Long-chain non-coding RNA (Ribonucleic Acid) and application of long-chain non-coding RNA in regulation and control of plant cold tolerance

Abstract

The invention discloses a long-chain non-coding RNA (Ribonucleic Acid) and application thereof in regulation and control of plant cold tolerance. The name of the long-chain non-coding RNA is nc1850, and the long-chain non-coding RNA is any one of the following (a1)-(a3): (a1) RNA as shown in a sequence 1; (a2) RNA which is obtained by substitution and / or deletion and / or addition of one or more nucleotide residues on the nucleotide sequence as shown in the sequence 1 and has the same function; (a3) is RNA which has 80% or more homology with the nucleotide sequence defined by (a1) or (a2) and has the same function as the nucleotide sequence defined by (a1) or (a2). The cold resistance of nc1850 overexpression rice and the cold resistance of wild rice are analyzed and compared, and it is found that the cold resistance of the nc1850 overexpression rice is lower than that of the wild rice. Therefore, the nc1850 can negatively regulate the low-temperature stress resistance of the plant. The invention is of great significance to the cultivation of new varieties of cold-tolerant plants.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a long-chain non-coding RNA and an application thereof in regulating plant cold tolerance. Background Art

[0002] Rice is the largest food crop in my country, and about two-thirds of the country's population relies on rice for food. The Northeastern cold rice-growing area is the main japonica rice production base in my country, accounting for 43% of the country's total japonica rice area and 40% of the country's total japonica rice output. It plays a vital role in ensuring my country's food security. Due to its geographical location, low temperature and cold damage often occurs in the Northeastern rice area, which is the main factor restricting the production of cold-region rice. In particular, Heilongjiang Province suffers from a large low temperature and cold damage every 3 to 5 years, each time causing a reduction of more than 30%, making it difficult to maintain stable rice production. Therefore, improving rice cold tolerance is of great strategic significance to ensure high and stable yields of cold-region rice, and analyzing the molecular regulatory mechanism of rice cold tolerance provides important guidance for the genetic improvement of rice cold tolerance traits and cold tolerance molecular breeding.

[0003] Plant tolerance to cold stress is a complex genetic trait controlled by multiple genes / quantitative trait loci. Compared with other agronomic traits, genetic research on rice cold tolerance has progressed slowly, and only a few cold tolerance genes have been identified. Most of them are transcription factor and protein kinase genes, and there are few reports on non-coding RNA in the process of abiotic stress response. Summary of the invention

[0004] The technical problem to be solved by the present invention is how to regulate the cold tolerance of plants.

[0005] In order to solve the above technical problems, the present invention first provides a long non-coding RNA derived from rice, which is named nc1850 in the present invention and is any one of the following (a1)-(a3):

[0006] (a1) RNA shown in sequence 1;

[0007] (a2) RNA having the same function as the nucleotide sequence shown in SEQ ID NO: 1 after one or more nucleotide residues are substituted and / or deleted and / or added;

[0008] (a3) RNA having 99% or more, 95% or more, 90% or more, 85% or more or 80% homology with the nucleotide sequence defined in (a1) or (a2) and having the same function.

[0009] In order to solve the above technical problems, the present invention further provides a DNA encoding the above long-chain non-coding RNA.

[0010] The DNA encoding the long non-coding RNA provided by the present invention is any one of the following (b1)-(b3):

[0011] (b1) DNA shown in Sequence 2;

[0012] (b2) a DNA having the same function as the nucleotide sequence shown in SEQ ID NO: 2 after one or more nucleotide residues have been replaced and / or deleted and / or added;

[0013] (b3) A DNA having 99% or more, 95% or more, 90% or more, 85% or more or 80% homology with the nucleotide sequence defined in (b1) or (b2) and having the same function.

[0014] In order to solve the above technical problems, the present invention also provides an expression cassette, a recombinant vector or a recombinant bacterium containing the above long-chain non-coding RNA or the above DNA.

[0015] The expression cassette may be a DNA capable of expressing the long non-coding RNA in a host cell, and may specifically be composed of a promoter, the DNA and a transcription termination sequence.

[0016] The recombinant vector may be a recombinant expression vector or a recombinant cloning vector. In the present invention, the recombinant vector is specifically a recombinant plasmid pCAMBIA3301-nc1850 obtained by replacing the small fragment between the NcoI and BstEII restriction sites in the pCAMBIA3301 vector with the DNA.

[0017] The recombinant bacteria may be bacteria containing the above expression cassette or the above recombinant vector. In the present invention, the recombinant bacteria is specifically Agrobacterium tumefaciens EHA105 containing the above recombinant plasmid pCAMBIA3301-nc1850.

[0018] In order to solve the above technical problems, the present invention also provides new uses of the above long-chain non-coding RNA or the above DNA or the above expression cassette, recombinant vector or recombinant bacteria.

[0019] The present invention provides the use of the long-chain non-coding RNA or the DNA or the expression cassette, recombinant vector or recombinant bacteria in regulating plant stress tolerance or plant breeding.

[0020] In the above application, the regulating plant stress tolerance is to increase plant stress tolerance or reduce plant stress tolerance.

[0021] The regulation mode is negative regulation, that is, when the expression level of the above-mentioned long-chain non-coding RNA in the plant increases, the stress tolerance of the plant decreases, and when the expression level of the above-mentioned long-chain non-coding RNA in the plant decreases, the stress tolerance of the plant increases.

[0022] In some embodiments, when the expression level of the above-mentioned long non-coding RNA in the plant increases, the cold tolerance of the plant decreases, which is specifically manifested as: when the expression level of the above-mentioned long non-coding RNA in the plant increases, the survival rate of the plant after cold stress decreases, the number of fertile pollen grains decreases, and the fruit setting rate decreases.

[0023] In order to solve the above technical problems, the present invention also provides a new use of a substance for reducing the expression amount of the above long non-coding RNA.

[0024] The present invention provides the use of a substance for reducing the expression amount of the long-chain non-coding RNA in improving plant stress tolerance or plant breeding.

[0025] The substance that reduces the expression amount of the above-mentioned long-chain non-coding RNA includes a substance that knocks out the DNA encoding the above-mentioned long-chain non-coding RNA or a substance that inhibits the expression of the DNA encoding the above-mentioned long-chain non-coding RNA.

[0026] The material for knocking out the DNA encoding the long non-coding RNA can be a material that achieves that the host cell does not produce a functional nc1850 product in any way, such as removing all or part of the coding gene sequence, introducing mutations so that no functional long non-coding RNA is produced, removing or changing the regulatory components (such as promoter editing) so that the coding gene sequence is not transcribed, etc. Usually, the knockout is performed at the genomic DNA level, so that the offspring of the cell also permanently carry the knockout. Further, the material for knocking out the DNA encoding the long non-coding RNA can be a material that causes the DNA encoding the long non-coding RNA in the plant to mutate (the mutation form can be a deletion mutation and / or an insertion mutation and / or a base substitution) to lose activity, and the mutation method can be any method known in the art, such as EMS mutagenesis, gene editing (zinc finger protein ZFN gene editing, TALENs gene editing, CRISPR / Cas9 gene editing), T-DNA insertion, etc.

[0027] The substance that inhibits the expression of the DNA encoding the long non-coding RNA can be any substance that can interfere with the expression of the DNA encoding the long non-coding RNA, such as inhibiting the expression of the DNA by RNAi.

[0028] In any of the above applications, the purpose of the plant breeding is to cultivate stress-resistant plant varieties (such as cold-resistant plant varieties).

[0029] In order to solve the above technical problems, the present invention finally provides a method for cultivating plants with improved stress tolerance and a method for cultivating plants with reduced stress tolerance.

[0030] The method for cultivating plants with improved stress tolerance provided by the present invention comprises the following steps: reducing the expression level of the long-chain non-coding RNA in a recipient plant to obtain a transgenic plant; the stress tolerance of the transgenic plant is higher than that of the recipient plant.

[0031] Furthermore, reducing the expression level of the long non-coding RNA in the recipient plant can be achieved by knocking out or inhibiting the expression of the DNA encoding the long non-coding RNA in the recipient plant.

[0032] Furthermore, knocking out or inhibiting the expression of the DNA encoding the above-mentioned long non-coding RNA in the recipient plant can be achieved by any technical means that can achieve this purpose, such as specifically editing the DNA by sequence-specific nucleases (such as CRISPR / Cas9 nucleases) to knock out its expression in the recipient plant, or inhibiting the expression of the DNA by RNAi means, etc.

[0033] The method for cultivating plants with reduced stress tolerance provided by the present invention comprises the following steps: increasing the expression level of the long-chain non-coding RNA in a recipient plant to obtain a transgenic plant; the stress tolerance of the transgenic plant is lower than that of the recipient plant.

[0034] Furthermore, the method for increasing the expression level of the long non-coding RNA in the recipient plant can be achieved by introducing DNA encoding the long non-coding RNA into the recipient plant.

[0035] Furthermore, the stress tolerance of the transgenic plant is lower than that of the recipient plant, which is manifested in any one of the following K1)-K3):

[0036] K1) under cold stress conditions (such as 4° C.), the survival rate of the transgenic plant is lower than that of the recipient plant;

[0037] K2) under cold stress conditions (e.g., 15° C.), the number of fertile pollen grains of the transgenic plant is lower than that of the recipient plant;

[0038] K3) Under cold stress conditions (such as 15° C.), the fruit setting rate of the transgenic plant is lower than that of the recipient plant.

[0039] Furthermore, the DNA can be introduced into the recipient plant through a recombinant vector. The recombinant vector can be constructed using an existing plant expression vector. The plant expression vector includes a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment, etc. Such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb, etc. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, or any selective marker gene can be not added, and the transformed plant can be directly screened by adversity.

[0040] In some embodiments, the recombinant vector is specifically the above-mentioned recombinant plasmid pCAMBIA3301-nc1850.

[0041] In any of the above methods, a recombinant vector carrying the DNA encoding the above-mentioned long non-coding RNA or a gene editing tool used to knock out or inhibit the expression of the DNA encoding the above-mentioned long non-coding RNA in the recipient plant is introduced into the recipient plant. Plant cells or tissues can be transformed through conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated, etc., and the transformed plant tissues are cultivated into plants.

[0042] In any of the above applications or methods, the stress resistance is cold resistance.

[0043] In any of the above applications or methods, the plant is a monocot or a dicot. Further, the monocot is a Gramineae plant. Still further, the Gramineae plant is a Rice plant. Still further, the Rice plant is Rice (such as Kenjing No. 8).

[0044] The present invention analyzes and compares the cold tolerance of nc1850 overexpressing rice and wild rice Kenjing 8 and finds that the cold tolerance of nc1850 overexpressing rice is lower than that of wild rice Kenjing 8. This indicates that nc1850 negatively regulates the ability of plants to tolerate low temperature stress. The present invention is of great significance for breeding new varieties of cold-tolerant plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 This is the cold stress expression pattern of nc1850.

[0046] Figure 2 This is the clone of the nc1850 transcript.

[0047] Figure 3 To obtain and identify rice overexpressing nc1850.

[0048] Figure 4 Overexpression of nc1850 negatively regulates rice cold tolerance. DETAILED DESCRIPTION

[0049] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0050] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0051] The wild rice Kenjing 8 in the following examples is recorded in the document “Breeding and cultivation technology of a new cold-region rice variety Kenjing 8, Heilongjiang Agricultural Sciences”.

[0052] The pCAMBIA3301 vector in the following examples is described in the document “Osa-miR1320 targets the ERFtranscription factor OsERF096 to regulate cold tolerance via JA-mediated signaling”.

[0053] Example 1. Analysis of expression pattern of nc1850 under cold stress

[0054] The three-leaf rice seedlings (Kenjing No. 8) were cold treated at 4°C. Leaves at the same position were taken at 0h, 0.5h, 1h, 3h, 6h, 9h, 12h and 24h of treatment, and total RNA was extracted by Trizol method. The reverse transcription kit HiScript III1st Strand cDNA Synthesis Kit (+gDNA wiper) (Vazyme, R312) was used to reverse transcribe cDNA. The obtained cDNA was diluted 10 times, and the diluted cDNA was used as a template. Fluorescence quantitative PCR was performed using primers nc1850-qRT-F and nc1850-qRT-R. At the same time, the rice elongation factor 1-α gene (osa-ELF1-α) was used as an internal reference gene. The primer sequences used for detection are as follows:

[0055] nc1850-qRT-F:5'-CAGCCGCAATTTTCAATCCACAA-3';

[0056] nc1850-qRT-R: 5'-CTTGAGCGTGAACTGATCTTGC-3';

[0057] osa-ELF1-α-F: 5'-GCACGCTCTTTCTTGCTTTCAC-3';

[0058] osa-ELF1-α-R: 5'-TCTTGTCAGGGTTGTAGCCGAC-3'.

[0059] The qRT-PCR test results are as follows Figure 1 The results showed that after 1 h of cold stress at 4°C, the expression level of nc1850 decreased significantly to half of that at 0 h, and then maintained a low expression level, indicating that the expression of nc1850 was inhibited by cold stress and may be involved in the cold stress response of rice.

[0060] Example 2: Cloning of nc1850 non-coding transcripts

[0061] 1. Primer design

[0062] The genome sequence of rice nc1850 was obtained through the RAP (https: / / rapdb.dna.affrc.go.jp / ) database, and the transcript of nc1850 was selected for cloning. Primer Premier 5.0 was used to design cloning primers for nc1850 transcripts. The primer sequences used for cloning are as follows:

[0063] nc1850-CF: 5'-TTAAAATACGCAAATATGATTTATTCAAT-3';

[0064] nc1850-CR: 5'-ATCTTCATCCTCCACGCCG-3'.

[0065] 2. Cloning of nc1850 transcripts

[0066] 1) Select mature and plump wild rice Kenjing No. 8 seeds, treat them at 42° C. for 3-5 days to break dormancy, and obtain germinating rice seeds.

[0067] 2) sterilize with 10% NaClO for 30 minutes, wash with sterile distilled water for 5 times and soak in dark conditions for 1 day, then transfer the germinated rice seeds to a 30°C environment for dark germination culture for 1 day, then transfer the germinated rice seedlings to Yoshida solution and culture them to the three-leaf stage at 28°C, 14 h light / 25°C, 10 h dark conditions to obtain three-leaf rice seedlings.

[0068] 3) Take leaves of rice seedlings at the three-leaf stage, extract total RNA by Trizol method (Invitrogen, 15596026), and obtain cDNA by reverse transcription. Use the obtained cDNA as a template and use primers nc1850-CF and nc1850-CR for PCR amplification to obtain PCR products. Recover the expected PCR products ( Figure 2 A), connected to the pEASY-T vector, and sequenced the positive clones. The sequencing results showed that a 1409 bp fragment was obtained by PCR amplification, and its nucleotide sequence was shown in Sequence 1. The fragment contained the transcript sequence of nc1850, and the vector with the correct sequence was named T-nc1850. At the same time, the coding ability of the nc1850 transcript was predicted by CPC2 online software, and it was found that it was similar to the reported non-coding RNA-LAIR and had no protein coding ability ( Figure 2 B).

[0069] Example 3: Acquisition of nc1850 overexpressing rice and analysis of cold tolerance

[0070] 1. Construction of nc1850 overexpression vector

[0071] To obtain rice overexpressing nc1850, we constructed Figure 3 The plant expression vector shown in A is used for subsequent genetic transformation. The specific steps are as follows:

[0072] 1. Using T-nc1850 plasmid as template, use primers nc1850-OF and nc1850-OR to perform PCR amplification to obtain the nc1850 transcript sequence (referred to as nc1850 fragment) with added restriction sites (NcoI and BstEII). The primer sequences are as follows (underlined sequences represent the recombinant sequences required for constructing the vector):

[0073] nc1850-OF:5'- acgggggactcttgaccatgg TTAAAATACGCAAATATGATTTATTCAAT-3';

[0074] nc1850-OR:5'- ggggaaattcgagctggtcacc ATCTTCATCCTCCACGCCG-3'.

[0075] 2. Double digest the pCAMBIA3301 vector with restriction endonucleases NcoI and BstEII to obtain vector digestion products.

[0076] 3. The vector digestion product obtained in step 2, CE recombinase (Vazyme, C112) and the nc1850 fragment obtained in step 1 were incubated at 37°C for 30 minutes. Under the catalytic action of the recombinase, the recombinant vector pCAMBIA3301-nc1850 was obtained, and E. coli was transformed. The single clones with positive PCR amplification were sequenced and identified. The sequencing results showed that the recombinant vector pCAMBIA3301-nc1850 was obtained by replacing the fragment between the NcoI and BstEII restriction sites of the pCAMBIA3301 vector with the DNA molecule shown in sequence 1, and keeping the other sequences of the pCAMBIA33001 vector unchanged.

[0077] II. Acquisition and identification of nc1850 overexpressing rice

[0078] 1. The recombinant vector pCAMBIA3301-nc1850 obtained in step 1 was transformed into Agrobacterium tumefaciens EHA105 by freeze-thaw method to obtain the recombinant bacteria pCAMBIA3301-nc1850 / EHA105.

[0079] 2. The embryonic callus of wild rice variety Kenjing 8 was infected with the recombinant bacterium pCAMBIA3301-nc1850 / EHA105 for 20 minutes using the Agrobacterium-mediated method, and then the callus was transferred to the co-cultivation medium (NB medium containing 20 mg / L acetosyringone, pH 5.2).

[0080] 3. After culturing in the dark at 25°C for 2-4 days, the callus tissue was collected, washed with a sterile aqueous solution containing 500 mg / L cephalosporin, and then inoculated into a screening medium (NB medium containing 15 mg / L cyprodinil and 100 mg / L amoxicillin-clavulanate potassium, pH 5.8).

[0081] 4. After culturing for 6 weeks at 32°C and 24 h light conditions, the callus tissue was collected and inoculated into differentiation medium (MS medium containing 30 g / L sorbitol, 2 g / L casein hydrolysate, 100 mg / L amoxicillin-clavulanate potassium, 2 mg / L KT and 0.02 mg / L NAA, pH 5.8). First, culture it at 25°C and dark conditions for 5-7 days, and then transfer it to 26°C and 16 h light / 8 h dark conditions and culture it until green spots appear on the surface of the callus tissue.

[0082] 5. Transfer the callus with green spots to a new differentiation medium and culture at 26°C, 16 h light / 8 h dark until the length of the seedling regeneration shoots is about 2 cm.

[0083] 6. Transfer the seedlings to rooting medium (MS medium containing 100 mg / L amoxicillin-clavulanate potassium, pH 5.8), and culture them at 26°C, 16 h light / 8 h dark until the plant height reaches 10-15 cm and the root system is well developed to obtain regenerated plants (T0 generation).

[0084] 7. Transplant the regenerated plants (T0 generation) into the prepared culture medium (the composition of the culture medium: 1 part by mass of peat soil + 1 part by mass of Clivia soil + 3 parts by mass of soil), water them, culture them under dark conditions for 3-5 days, and then move them outdoors for normal culture.

[0085] 8. Take the leaves of the regenerated plants, extract genomic DNA, and use primers PC-UF and nc1850-R for PCR identification to obtain the regenerated plants with positive PCR identification ( Figure 3 B). The primer sequences are as follows:

[0086] PC-UF: 5'-ATAAGGAAGTTTCATTTCATTTGGA-3';

[0087] nc1850-R: 5'-GGTTTGATGCCGATGTGGATGT-3'.

[0088] 9. Take the young leaves of the regenerated plants and wild-type rice Kenjing 8 that are positive for PCR identification, extract total RNA and reverse transcribe to synthesize cDNA. Using cDNA as a template, primers nc1850-qRT-F and nc1850-qRT-R were used for fluorescence quantitative PCR, and the rice elongation factor 1-α gene (osa-ELF1-α) was used as an internal reference gene. The primer sequences are as follows:

[0089] nc1850-qRT-F:5'-CAGCCGCAATTTTCAATCCACAA-3';

[0090] nc1850-qRT-R: 5'-CTTGAGCGTGAACTGATCTTGC-3'.

[0091] Fluorescence quantitative PCR identification results Figure 3 C. It can be seen from the figure that under normal conditions, the expression level of nc1850 in 4 strains (#1, #4, #6, #7) among the 10 transgenic strains was significantly higher than that in the wild type.

[0092] 10. Self-pollinate the regenerated plants with overexpression identified by fluorescence quantitative PCR, harvest T1 seeds from each plant, self-pollinate the positive T1 plants, harvest T2 seeds from each plant, and perform fluorescence quantitative PCR identification on the plants grown from T2 seeds according to the method in step 9; for a certain T1 plant, if the T2 plants obtained by self-pollination are all positive by PCR identification, the T1 plant is a homozygous transgenic plant, and the T1 plant and its self-pollinated offspring are a homozygous transgenic line, until a T3 generation transgenic rice homozygous line overexpressing nc1850 is obtained. Randomly select two T3 generation transgenic rice homozygous lines overexpressing nc1850 35S pro :nc1850#1 and 35S pro :nc1850#4 is used for the following cold resistance analysis.

[0093] 3. Analysis of cold tolerance of nc1850 overexpressing rice

[0094] 1. Analysis of cold tolerance at seedling stage

[0095] The plump wild-type rice variety Kenjing 8 (WT) and the T3 generation nc1850-overexpressing transgenic rice homozygous line 35S pro :nc1850#1 and 35S pro nc1850#4 seeds were washed with distilled water and soaked at 30℃ for 3-5 days until the seeds were white. The germinated seeds were sown in moist seedling soil and cold-treated at the seedling stage after culturing to the three-leaf stage. The cold-treatment method was as follows: first, the seeds were cultured at 4℃ and the photoperiod was 14 hours of light / 10 hours of darkness for 4 days, and then the seeds were restored to culture at 28℃ and the photoperiod was 14 hours of light / 10 hours of darkness for 4 days. After the cold-treatment was restored, photos were taken and the survival rate was calculated.

[0096] The results of cold tolerance analysis at the seedling stage are as follows Figure 4 A and Figure 4 As shown in B, the results showed that after recovery from cold treatment, both wild-type rice and nc1850 overexpressing rice gradually lost green color or even died, but the growth of wild-type rice after recovery was significantly better than that of nc1850 overexpressing rice ( Figure 4 A) Wild-type rice and nc1850 overexpressing 35S after recovery from cold treatment pro :nc1850#1 and 35S pro The average survival rates of nc1850#4 were 73%, 58% and 58.5% respectively ( Figure 4 B), nc1850 overexpression of rice 35S pro :nc1850#1 and 35S pro The survival rate of nc1850#4 was significantly lower than that of wild-type rice.

[0097] 2. Analysis of cold tolerance at the booting stage

[0098] The experiment was conducted in an artificial climate chamber using potted cultivation. 60 seedlings of the wild-type rice variety Kenjing 8 (WT) and the T3 generation nc1850 overexpressing transgenic rice homozygous line 35Spro:nc1850#1 were planted. When the wild-type rice and nc1850 overexpressing rice grew to the booting stage, tillers with a flag leaf and a second leaf pulvinus distance of -5cm-0cm were selected for marked cold treatment. The cold treatment method was as follows: first, low temperature treatment was performed for 7 days at a temperature of 15℃ and a photoperiod of 14 hours of light / 10 hours of darkness, and then cultured under 14 hours of light (28℃) / 10 hours of darkness (25℃). After the panicle was drawn, anthers at the same position and with a length of 2 / 3 of the husk were selected for iodine-potassium iodide staining, and the number of fertile pollen grains was counted. The fruiting rate was counted after harvest. 10-20 samples were measured for each index, and the experiment was repeated three times. At the same time, cells cultured under normal conditions (14 h light (28°C) / 10 h dark (25°C)) were used as controls.

[0099] The results of cold tolerance analysis at the booting stage are as follows Figure 4 As shown in C-4F, the results show that under normal growth conditions, the average number of fertile pollen grains in wild-type rice is 243, and the number of fertile pollen grains in 35S pro The average number of fertile pollen grains in nc1850#1 rice was 238, with no significant difference. pro The number of fertile pollen grains in nc1850#1 rice decreased significantly. The average number of fertile pollen grains in wild-type rice was 151, and the number of fertile pollen grains in 35S pro The average number of fertile pollen grains in nc1850#1 rice was 105, which was significantly lower than that in wild-type rice ( Figure 4 C and Figure 4 D) Statistical analysis of fruit set found that under normal growth conditions, wild-type rice and 35S pro There was no significant difference in the seed setting rate of nc1850#1 rice, among which the average seed setting rate of wild-type rice was 95%, and that of 35S pro The average fruiting rate of nc1850#1 rice was 93%. Under cold stress conditions, wild-type rice and 35S pro The fruit setting rate of nc1850#1 rice decreased significantly, and empty grains appeared. The average fruit setting rate of wild-type rice was 29%, while that of 35S pro The average fruit setting rate of nc1850#1 rice was 13%, which was significantly lower than that of wild-type rice.

[0100] In summary, nc1850 overexpression reduced rice tolerance to cold stress.

[0101] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Long non-coding RNA, any one of the following (a1)-(a3): (a1) RNA shown in sequence 1; (a2) RNA having the same function as the nucleotide sequence shown in SEQ ID NO: 1 after one or more nucleotide residues are substituted and / or deleted and / or added; (a3) RNA having 99% or more, 95% or more, 90% or more, 85% or more or 80% homology with the nucleotide sequence defined in (a1) or (a2) and having the same function.

2. A DNA encoding the long non-coding RNA according to claim 1.

3. The DNA according to claim 2, characterized in that: The DNA is any one of the following (b1)-(b3): (b1) DNA shown in Sequence 2; (b2) a DNA having the same function as the nucleotide sequence shown in SEQ ID NO: 2 after one or more nucleotide residues have been replaced and / or deleted and / or added; (b3) A DNA having 99% or more, 95% or more, 90% or more, 85% or more or 80% homology with the nucleotide sequence defined in (b1) or (b2) and having the same function.

4. An expression cassette, a recombinant vector or a recombinant bacterium containing the long non-coding RNA according to claim 1 or the DNA according to claim 2 or 3.

5. Use of the long non-coding RNA according to claim 1, the DNA according to claim 2 or 3, or the expression cassette, recombinant vector or recombinant bacteria according to claim 4 in regulating plant stress tolerance or plant breeding.

6. Use of a substance for reducing the expression of the long non-coding RNA according to claim 1 in improving plant stress tolerance or plant breeding.

7. A method for cultivating plants with improved stress tolerance, comprising the following steps: reducing the expression level of the long non-coding RNA according to claim 1 in a recipient plant to obtain a transgenic plant; the transgenic plant has higher stress tolerance than the recipient plant.

8. A method for cultivating plants with reduced stress tolerance, comprising the following steps: increasing the expression level of the long non-coding RNA according to claim 1 in a recipient plant to obtain a transgenic plant; the stress tolerance of the transgenic plant is lower than that of the recipient plant.

9. The use according to claim 5 or 6 or the method according to claim 7 or 8, characterized in that: The stress resistance is cold resistance.

10. The use according to claim 5 or 6 or the method according to claim 7 or 8, characterized in that: The plant is a monocotyledon or a dicotyledon.

Images