Variant of T7 RNA polymerase and application thereof

Abstract

The invention discloses a variant of T7 RNA polymerase and application of the variant. The variant of the T7 RNA polymerase is obtained by mutation on the basis of a natural T7 RNA polymerase, and the mutation site comprises any one or a combination of more of M362V, D421S, D421M, F432T, I543V, I543D, G603E, T636V, Y639F, E652A, E652I, D660E, D660D, H725R, V727I, V727A and D731S. According to the variant of the T7 RNA polymerase, the compatibility of the variant to a complex sample and a crude sample is obviously improved, the amplification efficiency and sensitivity of the complex sample are effectively improved, and compared with natural T7 RNA polymerase, the variant of the T7 RNA polymerase shows higher amplification efficiency and detection sensitivity.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and proteomics, and specifically relates to a variant of T7 RNA polymerase and application thereof. Background Art

[0002] NASBA (Nucleic Acid Sequence-Based Amplification) is a nucleic acid sequence-based amplification technology. It is an isothermal nucleic acid amplification detection method that relies on RNA templates and can observe results in real time. Among them, bacteriophage T7 RNA polymerase is an important component, responsible for synthesizing RNA through specific binding sites using double-stranded DNA as a template. Molecular beacon probes are used to identify newly synthesized single-stranded RNA to achieve real-time monitoring of fluorescent signals. This technology, which reacts at 42°C, can quickly amplify the template RNA by about 10 9 ~10 12 This technology is widely used in the detection of various pathogenic microorganisms, especially in the detection of viruses, bacteria, molds, parasites and cytokines, and especially in the detection of RNA viruses such as HIV and hepatitis C virus.

[0003] Currently, when faced with complex or rough samples, the natural T7 RNA polymerase exhibits disadvantages such as low amplification efficiency, slow reaction speed, and insufficient sensitivity. It cannot meet the genetic testing needs of rough samples, which seriously affects the development and application of this technology. Summary of the invention

[0004] The main purpose of the present invention is to provide a variant of T7 RNA polymerase and its application to overcome the shortcomings of the prior art.

[0005] In order to achieve the above-mentioned invention object, the technical solution adopted by the present invention includes: An embodiment of the present invention provides a variant of a T7 RNA polymerase, wherein the variant of the T7 RNA polymerase is obtained by mutation based on a natural T7 RNA polymerase, wherein the mutation site includes any one or more combinations of M362V, D421S, D421M, F432T, I543V, I543D, G603E, T636V, Y639F, E652A, E652I, D660E, D660D, H725R, V727I, V727A, and D731S.

[0006] The embodiments of the present invention also provide the use of the aforementioned T7 RNA polymerase variant in nucleic acid amplification.

[0007] The embodiments of the present invention also provide reagents, test papers, and kits comprising the aforementioned variants of T7 RNA polymerase.

[0008] An embodiment of the present invention further provides a nucleic acid amplification method, which comprises: using the aforementioned variant of the T7 RNA polymerase to amplify a sample containing an RNA virus.

[0009] Compared with the prior art, the beneficial effects of the present invention are: the variant of the T7 RNA polymerase provided by the present invention significantly improves the compatibility with complex samples and rough samples, effectively improves the amplification efficiency and sensitivity facing complex samples, and shows higher amplification efficiency and detection sensitivity compared to the natural T7 RNA polymerase. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0011] Figure 1 is a diagram of the key active region of the T7 RNA polymerase domain in a typical embodiment of the present invention; Figure 2 is a distribution diagram of mutation sites in a typical embodiment of the present invention; Figure 3 This is a graph showing different efficiencies of 1000 different mutants of influenza B virus in nasba amplification in Example 3 of the present invention; Figure 4 This is a graph showing different efficiencies of 500 different mutants of influenza B virus in nasba amplification in Example 3 of the present invention; Figure 5 This is a graph showing different efficiencies of 100 different mutants of influenza B virus in nasba amplification in Example 3 of the present invention; Figure 6 This is a graph showing different efficiencies of 50 different mutants of influenza B virus in nasba amplification in Example 3 of the present invention; Figure 7 This is a graph showing different efficiencies of 10 different mutants of influenza B virus in NASBA amplification in Example 3 of the present invention. DETAILED DESCRIPTION

[0012] In view of the defects of the prior art, the inventor of this case has proposed the technical solution of the present invention after long-term research and extensive practice. The technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0013] Specifically, as one aspect of the technical solution of the present invention, a variant of T7 RNA polymerase involved therein is obtained by mutation based on natural T7 RNA polymerase, wherein the mutation site includes any one or more combinations of M362V, D421S, D421M, F432T, I543V, I543D, G603E, T636V, Y639F, E652A, E652I, D660E, D660D, H725R, V727I, V727A, and D731S.

[0014] The mutant in the present invention is a mutant sequence obtained by genetic engineering means based on the natural T7 RNA polymerase sequence according to the PDB crystal structure and semi-rational deduction of key active amino acid sites.

[0015] In some preferred embodiments, the nucleic acid sequence encoding the natural T7 RNA polymerase is shown as SEQ ID NO:1, and the amino acid sequence of the natural T7 RNA polymerase is shown as SEQ ID NO:2.

[0016] In some preferred embodiments, the mutation sites include M362V D421S, T636V, H725R, V727A and D731S.

[0017] In some preferred embodiments, the nucleic acid sequence encoding the variant of T7 RNA polymerase is shown as SEQ ID NO:3, and the amino acid sequence of the variant of T7 RNA polymerase is shown as SEQ ID NO:4.

[0018] In some preferred embodiments, the mutation sites include M362V, F432T I543V, G603E, V727I and D731S.

[0019] In some preferred embodiments, the nucleic acid sequence encoding the variant of T7 RNA polymerase is shown as SEQ ID NO:5, and the amino acid sequence of the variant of T7 RNA polymerase is shown as SEQ ID NO:6.

[0020] In some preferred embodiments, the mutation sites include D421M F432T I543V, Y639F and E652A.

[0021] In some preferred embodiments, the nucleic acid sequence encoding the variant of T7 RNA polymerase is shown as SEQ ID NO:7, and the amino acid sequence of the variant of T7 RNA polymerase is shown as SEQ ID NO:8.

[0022] In some preferred embodiments, the mutation sites include F432T T636V, Y639F, H725R, V727A and D731S.

[0023] In some preferred embodiments, the nucleic acid sequence encoding the variant of T7 RNA polymerase is shown as SEQ ID NO:9, and the amino acid sequence of the variant of T7 RNA polymerase is shown as SEQ ID NO:10.

[0024] In some preferred embodiments, the mutation sites include G603E, T636V, E652I, D660E, V727I and D731S.

[0025] In some preferred embodiments, the nucleic acid sequence encoding the variant of T7 RNA polymerase is shown as SEQ ID NO:11, and the amino acid sequence of the variant of T7 RNA polymerase is shown as SEQ ID NO:12.

[0026] The present invention modifies the mutation of part of the deoxyribonucleic acid sequence by means of genetic engineering, constructs the mutated sequence into an artificial expression vector, and obtains the mutated T7 RNA polymerase mutant protein by expression in Escherichia coli, and then obtains a variant of the T7 RNA polymerase with higher purity by protein purification technology. Its performance is verified by NASBA amplification, and it shows better performance than the natural T7 RNA polymerase.

[0027] T7 RNA polymerase is an RNA polymerase from T7 bacteriophage that uses ribonucleic acid as a substrate to synthesize long RNA chains. Its PDB structure (https: / / doi.org / 10.2210 / pdb1H38 / pdb) shows that it contains a DNA guide domain and an RNA polymerase domain. The present invention semi-rationally infers the amino acid positions of the active center sites in different domains through the study of its domain and spatial structure, and changes the relevant activity of T7 RNA polymerase by changing the amino acid residues. This change includes changing the residue to NH4 + Modified to acidic amino acid COOH -Or it can be modified to -OH or uncharged -CH4. The modified amino acid changes its charge, and its ability to bind to double-stranded DNA or its ability to synthesize RNA changes, which manifests as different synthesis speeds or anti-inhibition capabilities when synthesizing new RNA chains.

[0028] The mutation site in the present invention is obtained by semi-rational inference and genetic engineering. Since T7 RNA polymerase itself has specific recognition for the T7 promoter region, the sequence obtained by genetic engineering will be constructed in the artificial expression vector of T5Promoter. The expression is carried out in genetic engineering bacteria whose host cells are Escherichia coli. The enzyme with a purity of 95% is obtained by AKTA protein purification instrument. The performance is verified by NASBA amplification.

[0029] The sites of T7 RNA polymerase mutation in the present invention include M362V, D421S, D421M, F432T, I543V, I543D, G603E, T636V, Y639F, E652A, E652I, D660E, D660D, H725R, V727I, V727A and D731S sites. In practical applications, a combination of several or more of the mutants can be used, which can be: M0: wild type (i.e., natural T7 RNA polymerase, without mutation); M1: M362V, D421S, T636V, H725R, V727A and D731S; M2: M362V, F432T, I543V, G603E, V727I and D731S; M3: D421M, F432T, I543V, Y639F, E652A; M4: F432T, T636V, Y639F, H725R, V727A, and D731S; M5: G603E, T636V, E652I, D660E, V727I and D731S; Different combinations of mutants showed different differences in the amplification of nasba, among which the combination of scheme 1 (M1) and scheme 2 (M2) were the best.

[0030] Specific implementation schemes are shown in Examples 1-7; In the sequence, A: deoxyadenine nucleotide (abbreviated as deoxyadenosine), T: deoxythymidine nucleotide (abbreviated as deoxythymidine), C: deoxycytosine nucleotide (abbreviated as deoxycytidine), and G: deoxyguanine nucleotide (abbreviated as deoxyguanosine).

[0031] SEQ ID NO: 1 is the natural T7 RNA polymerase nucleic acid sequence.

[0032] SEQ ID NO: 2 is the amino acid sequence of natural T7 RNA polymerase.

[0033] SEQ ID NO:3 Mutant M1 nucleic acid sequence.

[0034] SEQ ID NO:4 Mutant M1 amino acid sequence.

[0035] SEQ ID NO:5 Mutant M2 nucleic acid sequence.

[0036] SEQ ID NO:6 Mutant M2 amino acid sequence.

[0037] SEQ ID NO:7 Mutant M3 nucleic acid sequence.

[0038] SEQ ID NO: 8 Mutant M3 amino acid sequence.

[0039] SEQ ID NO:9 Mutant M4 nucleic acid sequence.

[0040] SEQ ID NO: 10 Mutant M4 amino acid sequence.

[0041] SEQ ID NO: 11 mutant M5 nucleic acid sequence.

[0042] SEQ ID NO: 12 Mutant M5 amino acid sequence.

[0043] The T7 RNA polymerase mutation sites in the present invention include one or more mutations in all mutation sites of M362V, D421S, D421M, F432T, I543V, I543D, G603E, T636V, Y639F, E652A, E652I, D660E, D660D, H725R, V727I, V727A and D731S, which can improve the amplification of complex samples by T7 RNA polymerase.

[0044] The T7 RNA polymerase mutation sites in the present invention include M362V, D421S, D421M, F432T, I543V, I543D, G603E, T636V, Y639F, E652A, E652I, D660E, D660D, H725R, V727I, V727A and D731S, which all significantly improve the sensitivity of NASBA for complex sample amplification in NASBA amplification.

[0045] Compared with the natural sequence, the mutant T7 RNA polymerase of the present invention has amino acid mutations at the positions of M362V, D421S, D421M, F432T, I543V, I543D, G603E, T636V, Y639F, E652A, E652I, D660E, D660D, H725R, V727I, V727A and D731S, wherein the mutation schemes M1, M2, M3, M4 and M5 all improve the sensitivity of NASBA amplification and the compatibility with crude samples to varying degrees (the schematic diagram of the mutation site distribution map of M1, M2, M3, M4 and M5 is shown in FIG. Figure 2 as shown).

[0046] Another aspect of the embodiments of the present invention further provides use of the aforementioned T7 RNA polymerase variant in nucleic acid amplification.

[0047] Another aspect of the embodiments of the present invention further provides a reagent, a test paper, and a kit comprising the aforementioned variant of the T7 RNA polymerase.

[0048] Another aspect of an embodiment of the present invention further provides a nucleic acid amplification method, which includes: using the aforementioned variant of the T7 RNA polymerase to amplify a sample containing an RNA virus.

[0049] The technical solution of the present invention is further described in detail below in conjunction with several preferred embodiments and drawings. This embodiment is implemented on the premise of the technical solution of the invention, and a detailed implementation method and specific operation process are given, but the protection scope of the present invention is not limited to the following embodiments.

[0050] Unless otherwise specified, the experimental materials used in the following examples can be purchased from conventional biochemical reagent companies.

[0051] Example 1 T7 RNA polymerase vector construction The sequences designed in the present invention are based on the PDB structure of T7 RNA polymerase (https: / / doi.org / 10.2210 / pdb1H38 / pdb). It can be seen that the results include a DNA guide domain and an RNA polymerase domain such as Figure 1 , through the study of its domain and spatial structure, semi-rational inference. By modifying the sequence of ribonucleic acid bases in the natural T7 RNA polymerase nucleic acid sequence, a mutant of T7 RNA polymerase is obtained. The specific nucleic acid sequence is as follows: SEQ ID NO: 1 is the natural T7 RNA polymerase nucleic acid sequence; SEQ ID NO:3 mutant M1 nucleic acid sequence; SEQ ID NO:5 mutant M2 nucleic acid sequence; SEQ ID NO:7 mutant M3 nucleic acid sequence; SEQ ID NO:9 mutant M4 nucleic acid sequence; SEQ ID NO: 11 mutant M5 nucleic acid sequence.

[0052] Different mutants were constructed in pET28 vector, the restriction sites selected were BglⅡ and Xho I, and T5 promoter (including T5 promoter and 6×His tag) was added before T7 RNA polymerase nucleic acid sequence, as shown in SEQ ID NO: 13, wherein the plasmids of different mutants can be synthesized by biological companies according to requirements and cloned in pET28 vector.

[0053] The constructed plasmid was transformed into BL21 peptide-sensitive cells.

[0054] Specific steps: Take 1 μl of 50 ng / μl plasmid and add it to 100 μl BL21 peptide competent cells and let it stand on ice for 5 min.

[0055] Incubate at 42°C for 90 seconds and quickly place on ice for 10 minutes.

[0056] Add fresh resistance-free LB liquid medium to the peptide-competent cells.

[0057] Incubate at 37°C in a constant temperature shaker at 150 rpm for 1 h.

[0058] Take 100 μl of the cultured bacterial solution and spread it evenly on the kanamycin-resistant LB solid plate culture medium using a spreading rod.

[0059] Invert and place in a constant temperature incubator at 37°C for 12 hours.

[0060] Example 2 Expression and purification of T7 RNA polymerase Expression of T7 RNA polymerase: Pick the monoclonal colony on the kanamycin-resistant LB solid medium into 150 ml / bottle LB liquid medium and add 150 μl 100 mg / ml ampicillin, place in a constant temperature shaking incubator at 200 rpm and 37°C for 16 h.

[0061] Take 10 ml of the cultured bacteria and inoculate it into 1 L / bottle LB liquid culture medium, add 1 ml of 100 mg / ml kanamycin, seal the bottle mouth with sealing film, and place it in a constant temperature shaking incubator at 200 rpm and 37°C for about 4 hours.

[0062] Take 1 ml of bacterial solution from 1 L / bottle of LB liquid culture solution, monitor the absorbance of the bacterial solution at a wavelength of 600 nm with a spectrophotometer. When it is between 0.8-1.0, add 1 ml of 1 M IPTG to each bottle of bacterial solution, set the constant temperature shaking incubator to 200 rpm, and continue culturing at 16°C for 16 hours.

[0063] Collect the bacteria by centrifugation at 10000rpm and take the supernatant.

[0064] Purification of T7 RNA polymerase 1. Weigh 20 g of T7 RNA polymerase and mutant wet bacteria into a 200 ml glass beaker.

[0065] 2. Use a measuring bucket to measure 100 ml of Lysis buffer (Lysis buffer: 50 mM KH2PO4, 5% glycerol, pH: 6.0) and pour it into a beaker. Stir with a magnetic stirrer until there are no lumps of bacteria.

[0066] 3. Slowly pour the resuspended bacterial solution into the sample cup of the high-pressure homogenizer, set the speed to 50 and the pressure to 800-1000 bar; start crushing, collect the crushed liquid, and centrifuge at 12000rpm and 4℃ for 15min.

[0067] 4. Transfer the supernatant to a clean beaker and filter using a 0.22 μm filter membrane.

[0068] 5. After equilibration of the SP-HP column with Lysis buffer, load the supernatant onto the column.

[0069] 6. After loading, balance again until the UV detection value reaches equilibrium.

[0070] 7. Elute with elution buffer (50 mM KH2PO4, 5% glycerol, 1 M NaCl, pH: 6.0) for 15 column volumes in a linear gradient.

[0071] 8. Collect the eluted peak and pass it through nickel column affinity chromatography.

[0072] 9. Equilibrate the nickel affinity chromatography column with binding buffer.

[0073] 10. After equilibrium, the protein collected by the SP column is loaded onto a nickel column affinity chromatography column. 11. Elute with elution buffer (50 mM KH2PO4, 5% glycerol, 0.5 M NaCl, 250 mM imidazole, pH: 7.6) for 15 column volumes in a linear gradient.

[0074] 12. Pass the peak eluted from the nickel column through a gel filtration column.

[0075] Example 3 Comparison of the sensitivity of different mutants of T7 RNA polymerase in NASBA amplification Preparation of Ureaplasma urealyticum template: The concentration of the national standard product of Ureaplasma urealyticum inactivated virus purchased in this experimental template is 10 8 / ml, and different concentrations of Ureaplasma urealyticum standards were diluted and added to 50ul of lysis buffer to make crude Ureaplasma urealyticum for NASBA amplification, where 5×Nasba buffer (125mMtris 100mMKCL, 40mM MgCl2, 20mM DTT, 0.2%Triton X-100, 20%DMSO) NTPs and dNTPs were purchased from Kangwei Century, MLV and RNaseH were purchased from Invitrogen, and primers (UU-16sRNA-F, as shown in SEQ ID NO: 14; UU-16sRNA-R, as shown in SEQ ID NO: 15) and probes (UU-16sRNA-probe, as shown in SEQ ID NO: 16) were synthesized at Shanghai Jierui Biotechnology Co., Ltd. The sequence is: UU-16sRNA-F: TAATACATAGGATGCAAGC; UU-16sRNA-R: AATTCTAATACGACTCACTATAGGGAGATTGATACAGCTAGACGTTAA; UU-16sRNA-probe: FAM-CGCACCCGGGUUUGUAAGUUUGGUAGGUGCG-Dabcal.

[0076] Configure the NASBA reaction system according to the following table. The Nasba reaction system is:

[0077] The reaction temperature was 42°C for 40 min, and the signal was collected every 30 s.

[0078] Figure 3 The results are shown in the following table:

[0079] In the sample with 1000 Ureaplasma urealyticum as the standard, the amplification curves of mutants M3, M2, and M1 were similar, but significantly better than mutants M5, M4, and wild-type M0. Figure 4 The results are shown in the following table:

[0080] Among the 500 samples of Ureaplasma urealyticum, the mutants M1 and M2 are relatively close and significantly better than the wild-type M0, M3, M4, and M5. Figure 5 The results are as follows:

[0081] Among the 100 samples of Ureaplasma urealyticum, mutants M and M2 are relatively close and significantly better than wild-type M0, M3, M4, and M5. Figure 6 The results are shown in the following table:

[0082] Among the 50 samples of Ureaplasma urealyticum, the mutants M2 and M3 were relatively close and significantly better than the wild-type M0, M3, M4, and M5. Figure 7 The results are as follows:

[0083] Among the 10 samples of Ureaplasma urealyticum, the mutant M2 is relatively close and significantly better than the wild type M0 and other mutants. Comprehensive results show that from the NASBA amplification results of templates of different concentrations, the combination of mutant M2 has the best amplification effect, which is better than M1 and significantly better than the wild type M0. Therefore, the combination of M2 mutants significantly improves the amplification effect of T7 RNA polymerase on RNA crude extracts.

[0084] In addition, the inventors of this case also referred to the aforementioned embodiments and conducted experiments with other raw materials, process operations, and process conditions described in this specification, and obtained relatively ideal results.

[0085] It should be understood that the technical solution of the present invention is not limited to the above-mentioned specific implementation cases. Any technical deformation made according to the technical solution of the present invention without departing from the scope of protection of the purpose of the present invention and the claims shall fall within the protection scope of the present invention.

Claims

1. A variant of T7 RNA polymerase, characterized in that: The variant of T7 RNA polymerase is obtained by mutation based on natural T7 RNA polymerase, wherein the mutation site includes any one or more combinations of M362V, D421S, D421M, F432T, I543V, I543D, G603E, T636V, Y639F, E652A, E652I, D660E, D660D, H725R, V727I, V727A, and D731S.

2. The variant of T7 RNA polymerase according to claim 1, characterized in that: The nucleic acid sequence encoding the natural T7 RNA polymerase is shown in SEQ ID NO:1, and the amino acid sequence of the natural T7 RNA polymerase is shown in SEQ ID NO:

2.

3. The variant of T7 RNA polymerase according to claim 1, characterized in that: The mutation sites include M362VD421S, T636V, H725R, V727A and D731S; And / or, the nucleic acid sequence encoding the variant of T7 RNA polymerase is shown as SEQ ID NO:3, and the amino acid sequence of the variant of T7 RNA polymerase is shown as SEQ ID NO:

4.

4. The variant of T7 RNA polymerase according to claim 1, characterized in that: The mutation sites include M362V, F432T I543V, G603E, V727I and D731S; And / or, the nucleic acid sequence encoding the variant of T7 RNA polymerase is shown as SEQ ID NO:5, and the amino acid sequence of the variant of T7 RNA polymerase is shown as SEQ ID NO:

6.

5. The variant of T7 RNA polymerase according to claim 1, characterized in that: The mutation sites include D421MF432T I543V, Y639F and E652A; And / or, the nucleic acid sequence encoding the variant of T7 RNA polymerase is shown as SEQ ID NO:7, and the amino acid sequence of the variant of T7 RNA polymerase is shown as SEQ ID NO:

8.

6. The variant of T7 RNA polymerase according to claim 1, characterized in that: The mutation sites include F432TT636V, Y639F, H725R, V727A and D731S; And / or, the nucleic acid sequence encoding the variant of T7 RNA polymerase is shown as SEQ ID NO:9, and the amino acid sequence of the variant of T7 RNA polymerase is shown as SEQ ID NO:

10.

7. The variant of T7 RNA polymerase according to claim 1, characterized in that: The mutation sites include G603E, T636V, E652I, D660E, V727I and D731S; And / or, the nucleic acid sequence encoding the variant of T7 RNA polymerase is shown as SEQ ID NO:11, and the amino acid sequence of the variant of T7 RNA polymerase is shown as SEQ ID NO:

12.

8. Use of the variant of T7 RNA polymerase according to any one of claims 1 to 7 in nucleic acid amplification.

9. A reagent, a test paper, or a kit comprising the variant of T7 RNA polymerase according to any one of claims 1 to 7.

10. A method for nucleic acid amplification, characterized in that: include: A sample containing RNA viruses is amplified using the variant of T7 RNA polymerase described in any one of claims 1 to 7.

Images