-dioxygenase is shown in SEQ ID NO: 1.

[0009] The dihydroxy-3,5-cyclohexadiene-1,4-dicarboxylic acid dehydrogenase of the present invention is a dihydroxy-3,5-cyclohexadiene-1,4-dicarboxylic acid dehydrogenase from Comamonas sp.E6; the encoding nucleic acid sequence of the dihydroxy-3,5-cyclohexadiene-1,4-dicarboxylic acid dehydrogenase is shown in SEQ ID NO:2; further, the present invention performs codon optimization on the nucleic acid sequence encoding the dihydroxy-3,5-cyclohexadiene-1,4-dicarboxylic acid dehydrogenase to make it more consistent with the original genome characteristics of Pseudomonas putida, and adds the RBS sequence TAGAAAACCTCCTTA at the 5' end. The encoding nucleic acid sequence of the dihydroxy-3,5-cyclohexadiene-1,4-dicarboxylic acid dehydrogenase is shown in SEQ ID NO:2.

[0010] In the present invention, the sources of protocatechuate decarboxylase are screened, for example: AroY from Enterobactercloacae, Pdc from Klebsiella pneumoniae, and TaGDC from Talaromyces atroroseus. Among the protocatechuate decarboxylases from multiple sources, the protocatechuate decarboxylase from Enterobactercloacae can obtain a higher conversion rate; the present invention performs codon optimization on the nucleic acid encoding protocatechuate decarboxylase to make it more consistent with the original genome characteristics of Pseudomonas putida, and adds the RBS sequence TAGAAAACCTCCTTA at the 5' end. Compared with other optimization schemes, the nucleic acid encoding protocatechuate decarboxylase is better as shown in SEQ ID NO:3.

[0011] The connection sequence of phthalate 1,2-dioxygenase, dihydroxy-3,5-cyclohexadiene-1,4-dicarboxylic acid dehydrogenase and protocatechuate decarboxylase in Pseudomonas putida constructed by the present invention is tphA123, tphB, aroY; or tphA123, aroY, tphB; or tphB, tphA123, aroY; or tphB, aroY, tphA123; or aroY, tphA123, tphB; or aroY, tphB, tphA123.

[0012] In the strain of the present invention, the exogenous gene also carries a promoter. The promoter of phthalate 1,2-dioxygenase is T3 promoter, the promoter of dihydroxy-3,5-cyclohexadiene-1,4-dicarboxylic acid dehydrogenase is T3 promoter, and the promoter of protocatechuate decarboxylase is T3 promoter.

[0013] In addition, T7 promoter, SP6 promoter, CMV (cytomegalovirus) promoter, SV40 (simian virus 40) promoter, U6 promoter, H1 promoter, RSV (Rous sarcoma virus) promoter, β-actin (β-actin) promoter, EF1α (elongation factor 1-α) promoter, and PGK (phosphoglycerate kinase) promoter can also be used.

[0014] In the present invention, the pcaHG gene, catA gene and catA2 gene are knocked out in the Pseudomonas putida. Among them, the pcaHG gene is protocatechuate 3,4-dioxygenase, the catA gene is a catechol degrading enzyme, and the catA2 gene is a catechol degrading enzyme. The present invention uses the Pseudomonas putida with the pcaHG gene, catA gene and catA2 gene knocked out as the base bacteria, and introduces exogenous tphA1, tphA2, tphA3, tphB and aroY genes therein, thereby developing a metabolic pathway for converting aromatic compounds into catechol, and realizing the conversion of terephthalic acid into catechol in Pseudomonas putida.

[0015] Furthermore, the present invention also provides a method for constructing the strain, which comprises:

[0016] A plasmid vector containing a phthalate 1,2-dioxygenase encoding nucleic acid, a dihydroxy-3,5-cyclohexadiene-1,4-dicarboxylate dehydrogenase encoding nucleic acid and a protocatechuate decarboxylase encoding nucleic acid is constructed; and the plasmid vector is transfected or transformed into Pseudomonas putida.

[0017] The construction method of the present invention also includes the step of knocking out the pcaHG gene, catA gene and catA2 gene.

[0018] In the present invention, the plasmid vector is pBBR1MCS-2, or a pUC series vector (e.g., pUC18, pUC19, pUC57), a pTZ series vector (e.g., pTZ19R), a pMD series vector (e.g., PMD18T), a pQE series vector (e.g., pQE30), a pTrc series vector (e.g., pTrcHisA), a pTrx series vector (e.g., pTrxFus), a pRSET series vector (e.g., pRSET-A, pRSET-B), a pVAX series vector (e.g., pVAX1), a pBR series vector (e.g., pBR322), a pbv series vector (e.g., pbv220), a pBluescript II series vector (e.g., pBluescript II KS(+)), L4440 series vectors (e.g., L4440), pCAMBIA series vectors (e.g., pCAMBIA-1301), pMAL series vectors (e.g., pMAL-p2X), and pGD series vectors (e.g., pGD926).

[0019] In some specific embodiments, the plasmid vector for overexpressing tphA1, tphA2, tphA3, tphB and aroY genes in the present invention is pBBR1MCS-2, and the insertion sites of the exogenous fragments are XhoI, BamH I, Hind III. In the present invention, the construction of the plasmid vector adopts the Gibson method.

[0020] In some specific embodiments, the strain is constructed by transformation, and specifically, the strain is constructed by heat shock transformation.

[0021] Furthermore, the present invention also provides a method for preparing catechol, which comprises: fermenting a substrate containing terephthalic acid with the strain as described above to obtain a product containing catechol.

[0022] In the present invention, the concentration of terephthalic acid in the substrate containing terephthalic acid is 1 to 10 mM. For example, the content of terephthalic acid is 3 to 7 mM, and more specifically, the content of terephthalic acid is 3 mM, 4 mM, 5 mM, 5.1 mM, 5.2 mM, 5.3 mM, 5.4 mM, 5.5 mM, 6 mM or 7 mM. Preferably, the substrate containing terephthalic acid is M9 medium containing 5.2 mM terephthalic acid.

[0023] Specifically, each liter of M9 culture medium contains 6.78g / LNa2HPO4, 3.00g / LKH2PO4, 1.00 / LNH4Cl, 0.50g / LNaCl, 0.24g / LMgSO4 and trace elements (0.060g / LFeSO4·7H2O, 0.00270g / LCaCO3, 0.002g / LZnSO4·H2O, 0.00116g / LMnSO4·H2O, 0.00037g / LCoSO4·7H2O, 0.00033g / LCuSO4·5H2O, 0.00008g / LH3BO3).

[0024] In the present invention, the initial inoculation concentration of the strain is OD 600 =1.0, and the fermentation conditions are 180 rpm, 30°C and fermentation for about 72 hours.

[0025] The present invention uses tphA123, tphB and aroY in Pseudomonas putida to construct a conversion pathway of terephthalic acid to catechol, thereby converting terephthalic acid into catechol. The strain has a good catechol yield, and the conversion rate can reach 91.22%. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The method of producing catechol from terephthalic acid

[0027] Figure 2 The fermentation results are shown, wherein the left graph shows the change of terephthalic acid concentration over time, and the right graph shows the change of catechol concentration and yield over time. DETAILED DESCRIPTION

[0028] The present invention provides a strain and a construction method for producing catechol using terephthalic acid. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve the desired effect. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications of this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0029] The test materials used in the present invention are all common commercial products and can be purchased in the market.

[0030] Unless otherwise defined herein, scientific and technical terms related to the present invention shall have the meanings understood by those of ordinary skill in the art.

[0031] In this application, "include", "comprising" and "having" are used interchangeably, and are intended to indicate the inclusiveness of the solution, meaning that the solution may have other elements besides the listed elements. At the same time, it should be understood that the use of "include", "comprising" and "having" descriptions in this article also provides a "consisting of..." solution.

[0032] In this application, the term "and / or" describes the association relationship of associated objects, indicating that there may be three relationships. For example, A and / or B may represent: A exists alone, A and B exist at the same time, and B exists alone. A and B may be singular or plural.

[0033] In this application, "at least one" means one or more, "more than one" means two or more. "At least one of the following" or similar expressions refers to any combination of these items, including any combination of single or plural items.

[0034] The primer sequences used in this article include:

[0035] yz-pBBR1-for:ttacaatttccattcgccattcagg

[0036] yz-pBBR1-rev:ttaatgcagctggcacgaca

[0037] tphA2-BM-F: atcgataccgtcgacctcgagctaagcctgcatttcctggcc

[0038] tphA2-BM-R: gccttgccgctgtagtaaggaggttttctaatgcaagagagc

[0039] tphA3-BM-F:aacctccttaactacagcggcaaggcca

[0040] tphA3-BM-R: gggtaccgggccccccctcgataaggaggttttctaatgatcaacgaga

[0041] tphA1-BM-F:tttagtgagggttaattcctagtggtggccggttgg

[0042] tphA1-BM-R:caggaaatgcaggcttagctcgataaggaggttttctaatgaaccaccag

[0043] tphB-XF:taaagctttatcgataccgtcgacctcgagcctttagtgagggttaattagctaacccggctgtgc

[0044] gccca

[0045] tphB-XR: ctaggaattaaccctcactaaaggctcgataaggaggttttctaatgaccatcgtgcatc

[0046] Gene sequences used in this article (the capitalized underlined part is the ribosome binding site RBS)

[0047] >AroY gene sequence (SEQ ID NO:3)

[0048]

[0049] >tphA3 gene

[0050] aacctccttactacagcggcaaggccatcagagtgtcggtcacggtgctatcgcacacggcgatgcgctcttgcagacgcagcttaccgtcgatggtggtgaacttgtccaggtactcgccgctggcgaacacttcggtttcgccggtgtgcatgatgcgcagcaccatgaacggcgtgctggcgctggcctgagtggcgtcgccgctctggatgcttggcagacccagaatgtggcggtagcgatgacgctcgtagatgttggcttcgcgcagagcgctgatacggtcggtcagcatgtcttggctgtcggcccacacgataccggcggccaggccttcgtcgtggttgtccacgttggtcacgcagtagtggcagtctttggtgaagaaggtcggccactgttccatcgcatcgctgtcgatggtcttggcgtaggcggcgttgaaggcggcgatctggatctcgttgatcatTAGAAAACCTCCTTAtcgagggggggcccggtaccc

[0051] >tphA2 gene

[0052]

[0053] >tphA1 gene

[0054]

[0055] >tphB gene (SEQ ID NO:2)

[0056]

[0057] The plasmid used in this article is pBBR1MCS-2;

[0058] The chassis fungus P. putida KTCA01 used in this article comes from the laboratory (Tianjin University), which is obtained by knocking out the pcaHG gene, catA gene, and catA2 gene of the wild-type Pseudomonas putida.

[0059] The present invention will be further described below in conjunction with embodiments:

[0060] Example 1: Construction of P. putida KTCA01 (taking pcaHG knockout as an example)

[0061] Escherichia coli containing the pSEVA-gRic6T plasmid was cultured overnight in LB medium containing gentamicin to extract the plasmid. The appropriate gRNA was selected on the gene pcaHG, and the obtained pSEVA-gRic6T plasmid was cut into linear fragments with BsaI single enzyme, and the linear fragments and gRNA were connected using T4 DNA ligase, followed by E. coli transformation, which was spread on LB agar plates containing gentamicin and cultured overnight at 37°C. After that, white clones were selected, and the selected single colonies were continued to be cultured overnight in LB medium containing gentamicin, and the plasmid connected with gRNA was extracted, and double enzymes were used to obtain linear fragments. At the same time, Q5 high-fidelity DNA polymerase was used to perform PCR with the wild-type P. putida KT2440 genome as a template to obtain the upper and lower homologous arms of the target gene. The linearized plasmid and the upper and lower homologous arms were assembled through BM seamless cloning, followed by E. coli transformation, and the correct plasmid was extracted and verified.

[0062] The plasmid pCAS-RK2T was electroporated into wild-type Pseudomonas putida, spread on tetracycline agar plates, and the correct strain was inoculated into LB liquid medium supplemented with tetracycline and cultured at 30°C for 12 hours. Subsequently, the strain was transferred to a new LB (tetracycline added) liquid medium supplemented with 6.0 g / L arabinose to induce the expression of λ-Red protein. After 3 hours, the above pSEVA-gRic6T-pcaHG plasmid was electroporated into competent cells and spread on double-resistance (tetracycline + gentamicin) agar plates and cultured overnight at 30°C. Through colony PCR, the correctly edited transformants were screened and inoculated into LB liquid culture medium supplemented with tetracycline and 500mM rhamnose, thereby targeted elimination of pSEVA-gRNAT-pcaHG related plasmids. Then, the strain that lost the pSEVA-gRNAT-pcaHG plasmid was inoculated into LB culture medium containing 10g / L sucrose and 5g / L glucose and cultured for 24h to eliminate the pCAS-RK2T plasmid. The bacterial liquid was then spread on LB agar plates and cultured overnight at 30°C to finally obtain a plasmid-free strain.

[0063] The method for knocking out genes catA and catA2 is as described above, and finally the chassis bacteria P. putida KTCA01 with knockout of pcaHG, catA, and catA2 is obtained.

[0064] Example 2 Construction of Pseudomonas putida KTCA18 capable of producing catechol using terephthalic acid monomer from plastics

[0065] P. putida KTCA01 (ΔpcaHG, ΔcatA, ΔcatA2) was used as the base strain, and the genes of terephthalate 1,2-dioxygenase (tphA123) from Comamonas sp.E6, dihydroxy-3,5-cyclohexadiene-1,4-dicarboxylic acid dehydrogenase (tphB) from Enterobacter cloacae and protocatechuate decarboxylase (AroY) from Enterobacter cloacae were expressed by plasmids to obtain strain KTCA18.

[0066] Experimental process:

[0067] Genes tphA1, tphA2, tphA3, tphB and aroY were synthesized by Beijing Qingke Biotechnology Co., Ltd. and connected to plasmid pUC57.

[0068] The plasmid pBBR1MCS-2 was digested with XhoI and the linearized plasmid fragment was obtained by gel collection. The gene fragment tphA2 was amplified with primers tphA2-BM-F and primers tphA2-BM-R, and the gene fragment tphA3 was amplified with primers tphA3-BM-F and primers tphA3-BM-R. The fragments tphA2 and tphA3 were Gibson assembled with the linearized plasmid fragment, and transformed into competent cells for large intestine to amplify the plasmid, and then coated on LB plates containing 50 mg / L kanamycin. After the empirical bacteria were extracted and sequenced, the correct plasmid P T3 -tphA2A3.

[0069] The plasmid P was cleaved again with XhoI endonuclease. T3- tphA2A3 was digested, and the fragment tphA1 was amplified with primers tphA1-BM-F and tphA1-BM-R, and the fragment tphB was amplified with tphB-XF and tphB-XR. Then, the fragments tphA1 and tphB were overlapped with the above primers tphB-XF and tphA1-BM-R, and the fragments were recovered by gel collection, and Gibson assembly was performed on the linearized plasmid, and the plasmid was amplified by transformation into competent cells of large intestine, and coated on LB plates containing 50 mg / L kanamycin. After empirical bacteria, plasmid extraction, and sequencing, the correct plasmid P T3 -tphA123-P T3 -tphB.

[0070] Plasmid P was cloned with BamHI and HindIII T3 -tphA123-P T3 -tphB and pUC57-aroY were double-digested and ligated with T4 DNA ligase, and transformed into E. coli competent cells to amplify the plasmid, and then coated on LB plates containing 50 mg / L kanamycin. After the bacteria were tested, the plasmid was extracted and sequenced, and the correct plasmid pCA18 (P T3 -aroY-P T3 -tphA123-P T3 -tphB).

[0071] The plasmid was transferred into P. putida KTCA01 by electroporation, and then spread on a solid culture medium containing kanamycin resistance and cultured overnight in an incubator at 30°C. The obtained transformant was inoculated into LB culture medium containing 50 mg / L kanamycin. If it can grow normally, the correct strain P. putida KTCA18 was obtained.

[0072] (2) Fermentation results of terephthalic acid as substrate to catechol

[0073] Pseudomonas putida KTCA18 was inoculated into 5 mL of LB liquid medium containing 50 mg / L kanamycin, and incubated on a shaker at 220 rpm and 30° C. for about 20 hours.

[0074] The strain reaching the logarithmic phase was transferred to a 250 mL shake flask containing 50 mL of M9 mineral medium and 20 g / L glucose. The culture was incubated at 30°C and 180 rpm for about 22 hours.

[0075] The cells were collected by centrifugation at 4,200 rpm for 10 min and the initial inoculation OD was 600 The fermentation was carried out in M9 medium with 5.2 mM terephthalic acid as substrate for 72 h.

[0076] The experimental results are shown in Table 1 and Figure 2 The substrate terephthalic acid was consumed during the fermentation process, the catechol yield was 5.05 mM, and the highest conversion rate reached 91.22%.

[0077] Table 1: Parameters of various substances in the fermentation process

[0078]

[0079] The above are only preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Pseudomonas putida, which expresses phthalate 1,2-dioxygenase, dihydroxy-3,5-cyclohexadiene-1,4-dicarboxylate dehydrogenase and protocatechuate decarboxylase.

2. The Pseudomonas putida according to claim 1, characterized in that The phthalate 1,2-dioxygenase is from Comamonas sp. E6; The dihydroxy-3,5-cyclohexadiene-1,4-dicarboxylate dehydrogenase is from Comamonas sp. E6; The protocatechuate decarboxylase is from Enterobacter cloacae.

3. The Pseudomonas putida according to claim 2, characterized in that The phthalate 1,2-dioxygenase consists of tphA1, tphA2 and tphA3 linked in sequence.

4. The Pseudomonas putida according to any one of claims 1 to 3, characterized in that The nucleic acid sequence encoding the phthalate 1,2-dioxygenase is shown in SEQ ID NO: 1; The nucleic acid sequence encoding the dihydroxy-3,5-cyclohexadiene-1,4-dicarboxylate dehydrogenase is shown in SEQ ID NO: 2; The nucleic acid sequence encoding the protocatechuate decarboxylase is shown in SEQ ID NO:

3.

5. The Pseudomonas putida according to any one of claims 1 to 4, characterized in that Among them, the pcaHG gene, catA gene and catA2 gene were knocked out.

6. A method for constructing the strain according to any one of claims 1 to 5, comprising: A plasmid vector containing a phthalate 1,2-dioxygenase encoding nucleic acid, a dihydroxy-3,5-cyclohexadiene-1,4-dicarboxylate dehydrogenase encoding nucleic acid and a protocatechuate decarboxylase encoding nucleic acid is constructed; and the plasmid vector is transfected or transformed into Pseudomonas putida.

7. The construction method according to claim 6, characterized in that: The method also includes the step of knocking out the pcaHG gene, catA gene and catA2 gene.

8. A method for preparing catechol, comprising: A substrate containing terephthalic acid is fermented with the strain described in any one of claims 1 to 5 to obtain a product containing catechol.

9. The preparation method according to claim 8, characterized in that: In the substrate containing terephthalic acid, the concentration of terephthalic acid is 1-10 mM.

10. The preparation method according to claim 8, characterized in that: The substrate containing terephthalic acid is M9 medium containing 5.2 mM terephthalic acid.

Images