Application of miR-281-x in regulating octopamine level of bee brain and bee cleaning behavior

Abstract

The invention relates to an application of miR-281-x in regulation and control of octopamine level of a bee brain and a bee cleaning behavior. The miR-281-x is positioned in a chromosome 1 and contains 22 nucleotides, and the sequence of the miR-281-x is AAGAGAGCUAUCAUCGACAGU. The miR-281-x is used for regulating the level of octopamine in the bee brain by targeting a 3 'UTR (Untranslated Region) region of a Tdc2 gene (LOC410948, tyrosine decarboxylase 2), so that the cleaning intensity of the bee on the Varroa destructor mites is influenced. By overexpressing or inhibiting the expression level of the miR-281-x, the octopamine level of the bee brain can be influenced, so that the proportion of strongly cleared bees (MS) in a bee colony is reduced or increased, and the miR-281-x is expected to be applied to the anti-mite breeding of bees to reduce the parasitism rate of Varroa destructor and achieve dynamic balance.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to the application of miR-281-x in regulating the octopamine level in the brain of bees and the cleaning behavior of bees. Background Art

[0002] Varroa destructor is an external parasite of the western honey bee, Apis mellifera L. They feed on the fat bodies of honey bees, spread viruses that damage the immune system of honey bees, and cause bee damage or colony collapse, causing significant damage to the beekeeping industry worldwide. Natural selection in honey bee breeding for resistance to mites has led to the evolution of honey bee populations, greatly reducing the growth rate of the varroa mite population. Using resistance traits to select bees, these bees can survive in the environment of varroa mites and enable sustainable beekeeping. For example, Africanized honey bees are a bee species that is naturally selected for resistance to mites and can survive without any management input from beekeepers. Many studies have shown that cleaning behavior has a certain degree of resistance to varroa mites in Africanized honey bee colonies, but the regulatory mechanism of cleaning behavior is still unclear.

[0003] The structure and function of the honey bee brain are of increasing interest to researchers in relation to honey bee cognition and behavior. Although the honey bee brain has only about 1 million neurons, it is well known for its ability to facilitate effective communication and cooperation. The honey bee brain operates through a neural network mechanism that influences the bees' perception, decision-making, and social behavior. Honey bee social behavior is controlled and regulated by biogenic amines, such as dopamine, serotonin, octopamine, and tyramine, which are known for their neurotransmitter and neurohormone effects in the honey bee brain.

[0004] MicroRNAs (miRNAs) are key components of post-transcriptional gene expression regulation and are involved in the regulation of almost all biological processes. Many studies have confirmed that animal behavior is also regulated by post-transcriptional regulation and the interaction between miRNAs and target genes, involving aggregation, movement, general behavior, feeding, climbing, and circadian rhythms. However, there is no genome-based miRNA sequencing study that regulates the intensity of honey bee anti-mite cleaning behavior.

[0005] The present invention measures the brain biogenic amine levels of strong and weak cleaning bees among individuals, and uses the miRNAs transcriptomics method to reveal the mechanism of microRNA-neurotransmitter-grooming behavior, thereby achieving a scientific and effective anti-mite method for protecting bees, and provides reliable evidence for establishing a model of the influence of microRNA-neurotransmitter-grooming behavior. Summary of the invention

[0006] The purpose of the present invention is to provide the application of miR-281-x in regulating the octopamine level in the bee brain and the bee cleaning behavior.

[0007] The specific technical scheme of the present invention is as follows: 1. The cleaning behavior of honey bees against Varroa destructor mites is regulated by octopamine. Specifically, a high performance chromatography-ECD (Hplc-ECD) detector is used to measure the biogenic amines in the brains of honey bees with different cleaning intensities against Varroa destructor mites. The results show that octopamine is significantly different between strong and weak cleaning bees, and the use of octopamine for bees with weak cleaning intensity improves the cleaning intensity of the honey bees.

[0008] 2. miR-281-x is significantly differentially expressed in strong cleaning bees and weak cleaning bees. Specifically, microRNA transcriptome sequencing revealed that miR-281-x is significantly more expressed in weak cleaning bees than in strong cleaning bees. miR-281-x is located on chromosome 1, contains 22 nucleotides, has a sequence of AAGAGAGCUAUCCAUCGACAGU, has a genbank accession number of GeneID: 732503, and a miRBase number of MI0001587. It is present in the bee brain and various tissues (including brain, epidermis, hypopharyngeal glands, midgut, ileum, rectum, and chest muscles), and is expressed most highly in the bee midgut.

[0009] 3. The target gene of miR-281-x is Tdc2, a gene encoding octopamine synthase. The interaction between the two has been demonstrated by target gene prediction software, dual luciferase, RNA immunoprecipitation, and in situ hybridization experiments. miR-281-x targets the 3'UTR region of Tdc2 (LOC410948aromatic-L-amino-acid decarboxylase) and regulates the level of octopamine in the brain of Western honey bees.

[0010] 4. Application of miR-281-x in regulating the cleaning behavior of honey bees for the prevention of Varroa destructor mites. Specifically: when agomiR-281-x was injected into honey bees, the results of quantitative qPCR and western blot showed that the expression of Tdc2 gene and its protein was significantly reduced, the level of octopamine in the bee brain determined by Hplc-ECD was reduced, and behavioral experiments showed that the proportion of strong cleaning bees (MS) in the bee colony was reduced, while the proportion of weak cleaning bees (MW) was increased; while when antagomiR-281-x was injected into honey bees, the results of quantitative qPCR and western blot showed that the expression of Tdc2 gene and its protein was significantly increased, the level of octopamine in the bee brain determined by Hplc-ECD was increased, and behavioral experiments showed that the proportion of strong cleaning bees (MS) in the bee colony was increased, while the proportion of weak cleaning bees (MW) was decreased.

[0011] The significant advantages of the present invention are: 1. The present invention proves that octopamine regulates the cleaning behavior of honey bees to resist mites. Therefore, octopamine is expected to become a regulator in honey bee resistance to mite breeding.

[0012] 2. The present invention proves that miR-281-x is a microRNA that regulates octopamine. Therefore, miR-281-x is expected to become a target gene for use in honey bee anti-mite breeding. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 : The levels of biogenic amines in the brains of strong cleaning bees (MS) and weak cleaning bees (MW) against Varroa destructor mites are shown. From the results, it can be seen that there is a significant difference in the content of octopamine between the two.

[0014] Figure 2 : It was shown that giving octopamine to bees with weak cleaning ability improved the cleaning ability of the bees.

[0015] Figure 3 : Shows the differentially expressed microRNAs in the brain microRNA transcriptome sequencing (smallRNA-seq) of strong cleaning bees (MS) and weak cleaning bees (MW), and the clustered differential expression heat map of the top 7 microRNAs selected according to the expression level shows that these 7 microRNAs are lowly expressed in strong cleaning bees (MS) and highly expressed in weak cleaning bees (MW).

[0016] Figure 4 : Shows the expression of miR-281-x in different tissues of honey bees (epidermis, thorax, midgut, ileum, rectum, hypopharyngeal gland, brain). It can be seen from the figure that miR-281-x is expressed in various tissues of honey bees, but the expression is highest in the midgut.

[0017] Figure 5 : The target gene Tdc2 (LOC410948aromatic-L-amino-acid decarboxylase) of miR-281-x, which is differentially expressed in the brains of strong cleaning bees (MS) and weak cleaning bees (MW), is shown. It is an octopamine synthase expression gene. Tdc2 acts on the 3'UTR region, and the dual luciferase mutant sequence is shown. Luciferase is used to determine the interaction between miR-281-x and Tdc2.

[0018] Figure 6 : Shows RNA immunoprecipitation (RIP) with Ago-1 antibody, with normal rabbit anti-IgG as negative control. qPCR enrichment of Tdc2 in immunoprecipitates from brain tissue extracts treated with agomiR-281-x compared to agomir-NC.

[0019] Figure 7: Shows the transcription level of the target gene Tdc2 after honey bees were injected with agomiR-281-x and antagomiR-281-x, while the controls were injected with agomiR-NC and antagomiR-NC, *P<0.05, **P<0.01, ****P<0.0001.

[0020] Figure 8 : Shows the changes in the protein level of the target gene Tdc2 after honey bees were injected with agomiR-281-x and antagomiR-281-x, while the controls were injected with agomiR-NC and antagomiR-NC, *P<0.05, **P<0.01, ****P<0.0001.

[0021] Fig. 9 : Shows the changes in octopamine levels in the brains of honey bees after injection of agomiR-281-x and antagomiR-281-x, while the controls were injected with agomiR-NC and antagomiR-NC, *P<0.05, **P<0.01, ****P<0.0001.

[0022] Fig.10 : Shows the statistical graph of the cleaning intensity of honey bees after injection of agomiR-281-x and antagomiR-281-x, while the controls were injected with agomiR-NC and antagomiR-NC, *P<0.05, **P<0.01, ****P<0.0001. DETAILED DESCRIPTION

[0023] To make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0024] The miR-281-x in the present invention is located on chromosome 1, contains 22 nucleotides, has a sequence of 5'-AAGAGAGCUAUCCAUCGACAGU-3', a genbank accession number of GeneID: 732503, and a miRBase number of MI0001587.

[0025] The agomiR-281-x, antagomiR-281-x, mimic-281-x, agomiR-NC, antagomiR-NC, and mimic-NC in the present invention are all synthesized by Shanghai Jima Gene. agomiR-281-x and mimic-281-x are double-stranded structures, with the sense strand sequence of 5'-AAGAGAGCUAUCCAUCGACAGU-3' and the antisense strand sequence of 5'-UGUCGAUGGAUAGCUCUCUUUU-3'; antagomiR-281-x is a single-stranded structure with the sequence of 5'-ACUGUCGAUGGAUAGCUCUCUU-3'; agomiR-NC and mimic-NC are double-stranded structures, with the sense strand sequence of 5'-UUCUCCGAACGUGUCACGUTT-3' and the antisense strand sequence of 5'-ACGUGACACGUUCGGAGAATT-3'; antagomiR-NC is a single-stranded structure with the sequence of 5'-CAGUACUUUUGUGUAGUACAA-3'.

[0026] The honey bees in the present invention are all honey bees.

[0027] Example 1: Octopamine regulates the cleaning behavior of honey bees against Varroa mites (1) Honey bee cleaning behavior test: Bees’ self-grooming behavior was assessed based on the motor response to the V. destructor, specifically the number of legs used for grooming and the intensity of the body movements. Bees were classified as weak groomers if they were noted to move slowly and not more than two legs to remove the V. destructor, and as strong groomers if they were observed to shake and wipe vigorously and use three or more legs to move the V. destructor. Bees that showed an intermediate expression of self-grooming behavior were discarded to prevent misinterpretation of the behavior and to ensure that we selected for extreme behavioral responses (mild and strong).

[0028] (2) Collection and dissection of honey bee brain samples: The strong cleaning bees and weak cleaning bees collected in step (1) are quickly frozen in liquid nitrogen and then frozen at -80°C overnight. The frozen bee brain is cut off with dissecting scissors and then placed under a stereo microscope. The dissection process is mainly divided into three steps: a. Cut open the chitin in the brain: Use the left-hand tweezers to clamp the bee brain to keep it still, and use the right-hand tweezers to cut a square on the chitin shell above the bee brain. b. Remove the upper chitin: Use the left-hand tweezers to clamp the edge of the beak chitin, and use the right-hand tweezers to clamp the chitin shell at the cut, lift up the chitin above the brain, and pick up the chitin at the antennae. c. Remove excess tissue: First remove the compound eyes on both sides of the bee brain tissue and the simple eyes above, and then use tweezers to clamp out the hypopharyngeal glands and epidermal membrane-like tissue attached to the surface of the bee brain tissue. d. Remove the brain: When the brain tissue is completely exposed, insert the right-hand forceps horizontally from the bottom back of the bee's brain to lift the brain tissue so that the entire brain tissue is completely above the forceps, and then gently lift it up with the forceps to obtain the complete brain tissue. Transfer the obtained brain tissue to a cold 1.5mL centrifuge tube.

[0029] (3) Extraction and determination of biogenic amines: Add 1 ml of extract (mobile phase) to each brain tissue obtained in step (2), add magnetic beads, and grind with a tissue grinder (70 Hz, 60 s); centrifuge at 4°C, 12000 rpm for 2 min; use an ultrasonic disruptor to sonicate in ice water for 15 min; centrifuge at 4°C, 12000 rpm for 10 min; aspirate the supernatant with a 1 ml syringe, filter through a 0.22 μm filter membrane into a sample vial for detection.

[0030] High performance liquid chromatography-electrochemical detection method: flow rate: 0.2mL / min; column temperature: 38℃; phosphate mobile phase: pH=4.30; acetonitrile ratio: 10%; detection voltage: 850mV; injection volume: 10μL; the separation effect of this system is good, and the time used is controlled within 30min. The external standard method is used to draw a standard curve, and the concentrations of octopamine, dopamine, tyramine and 5-hydroxytryptamine are calculated based on the corresponding relationship between the peak area and the concentration.

[0031] The results are as follows Figure 1 As shown, the content of octopamine in the brains of strong-cleaning bees was significantly higher than that in the brains of weak-cleaning bees, while there were no significant differences in other biogenic amines.

[0032] (4) Using octopamine to improve the cleaning strength of bees with weak cleaning strength The weak-cleaning bees collected in step (1) were fed with octopamine, and the cleaning intensity of the bees against Varroa destructor mites was compared before and after the drug application.

[0033] The results are as follows Figure 2 As shown, giving octopamine to bees with weak cleaning strength increased the cleaning strength of the bees.

[0034] Example 2: miR-281-x is significantly differentially expressed in strong cleaning bees and weak cleaning bees (1) Extraction and reverse transcription of RNA from honey bee brain samples: RNA was extracted from bee brain samples using an RNA extraction kit (Promega, USA). The specific method was as follows: 300 μl of lysis buffer and diluent were added to the dissected bee brain tissue, magnetic beads were added, and the mixture was ground with a tissue grinder (70 Hz, 120 s), and then heated at 70°C for 3 min; centrifuged at 14,000 rpm for 5 min, and the supernatant was carefully aspirated; 0.5 times the volume of anhydrous ethanol was added, and the mixture was quickly pipetted 20 to 25 times, transferred to a collection tube, centrifuged at 14,000 rpm for 1 min, and the filtrate was discarded; 600 μL of washing solution was added, and the mixture was centrifuged at 14,000 rpm for 1 min, and the filtrate was discarded; 50 μl Incubate with DNase 1 solution at room temperature for 15 minutes; add 600 μL of washing solution, centrifuge at 14000 rpm for 1 minute, discard the filtrate, repeat once, and then centrifuge at 14000 rpm for 2 minutes; transfer the collection tube to the elution tube, add 100 μL of enzyme-free water, let stand at room temperature for 2 minutes, centrifuge at 14000 rpm for 1 minute, and store the RNA at -80°C for later use.

[0035] Reverse transcription was performed on the RNA of brain samples using a reverse transcription kit (Vazyme, Nanjing) as follows: a. Removal of genomic DNA Add 1 μg of RNA to the samples for reverse transcription. Calculate the volume to be added based on the concentration of the sample RNA. First, prepare a mixture of 5×g DNA Wiper Mix, total RNA, and RNase-free ddH2O in an RNase-free centrifuge tube under low temperature as shown in Table 1. Use a pipette to gently pipette repeatedly to mix. After reacting at 42°C for 2 minutes, perform reverse transcription immediately.

[0036] Table 1 Reaction system for removal of genomic DNA b Synthesis of first-strand cDNA Design specific Stem-loop primer LOOP-miR-281-x (Table 3) Under low temperature environment, prepare the mixed solution in RNase-free centrifuge tube according to the amount shown in Table 2. Mix Hiscript II Enzyme Mix, Stem-loop primer (2μM), 10×RT Mix and RNase Free ddH2O evenly to ensure the accuracy of the reaction solution packaging. Use a pipette to draw 10μL of the mixed solution and add it to the reaction solution in step a. The tip of the pipette gently and repeatedly mixes. After reacting at 25℃ for 5min, 50℃ for 15min, and 85℃ for 5min, the obtained product is directly used for qPCR reaction.

[0037] Table 2 First-strand cDNA synthesis reaction system (2) Primer design and qRT-PCR fluorescence verification: Using miRNA Design software (Vazyme, Nanjing), upstream primer (F-miR-281-x) and universal reverse primer (R-miR), U6 was selected as the internal reference gene (Table 3). The qPCR reaction system was 10 μL: 5 μL 2×miRNA UniversalSYBR qPCR Master Mix, 0.2 μL specific upstream primer, 0.2 μL universal downstream primer, 1 μL cDNA template, 3.6 μL RNase-free ddH2O. The reaction conditions were: 95℃5min, 95℃10s, 60℃30s, a total of 40 cycles, and the melting curve reaction conditions were: 95℃15s, 60℃1min.

[0038] Table 3 Primer sequences used for first-strand cDNA synthesis and fluorescence quantitative PCR synthesis The results are as follows Figure 3 As shown, miR-281-x was lowly expressed in the brains of strong cleaning bees (MS) and highly expressed in the brains of weak cleaning bees (MW).

[0039] Example 3: Expression of miR-281-x in different tissues of honey bees Bee tissue sample collection and RNA extraction, reverse transcription and qRT-PCR fluorescence assay: Bees of the same age were collected, and their epidermis, chest muscles, midgut, ileum, rectum, hypopharyngeal gland and brain tissues were dissected into 1.5 mL centrifuge tubes under low temperature conditions and quickly frozen with liquid nitrogen. The epidermis, chest muscles and midgut were ground with liquid nitrogen, and the ileum, rectum, hypopharyngeal gland and brain tissues were crushed with magnetic beads using a tissue grinder. The collected tissue samples were subjected to RNA extraction, reverse transcription and qRT-PCR fluorescence determination according to the steps in Example 2.

[0040] The results are as follows Figure 4 As shown, miR-281-x is expressed in various tissues of honey bees, with the highest expression level in the honey bee midgut.

[0041] Example 4: Interaction between miR-281-x and target gene Tdc2 (1) Dual luciferase assay: aLuciferase reporter vector construction: The 512 bp sequence of the 3′UTR around the predicted miR-281-x target site was cloned into the pmirGLO vector using the SacI and NheI sites, respectively, to obtain the wild-type vector wt-tdc2; the mutant vector mt-tdc2 mutated the target site GCTCTCT to CGAGAGA. The wild-type vector wt-tdc2 contains the sequence GAGCTCGACGAAAAGGAATTTAAAAAAAAAATGATGAAACGAAGAATGGTAGACGATACATCTCTAAAAAAATTCTCTTAAAATTGCTCAGCGAAGAAACGGACGAAGAAACACTCGAAATCGATCGACGATTATAGATTGTAATAATCCCATTGCCACCTTTTTTCCTTTGTTTCAGTCACTTTTTCGGAAACTTGTGCGCAAGTTAGTTGCAAGATTCGCATTCTCGACCGAAGGAAGCGCTCGAT AAAATATAAGTACATCTTCTTTACTTGCTTATCGATCTGTTTATATAAGTCTGCTCTCTTTGGATCGCGACAGAGATGCGTTACCACCATGCGGAACACGCTACATGTGTAACATATTACTCTATTAAAATG TACTTACATATATGATATATAAAGCGTGCATACATCGACATAGTAAAAAAAGAAAAAAAAAAAAATTTCAGAAGTAAAATAATCAACGTCCCGATTATTCACCATCGTCTCGAAATGCAATCGTGCTAGC,The mutant vector mt-tdc2 contains the sequence GAGCTCGACGAAAAGGAATTTAAAAAAAAAATGATGAAACGAAGAATGGTAGACGATACATCTCTAAAAAAATTCTCTTAAAATTGCTCAGCGAAGAAACGGACGAAGAAACACTC GAAATCGATCGACGATTATAGATTGTAATAATCCCATTGCCACCTTTTTTCCTTTGTTTCAGTCACTTTTTCGGAAACTTGTGCGCAAGTTAGTTGCAAGATTCGCATTCTCGACCGAAGGAAGCGCTCGAT AAAATATAAGTACATCTTCTTTACTTGCTTATCGATCTGTTTATAAGTCTCGAGAGATTGGATCGCGACAGAGATGCGTTACCACCATGCGGAACACGCTACATGTGTAACATATTACTCTATTAAAATGTACTTACATATATGATATATAAAGCGTGCATACATCGACATAGTAAAAAAAAAAGAAAAAAAAAAAATTTCAGAAGTAAAATAATCAACGTCCCGATTATTCACCATCGTCTCGAAATGCAATCGTGCTAGC. The wild-type vector wt-tdc2 and the mutant vector mt-tdc2 were directly synthesized (Qingke Biotechnology, Beijing), transformed into DH5α competent bacteria, and single colonies were picked and inoculated in ampicillin-resistant LB liquid medium to screen positive clones, and sequenced for verification.

[0042] B cell culture and plasmid transfection: HEK293T cell line was cultured in DMEM (high glucose) medium containing 10% fetal bovine serum at 37°C in a 5% CO2 atmosphere. Cells were seeded in 24-well plates and co-transfected with 500ng reporter plasmid and 100nM mimic-281-x using Lipofectamine 3000 (Thermo Fisher, USA). Mimic-NC was used as a negative control. Luciferase activity was detected 48 hours after transfection using a chemiluminescent microplate reader (Thermo Scientific, USA) using the Dual luciferase reporter gene detection system (Promega, USA).

[0043] The results are as follows Figure 5As shown, the wild-type vector wt-tdc2 produced lower luciferase activity compared with the mutant mt-tdc2 reporter construct (control) when co-transfected with the miR-281-x overexpression vector in HEK293T cells.

[0044] (2) RNA immunoprecipitation (RIP) assay: RNA immunoprecipitation test uses Magna RIP kit (Millipore, USA). 24h after agomir-281-x injection of bees, brains are collected and dissected, pre-cooled RIP lysis buffer is added, magnetic beads are added, and the tissue grinder is ground for 2min. Centrifuge at 4°C, 12000rpm for 10min, aspirate the supernatant and put it at -80°C overnight. A / G Beads adds 50μL Anti-Ago1 antibody (Abcam, USA) or monoclonal antibody of normal rabbit IgG (kit), and the supernatant is incubated with magnetic bead-antibody complex at 4°C overnight. 1 / 10 of the lysate is saved as the "Input" sample. Subsequently, total RNA is extracted from the precipitated RNA-protein complex, and CDNA is reverse transcribed. The method refers to the steps of Example 2, and then qRT-PCR is used for quantification to detect the degree of enrichment relative to the IgG control.

[0045] The results are as follows Figure 6 As shown, RNA immunoprecipitated from honey bee brains treated with agomir-281-x was significantly enriched in Tdc2 compared to agomir-NC treated controls.

[0046] Example 5: Regulation of honey bee cleaning behavior by overexpression or knockdown of miR-281-x The agonists and inhibitors of miR-281-x were synthesized at Jima Biotech Co., Ltd. In order to improve the efficiency of the agonists and inhibitors, agomir was modified on the antisense strand, with cholesterol modification at the 3' end, four sulfo-skeletal modifications at the 3' end, two sulfo-skeletal modifications at the 5' end, and methoxy modification on the entire chain; antogimir was modified with cholesterol at the 3' end, four sulfo-skeletal modifications at the 3' end, two sulfo-skeletal modifications at the 5' end, and methoxy modification on the entire chain. The chemically modified agonists and inhibitors have higher stability in animals and higher affinity with cell membranes. The synthesized lyophilized powders of the agonists and inhibitors with chemical structure modifications were diluted with RNase free water for use.

[0047] Use a marking pen to mark the chest of the bees that have just left the hive. When the marked bees are 6 days old, take about 400 and randomly divide them into 4 groups, namely agomiR-281-x (overexpression group), agomiR-NC (overexpression negative control group), antagomiR-281-x (interference expression group) and antagomiR-NC (interference expression negative control group). Then use a microsyringe to draw an appropriate amount of reagent and inject 3 μL (40 nM) at the top of the bee's head. After the bees are injected with the corresponding reagent, the injected bees are subjected to a cleaning behavior test 72 hours later, according to the method described in Example 1. The bees are then collected, quickly frozen with liquid nitrogen, and then stored at -80°C.

[0048] The results are as follows Figures 7 to 10 As shown, compared with the agomir-NC treated control, the agomir-281-x injected bees had decreased tdc2 expression and octopamine content in their brains, and the number of strong cleaning bees in the colony decreased; compared with the antagomir-NC treated control, the antagomir-281-x injected bees had increased tdc2 expression and octopamine content in their brains, and the number of strong cleaning bees in the colony increased.

Claims

1. Application of miR-281-x in any of the following: 1) In regulating bees Tdc2 Applications in gene expression; 2) Application in regulating octopamine levels in the bee brain; 3) Application in regulating the cleaning behavior of honey bees; 4) Application in bee anti-mite treatment; in, The nucleotide sequence of miR-281-x is 5'-AAGAGAGCUAUCCAUCGACAGU-3'.

2. The use according to claim 1, characterized in that: The regulating the cleaning behavior of honey bees refers to regulating the cleaning behavior of honey bee colonies against Varroa destructor mites; the anti-mite method refers to anti-Varroa destructor mites.

3. Use of an agent for upregulating miR-281-x expression in any of the following: 1) In reducing bees Tdc2 Applications in gene expression; 2) Application in reducing octopamine levels in the brain of honey bees; 3) Application in reducing the cleaning capacity of honey bee colonies; in, The nucleotide sequence of miR-281-x is 5'-AAGAGAGCUAUCCAUCGACAGU-3'.

4. The use according to claim 3, characterized in that: The cleaning ability refers to the ability to clean Varroa destructor mites, and reducing the cleaning ability of a honey bee colony refers to reducing the proportion of bees with strong cleaning behavior in the colony.

5. Use of an agent for downregulating miR-281-x expression in any of the following: 1) In raising bees Tdc2 Applications in gene expression; 2) Application in increasing octopamine levels in the brain of honey bees; 3) Application in improving the cleaning ability of honey bee colonies; 4) Application in bee anti-mite treatment; in, The nucleotide sequence of miR-281-x is 5'-AAGAGAGCUAUCCAUCGACAGU-3'.

6. The use according to claim 5, characterized in that: The cleaning ability is the cleaning ability against Varroa destructor mites, and the improving the cleaning ability of a bee colony is to increase the proportion of bees with strong cleaning behavior in the colony; and the anti-mite is the resistance to Varroa destructor mites.

7. A method for reducing octopamine levels in the brain of honey bees and reducing the cleaning ability of honey bee colonies, characterized in that: The method comprises the step of injecting an up-regulator of miR-281-x into honey bees; wherein the nucleotide sequence of the miR-281-x is 5'-AAGAGAGCUAUCCAUCGACAGU-3'.

8. The method according to claim 7, characterized in that: The cleaning ability refers to the cleaning ability against Varroa destructor mites, and the reducing of the cleaning ability of a honey bee colony refers to reducing the proportion of bees with strong cleaning behavior in the colony; the up-regulator of miR-281-x includes agomiR-281-x.

9. A method for increasing the octopamine level in the brain of bees and improving the cleaning ability of bee colonies to achieve bee anti-mite resistance, characterized in that: The method comprises the step of injecting an inhibitor of miR-281-x into bees; wherein the nucleotide sequence of the miR-281-x is 5'-AAGAGAGCUAUCCAUCGACAGU-3'.

10. The method according to claim 9, characterized in that: The cleaning ability is the ability to clean Varroa destructor mites, and the improvement of the cleaning ability of a honey bee colony is to increase the proportion of bees with strong cleaning behavior in the colony; the anti-mite is anti-Varroa destructor mites; and the inhibitor of miR-281-x includes antagomiR-281-x.

Images