The invention relates to 5apos; uTR (Untranslated Region) element and application thereof in improving expression quantity of target gene of plant

Abstract

The invention relates to the technical field of molecular biology and plant biology, and provides a 5 'UTR element and application thereof in improving the expression quantity of a plant target gene. Wherein the nucleotide sequence of the 5 'UTR is as shown in SEQ ID NO. 1. By introducing the specific nucleotide sequence, the structure and function of the 5 'UTR are optimized, and the stability of the target transcript mRNA can be promoted, so that the capability of translating the mRNA into the protein is improved. The method not only improves the expression level of the target gene, but also provides a new translation regulation strategy for plant genetic engineering. Through the innovative method, more efficient target gene expression can be realized in plants, and the method has important scientific and application values.

Description

Technical Field

[0001] The invention relates to the fields of molecular biology and plant biotechnology, and in particular to a 5'UTR element and application thereof in improving the expression amount of a target gene in a plant. Background Art

[0002] In plant genetic engineering, improving the expression level of foreign genes is the key to achieving efficient biological production and improving crop traits. Traditional gene expression regulation methods mainly focus on the selection and optimization of promoters, while the importance of 5'UTR in translation regulation is gradually being recognized. 5'UTR not only affects the stability of mRNA, but also plays an important role in the recruitment of ribosomes and the initiation of translation.

[0003] Previous studies have shown that certain specific nucleotide sequences can act as translational regulatory elements and significantly affect the expression of target proteins. For example, upstream open reading frames (uORFs) in the 5'UTR play a key role in regulating translation, and they can regulate the translation of the major open reading frame (mORF) by affecting ribosome scanning and restarting. In addition, specific sequence features in the 5'UTR, such as A-rich elements (poly Atract), can act as internal ribosome entry sites (IRES) to promote cap-independent translation of mRNA.

[0004] However, the existing technology lacks a simple and effective way to systematically optimize 5'UTR to improve the expression level of genes in plants. Therefore, the development of a new translation regulatory element that can effectively enhance gene expression in plants has important scientific and application value. Current research progress shows that by optimizing the nucleotide sequence in 5'UTR, the expression level of plant target genes can be significantly improved, which provides a theoretical basis for the development of new translation regulatory elements. Summary of the invention

[0005] In view of this, the present invention proposes a 5'UTR element that significantly improves the expression level of a plant target gene and an application of the 5'UTR element in improving the expression level of a plant target gene.

[0006] The technical solution for implementing the present invention is as follows:

[0007] In a first aspect, the present invention provides a 5'UTR element, wherein the nucleotide sequence of the 5'UTR is shown in SEQ ID NO.1.

[0008] In a second aspect, the present invention provides a nucleic acid molecule encoding a target protein, wherein the nucleic acid molecule comprises a 5'-UTR element shown in SEQ ID NO.1.

[0009] In a third aspect, the present invention provides an mRNA transcription vector, wherein the vector comprises the above-mentioned 5'UTR element or nucleic acid molecule.

[0010] In a fourth aspect, the present invention provides a method for preparing an mRNA transcription vector: cloning the sequence shown in SEQ ID NO.1 into the 5'UTR position of FLUC in a plant dual luciferase vector, the use as claimed in claim 5, characterized in that: using the dual luciferase expression vector plasmid as plasmid DNA, using the PEG method to transform plant protoplasts, and then extracting total protein, including the target protein.

[0011] In a fifth aspect, the present invention provides the use of a 5'UTR element or a nucleic acid molecule or an mRNA transcription vector in producing a plant target protein.

[0012] Preferably, the dual luciferase expression vector plasmid is used as plasmid DNA, the plant protoplasts are transformed by PEG method, and then the total protein including the target protein is extracted.

[0013] The 5'UTR element of the present invention and its application in increasing the expression of target genes in plants have the following beneficial effects compared with the prior art:

[0014] (1) High efficiency: By introducing a specific 5'UTR sequence, the present invention can significantly increase the expression of the target gene and promote the stability of the target transcript mRNA, thereby improving the ability of mRNA to be translated into protein, meeting the needs of biopharmaceuticals and agricultural improvement. This high efficiency is not only reflected in the improvement of gene expression levels, but also in its improvement of crop quality and stress resistance, thereby increasing crop yield and quality.

[0015] (2) Simplicity: This method does not require complex promoter engineering or multiple gene manipulations, is easy to operate, and is suitable for wide application in different plant systems. This simplicity makes the technology easy to implement and reduces the complexity and cost of experimental operations.

[0016] (3) Wide applicability: The translation regulatory element is applicable to a variety of plants, including model plants (such as Arabidopsis thaliana) and economic crops (such as rice, corn, tobacco, etc.). This wide applicability allows the technology to play a role in different plant systems and meet diverse research and application needs.

[0017] (4) Environmental friendliness: By optimizing gene expression and reducing dependence on external chemicals, negative impacts on the environment are reduced. This environmental friendliness meets the requirements of sustainable development of modern agriculture. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0019] Figure 1 This is a map of the mRNA transcription vector of the present invention;

[0020] Figure 2 The graphs are the protease activity (A) and mRNA expression level (B) of transformed Arabidopsis protoplasts;

[0021] Figure 3 The diagrams are the protease activity (A) and mRNA expression level (B) of transformed rice protoplasts;

[0022] Figure 4 The diagrams are the protease activity (A) and mRNA expression level (B) of transformed maize protoplasts;

[0023] Figure 5 The graphs are the protease activity (A) and mRNA expression level (B) of transformed tobacco protoplasts. DETAILED DESCRIPTION

[0024] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0025] In eukaryotes, the 5'UTR is critical for ribosome recruitment to messenger RNA (mRNA) and start codon selection, and plays an important role in controlling translation efficiency and shaping the cellular proteome. The ribosome initiation complex assembles on the mRNA through a cap-dependent or cap-independent mechanism. In addition, the secondary structure in the 5'UTR will also affect the initiation efficiency of the start codon. The strong stem-loop structure immediately downstream of the start codon will stall the scanning of the 40S subunit, increase its "dwelling time", and thus reduce the possibility of leaky scanning through near-cognate or AUG triplets in poor environments.

[0026] The core of the present invention is to provide a specific 5'UTR sequence and optimize the structure and function of the 5'UTR. When the sequence is present in the 5'UTR position of the target gene as a translation regulatory element, it can promote the stability of the target transcript mRNA, thereby improving the ability of mRNA to be translated into protein and the expression level of the target gene in the plant system. The design of this sequence is based on a deep understanding of the translation mechanism of plant mRNA, aiming to optimize the binding of ribosomes and translation efficiency.

[0027] 1. 5'UTR element

[0028] The nucleotide sequence of the 5'UTR element of this example is: CGGGCAGCCTAACTACGGGTACACCCGAAGCTCAAACAATAGGCACACAT (SEQ ID NO. 1). Since it contains 50 nucleotides, it is hereinafter referred to as "N50-high".

[0029] 2. Construction of dual luciferase expression vector

[0030] like Figure 1 As shown, the dual luciferase expression vector mainly contains two sets of expression frameworks, one set is RLUC (Renilla luciferase) driven by 35S promoter; the other set is FLUC (Firefly luciferase) driven by Ubiquitin promoter. The N50-high sequence is cloned into the 5'UTR position of FLUC in the plant dual luciferase vector to construct a recombinant expression vector. The specific steps are as follows:

[0031] (1) PCR amplification of N50-high sequence

[0032] Use PCR to amplify the N50-high sequence. The primers and reaction system are shown in the table below. Make sure the amplified fragment contains the required restriction site (BsaI) for subsequent cloning steps.

[0033] PCR primers

[0034] Upstream primer: CCGGTCTCCGATATCGGGCAGCCTAACTACG; downstream primer: CCGGTCTCCCCCGTATGTGTGCCTATTGTTTG.

[0035] Template sequence (N50-high sequence): CGGGCAGCCTAACTACGGGTACACCCGAAGCTCAAACAATAGGCACACAT.

[0036] Table 1 PCR reaction system

[0037] Element volume Nuclease-free Water 20uL Biorun Pfu PCR Mix 25uL Upstream primer (10 μM) 2uL Downstream primer (10 μM) 2uL template 1uL Total volume 50uL

[0038] Table 2 PCR reaction conditions

[0039] step Number of cycles 94℃ for 3min 1 94℃ for 30sec 30 50℃ for 30sec 30 72℃ for 10sec 30 72℃ for 5min 1 16℃ for 30min 1

[0040] (2) Enzyme digestion of target gene and vector

[0041] The N50-high sequence and the plant dual luciferase vector were digested with the selected restriction endonuclease BsaI. After digestion, agarose gel electrophoresis was performed to recover the target fragment and the linearized vector.

[0042] (3) Connecting the target gene and vector

[0043] Use T4 DNA ligase to ligate the digested N50-high sequence to the linearized plant dual luciferase vector.

[0044] (4) Transformation of competent cells

[0045] Transform the ligation product into DH5α competent cells: Take 50μL competent cells and place them in an ice bath, add 5μL ligation product. Place in an ice bath for 30 minutes, and heat shock in a 42℃ water bath for 90 seconds. Add 500μL of resistance-free LB liquid, and incubate at 37℃ for 1 hour. Spread 100μL of bacterial liquid on a Kana plate and incubate at 37℃ overnight.

[0046] (5) Screening positive clones and extracting recombinant plasmids

[0047] Use medium containing Kana antibiotics to screen positive clones. Use alkaline lysis method or kit (such as OmegaPlasmid Mini Kit) to extract recombinant plasmid, and perform restriction digestion and sequencing verification to ensure that the N50-high sequence is correctly inserted into the 5'UTR position of FLUC.

[0048] Negative control: 5'UTR sequence of Arabidopsis TBF1 shown in SEQ ID NO.2, the specific sequence is as follows:

[0049] TCTAGAAACAGCATCCGTTTTTATAATTTAATTTTCTTACAAAGGTAGGACCAACATTTGTGATCTATAAATCTTCCTACTACGTTATATAGAGACCCTTCGACATAACACTTAACTCGTTTTATATATTTGTTTTACTTGTTTTGCACATACACACAAAAATAAAAAAGACTTTATATTTATTTACTTTTTAATCACACGGATTAGCTCCGGCGAAGTATGGTCGTCGTCTTCATCTTCTTC CTCCATCATCAGATTTTTCCTAAATGGAAGAAACCAAACGAAACTCCGATCTTCTCCGTTCTCGTGTTTTCCTCTCTGGCTTTTATTGCTGGGATTGGGAATTTCTCACCGCTCTCTTGCTTTTTAGTTGCTGATTCTTTTTCCTTCGACTTTCTATTTCCAATCTTTCTTCTTCTTTGTGTATTAGATTATTTTTAGTTTTATTTTTCTGTGGTAAAATAAAAAAAGTTCGCCGGAG.

[0050] Positive control: the plant universal translation enhancing element-Omega sequence shown in SEQ ID NO.3, the specific sequence is as follows:

[0051] GCCGGTCTAGAGTATTTTTACAACAATTACCAACAACAACAAACAACAAACAACATTACAATTACTATTTACAATT.

[0052] 3. Preparation of Arabidopsis thaliana protoplasts

[0053] Healthy, disease-free and moderately sized leaves were selected from Arabidopsis plants 3-4 weeks before flowering (when there were 5-7 true leaves), and protoplasts were isolated.

[0054] The separation method is as follows: select 10-15 healthy leaves from Arabidopsis plants, cut them off and place them in a culture dish or dissection dish. Use a sharp blade to cut them into 0.5-1mm wide filaments, the thinner the better, to increase the efficiency of enzymolysis. Transfer them to the enzymolysis solution immediately after cutting. 10-15 leaves require 5-10ml of enzymolysis solution, and the leaves are fully immersed in the enzymolysis solution. Put the container containing the enzymolysis solution into a vacuum pump and evacuate (0.06-0.08MPa) for 30 minutes to remove the air in the tissue gap and improve the efficiency of enzymolysis. After evacuation, restore to normal pressure. Under light-proof conditions, place the sample on a rotator or shaking plate and shake it slowly at 50rpm at room temperature. The enzymolysis time is about 3 hours. Observation during the period: Observe the release of protoplasts from leaf cells under a microscope every 30 minutes. When the cell walls of large mesophyll cells are digested, protoplasts begin to be released in large quantities and appear round, the enzymolysis reaction ends.

[0055] The components of the enzymatic solution are: Cellulase R10 1.5wt% (final concentration), Macerozyme R10 0.4wt% (final concentration), Mannitol 0.4M (final concentration), KCL 20mM (final concentration), MES (pH5.7) 10mM (final concentration). Adjust the pH to 5.8, heat at 55°C for 10min, invert three times to mix, cool to room temperature, and then continue to add CaCl2 10mM (final concentration), BSA (Sigma A-6793) 0.1wt% (final concentration), add ddH2O to 10mL, filter and sterilize with a 0.22μm filter membrane, and use it immediately after preparation.

[0056] Add an equal volume of W5 solution to the sample after enzymatic hydrolysis, shake the centrifuge tube horizontally for 10 seconds with a little force by hand to release the protoplasts; filter the protoplasts using a 75um nylon membrane, collect the filtrate into a 50ml round-bottom centrifuge tube, and then rinse with W5 solution to reduce the loss of protoplasts. Centrifuge at 100g for 3 minutes to precipitate the protoplasts, and after centrifugation, use a 5ml pipette to aspirate the supernatant and retain the precipitate. Add an appropriate amount of W5 to the precipitated protoplast cells to resuspend them, place the centrifuge tube on ice, and ice bath for 30 minutes; centrifuge again, discard the supernatant, retain the precipitate and add an appropriate amount of MMG solution to resuspend the protoplasts.

[0057] The components of W5 solution are: NaCl 154mM, CaCl2 125mM, KCl 2mM, MES 2mM. Adjust the pH to 5.7-5.8, and finally add ddH2O to 100mL; filter and sterilize with a 0.22μm filter membrane, and store at 4℃.

[0058] The components of MMG solution are: Mannitol 0.4M, MgCl2·6H2O 15mM, MES 4mM. Adjust the pH to 5.7-5.8, and finally add ddH2O to 10mL; filter and sterilize with a 0.22μm filter membrane and store at 4℃.

[0059] IV. Transformation of Arabidopsis protoplasts and detection of dual luciferase activity

[0060] The plasmid was transformed into Arabidopsis protoplasts using the polyethylene glycol (PEG) method. Half of the transformed Arabidopsis protoplasts were taken, the cells were broken to extract protein, and the FLUC and RLUC enzyme activities were detected using a microplate reader. The other half of the transformed Arabidopsis protoplasts were used to extract RNA, and the mRNA levels of FLUC and RLUC were detected using a real-time fluorescence quantitative PCR instrument. The results are shown in Figure 2 .

[0061] like Figure 2 As shown, N50-high and Omega sequences significantly increased the expression level of FLUC relative to the 5'UTR sequence of endogenous TBF1 in Arabidopsis, and N50-high showed stronger translational regulation than Omega. In addition, FLUC transcripts containing N50-high and Omega sequences showed more stable mRNA relative to the 5'UTR of endogenous TBF1 in Arabidopsis. Similarly, N50-high mediated mRNA stability was stronger than Omega.

[0062] 5. Comparison of expression in different plants

[0063] (1) Plant species

[0064] A variety of plant protoplasts were selected as experimental objects, such as rice, corn, and tobacco. The three dual-luciferase vectors were transformed into rice protoplasts, corn protoplasts, and tobacco protoplasts, respectively.

[0065] (2) Dual luciferase assay and qPCR assay results

[0066] Refer to step 3 to prepare rice, corn, and tobacco protoplasts, refer to step 4 to transform the protoplasts, and detect the dual luciferase activity. The results are shown in Figure 3-5 .

[0067] like Figure 3-4 As shown in the results, the ability of FLUC translation mediated by N50-high in rice protoplasts and corn protoplasts was stronger than that of Omega and TBF1. Moreover, the mRNA of N50-high had high stability in both rice protoplasts and corn protoplasts. Figure 5As shown in the figure, in tobacco protoplasts, N50-high and Omega showed stronger protein expression levels and mRNA stability than TBF1. This result is similar to that in Arabidopsis protoplasts, that is, N50-high can promote mRNA translation and improve mRNA stability.

[0068] The present invention provides a novel N50-high nucleotide sequence as a translation regulatory element, which can significantly increase the expression level of genes in plants. N50-high not only performs well in promoting translation, but also significantly improves the stability of mRNA, and its effect even exceeds that of the common plant translation enhancer element Omega. This discovery not only provides a new tool for plant genetic engineering, but also provides an important scientific basis for understanding the plant translation regulatory mechanism.

[0069] As a translational regulatory element, N50-high has the advantage of being able to significantly increase the expression level of the target gene by optimizing ribosome binding and translation efficiency. Studies have shown that the structure and sequence of 5'UTR have an important influence on the stability and translation efficiency of mRNA. N50-high achieves efficient regulation of gene expression by enhancing the stability of mRNA and promoting effective ribosome binding. Compared with the traditional translational enhancer element Omega, N50-high shows higher efficiency and wider applicability. This advantage makes N50-high have a wider application potential in plant genetic engineering.

[0070] The role and significance of this invention lies in that it not only provides a new tool to enhance the expression of foreign genes in plants, but also provides a new perspective for studying the translation regulation mechanism of plants. Through further research and application, N50-high is expected to have a wide impact in the fields of biotechnology and agriculture. For example, in biotechnology, it can be used to develop highly expressed transgenic plants to meet the needs of biopharmaceuticals and agricultural improvement. In the agricultural field, by increasing the expression level of target genes in crops, the stress resistance and yield of crops can be enhanced, thereby promoting the development of related industries.

[0071] In summary, N50-high, as a new type of translational regulatory element, is not only scientifically innovative, but also shows wide applicability and significant environmental friendliness in application. With further research and application, this method is expected to have a profound impact in the fields of biotechnology and agriculture.

[0072] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A 5'UTR element, characterized in that: The nucleotide sequence of the 5'UTR is shown in SEQ ID NO.

1.

2. A nucleic acid molecule encoding a target protein, characterized in that: The nucleic acid molecule comprises the 5'-UTR element of claim 1.

3. An mRNA transcription vector, characterized in that: The vector comprises the 5'UTR element of claim 1 or the nucleic acid molecule of claim 2.

4. The method for preparing an mRNA transcription vector according to claim 3, characterized in that: The sequence shown in SEQ ID NO.1 was cloned into the 5'UTR position of FLUC in the plant dual-luciferase vector, and a dual-luciferase expression vector plasmid was constructed.

5. Use of the mRNA transcription vector according to claim 4 in producing plant target protein.

6. The use according to claim 5, characterized in that: The dual luciferase expression vector plasmid was used as plasmid DNA, and the plant protoplasts were transformed by PEG method, and then the total protein was extracted, including the target protein.

Images