Application of promoter and related biological material thereof in production of L-isoleucine

Abstract

The invention discloses application of a promoter and a related biological material thereof in production of L-isoleucine, and belongs to the technical field of biology. The technical problem to be solved by the invention is how to improve the yield of L-isoleucine. The promoter disclosed by the invention is a DNA (Deoxyribose Nucleic Acid) molecule as shown in SEQ ID No. 2 or SEQ ID No. 1. According to the present invention, the promoter has the promoter activity, and the yield of L-isoleucine can be improved after the wild type promoter pNCgl0780 represented by SEQ ID No.1 is replaced with the mutated promoter pNCgl0780 * represented by SEQ ID No.2, and the yield of L-isoleucine can be improved no matter whether the expression of the NCgl0780 gene is driven by using the pNCgl0780 or the pNCgl0780 *.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to application of a promoter and related biological materials in producing L-isoleucine. Background Art

[0002] Aminotransferase generally refers to transaminase, which is a group of enzymes that catalyze the amino transfer reaction between amino acids and α-keto acids. Transaminase is commonly found in animals, plant tissues and microorganisms, including Escherichia coli (E. coli).

[0003] Transaminases in Escherichia coli are a class of enzymes that catalyze the transfer of amino groups between amino acids and keto acids. These enzymes play an important role in Escherichia coli, especially in the biosynthesis and metabolism of amino acids. One of the applications of transaminases in Escherichia coli is the production of L-arginine. By modifying the transaminase gene in Escherichia coli, a series of engineered strains can be constructed to explore the differences in cell growth, L-arginine content, and L-arginine production after each gene modification. In addition, transaminases in Escherichia coli are also a biocatalyst with strict stereoselectivity and efficient one-step synthesis characteristics, which is essential for the biosynthesis of chiral amine compounds. At the same time, it also has the ability to non-oxidatively decarboxylate dicarboxylic acid substrates and is a less studied bifunctional enzyme. Transaminases in Escherichia coli play a key role in the synthesis and metabolism of amino acids. The activity of these enzymes can be optimized through genetic engineering to improve the production efficiency of specific amino acids. Summary of the invention

[0004] The technical problem to be solved by the present invention is how to increase the yield of L-isoleucine.

[0005] In order to solve the above technical problems, the present invention first provides a DNA molecule with promoter function, which comprises the following A1) or A2):

[0006] A1) a DNA molecule containing the nucleotide sequence of SEQ ID No. 2;

[0007] A2) A DNA molecule having 75% or more identity with the nucleotide sequence defined in A1) and having promoter function.

[0008] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, or 85% or more, or 90% or more, or 95% or more identity to the nucleotide sequence of SEQ ID No. 2 of the present invention. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0009] The above 75% or more identity may be 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0010] Specifically, the DNA molecule A2) may be the DNA molecule shown in SEQ ID No.1.

[0011] In one embodiment of the present invention, the DNA molecule having promoter function is the DNA molecule of SEQ ID No.2.

[0012] In another embodiment of the present invention, the DNA molecule having promoter function is the DNA molecule of SEQ ID No.1.

[0013] The present invention also provides a biological material associated with the DNA molecule, wherein the biological material comprises any one of the following B1) to B3):

[0014] B1) an expression cassette containing the DNA molecule;

[0015] B2) a recombinant vector containing the expression cassette described in B1);

[0016] B3) A recombinant microorganism containing the expression cassette described in B1), or a recombinant microorganism containing the recombinant vector described in B2).

[0017] In the above biological materials, the expression cassette described in B1) refers to a DNA that can drive the expression of the target gene in the host cell. The DNA may include not only the promoter but also the target gene.

[0018] Specifically, the expression cassette in B1) may contain the following b11) or b12):

[0019] b11) the DNA molecule shown at positions 21 to 1433 of SEQ ID No. 5;

[0020] b12) The DNA molecule shown in positions 21 to 1434 of SEQ ID No.6.

[0021] In one embodiment of the present invention, the target gene is NCgl0780 gene. B1) The expression cassette is a DNA molecule shown at positions 21-1433 of SEQ ID No.5 or positions 21-1434 of SEQ ID No.6.

[0022] Existing expression vectors can be used to construct a recombinant vector containing the expression cassette.

[0023] In the above biological materials, the vector may be a plasmid, a cosmid, a phage or a virus vector. The plasmid may specifically be a pK18mobsacB vector or a pXMJ19 vector.

[0024] B2) The recombinant vector may be the recombinant vector pK18-pNCgl0780 * , pK18-pNCgl0780 * The recombinant vector is obtained by replacing the fragment (small fragment) between the Xbal I and BamH I recognition sites of the pK18mobsacB vector with the DNA fragment shown at positions 37-1237 of SEQ ID No. 3 in the sequence list.

[0025] B2) The recombinant vector may also be pXMJ19-pNCgl0780 and pXMJ19-pNCgl0780 * pXMJ19-pNCgl0780 is a recombinant vector obtained by inserting the DNA molecule shown at positions 37-1449 of SEQ ID No. 8 into the pXMJ19 vector. * The recombinant vector is obtained by inserting the DNA molecule shown at positions 37-1450 of SEQ ID No. 9 into the pXMJ19 vector.

[0026] In the above-mentioned biological material, the microorganism can be yeast, bacteria, algae or fungi. Among them, the bacteria can be Corynebacterium glutamicum. The bacteria can also be Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium pekinense, Brevibacterium ammoniaphagoides, Corynebacterium blunt-toothed or Pantoea.

[0027] In one embodiment of the present invention, the Corynebacterium glutamicum is Corynebacterium glutamicum CGMCC 20437 or Corynebacterium glutamicum ATCC13032.

[0028] B3) The recombinant microorganism may be a recombinant microorganism obtained by replacing the DNA molecule shown in SEQ ID No.1 in the starting microorganism with the DNA molecule shown in SEQ ID No.2, or a recombinant microorganism obtained by inserting the DNA molecule shown in SEQ ID No.2 into the starting microorganism to drive the expression cassette of the target gene, or a recombinant microorganism obtained by inserting the DNA molecule shown in SEQ ID No.1 into the starting microorganism to drive the expression cassette of the target gene.

[0029] In an embodiment of the present invention, the recombinant microorganism is YPI-p0780-1, YPI-p0780-2, YPI-p0780-003, YPI-p0780-004, YPI-p0780-005, YPI-p0780-006, YPI-p0780-7, YPI-p0780-8, YPI-p0780-9 and YPI-p0780-10.

[0030] The recombinant bacterium YPI-p0780-1 is obtained by replacing the wild-type NCgl0780 gene promoter (SEQ ID No. 1) in the Corynebacterium glutamicum CGMCC 20437 strain with the mutated promoter pNCgl0780 shown in SEQ ID No. 2. * The obtained strains.

[0031] The recombinant bacterium YPI-p0780-2 is obtained by replacing the wild-type NCgl0780 gene promoter (SEQ ID No. 1) in the Corynebacterium glutamicum ATCC13032 strain with the mutated promoter pNCgl0780 shown in SEQ ID No. 2. * The obtained strains

[0032] The recombinant bacterium YPI-p0780-003 is obtained by inserting the expression cassette pNCgl0780-NCgl0780 shown in positions 21-1433 of SEQ ID No. 5 into the poxB site of the genome of Corynebacterium glutamicum CGMCC 20437.

[0033] The recombinant bacterium YPI-p0780-004 is obtained by inserting the expression cassette pNCgl0780 shown in positions 21 to 1434 of SEQ ID No. 6 into the poxB site of the genome of Corynebacterium glutamicum CGMCC 20437. * -pNCgl0780 obtained recombinant bacteria.

[0034] The recombinant bacterium YPI-p0780-005 is obtained by inserting the expression cassette pNCgl0780-NCgl0780 shown in positions 21-1433 of SEQ ID No. 5 into the poxB site of the genome of Corynebacterium glutamicum ATCC13032.

[0035] The recombinant bacterium YPI-p0780-006 is obtained by inserting the expression cassette pNCgl0780 shown in positions 21 to 1434 of SEQ ID No. 6 into the poxB site of the genome of Corynebacterium glutamicum ATCC13032. * -pNCgl0780 obtained recombinant bacteria.

[0036] The recombinant bacterium YPI-p0780-7 is obtained by introducing the recombinant vector pXMJ19-pNCgl0780 into Corynebacterium glutamicum CGMCC 20437.

[0037] The recombinant bacteria YPI-p0780-8 is a recombinant vector pXMJ19-pNCgl0780 * The recombinant bacteria obtained by introducing into Corynebacterium glutamicum CGMCC 20437.

[0038] The recombinant bacteria YPI-p0780-9 are obtained by introducing the recombinant vector pXMJ19-pNCgl0780 into Corynebacterium glutamicum ATCC13032, and both contain the expression cassette pNCgl0780-NCgl0780.

[0039] The recombinant bacteria YPI-p0780-10 is a recombinant vector pXMJ19-pNCgl0780 * The recombinant bacteria obtained by introducing into Corynebacterium glutamicum ATCC13032.

[0040] The use of the DNA molecule as a promoter also falls within the protection scope of the present invention.

[0041] The use of the DNA molecule or the biological material in the production of L-amino acids also falls within the protection scope of the present invention.

[0042] In the above application, the L-amino acid is at least one of L-isoleucine, L-lysine, L-threonine, and L-valine, and may also be other L-amino acids.

[0043] The promoter of the present invention can be used to produce a variety of products, including but not limited to L-isoleucine in the embodiment, and the products produced can also be glutamic acid, valine, glycine, alanine, leucine, lysine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, arginine, histidine, shikimic acid, protocatechuic acid, succinic acid, α-ketoglutaric acid, citric acid, ornithine, citrulline, etc. When various products are produced, the promoter of the present invention is placed upstream of the gene in the synthetic pathway of the target product and the promoter drives the synthesis of the gene in the synthetic pathway of the target product to achieve the production of the target product.

[0044] In one embodiment of the present invention, the gene in the target product synthesis pathway is the NCgl0780 gene (whose sequence is 270-1433 of SEQ ID No. 5).

[0045] The present invention also provides a method for producing L-amino acids, which comprises: introducing the DNA molecule into a biological cell capable of synthesizing the target L-amino acid, so that the DNA molecule drives the expression of genes in the target L-amino acid synthesis pathway in the biological cell to obtain a recombinant biological cell; and culturing the recombinant biological cell to obtain the target L-amino acid.

[0046] The biological cell is any biological cell that can synthesize the target L-amino acid.

[0047] Specifically, the biological cell is at least yeast, bacteria, algae or fungi that can synthesize the target L-amino acid, and may also be other biological cells that can synthesize the target L-amino acid.

[0048] Described bacterium can be at least Corynebacterium glutamicum.Described bacterium can also be other bacterium, as Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium pekinense, Brevibacterium ammoniae, Corynebacterium dentata or Pantoea.

[0049] The target L-amino acid can be at least one of L-isoleucine, L-lysine, L-threonine, and L-valine, or other L-amino acids.

[0050] In one embodiment of the present invention, the target L-amino acid is L-isoleucine, and the bacterium is Corynebacterium glutamicum CGMCC 20437.

[0051] In one embodiment of the present invention, the target L-amino acid is L-isoleucine, and the bacterium is Corynebacterium glutamicum ATCC13032.

[0052] The bacteria used to produce L-isoleucine using the promoter of the present invention include but are not limited to Corynebacterium glutamicum CGMCC20437 and Corynebacterium glutamicum ATCC13032. The promoter of the present invention can be placed upstream of genes in the L-isoleucine synthesis pathway of these bacteria, so that the promoter of the present invention can drive the expression of genes in the L-isoleucine synthesis pathway in these bacteria to synthesize L-isoleucine.

[0053] The gene in the L-isoleucine synthesis pathway is the NCgl0780 gene in Corynebacterium glutamicum, such as the NCgl0780 gene in Corynebacterium glutamicum CGMCC 20437 or Corynebacterium glutamicum ATCC13032 (the 270th to 1433rd positions of SEQ ID No.5 are shown as the NCgl0780 gene).

[0054] The promoter of the present invention has promoter activity, and the wild-type NCgl0780 gene promoter (pNCgl0780, SEQ ID No. 1) is replaced by the mutated promoter pNCgl0780 shown in SEQ ID No. 2. * The production of L-isoleucine can be increased by using either pNCgl0780 or pNCgl0780 * Driving the expression of the NCgl0780 gene or increasing the expression level of the NCgl0780 gene can also increase the production of L-isoleucine.

[0055] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0056] Description of biological material deposit

[0057] Classification name: Corynebacterium glutamicum

[0058] Strain ID: YPILE001

[0059] Name of depository: China National Microbiological Culture Collection Administration General Microbiology Center

[0060] Abbreviation of depository unit: CGMCC

[0061] Address of the depository: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101

[0062] Date of deposit: August 17, 2020

[0063] CGMCC Registration Number: CGMCC No.20437 DETAILED DESCRIPTION

[0064] The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, instruments, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources. The following examples were processed using SPSS11.5 statistical software, and the experimental results were expressed as average values, and One-way ANOVA tests were used.

[0065] Corynebacterium glutamicum CGMCC 20437 in the following examples has been deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration Committee (referred to as CGMCC, address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences) on August 17, 2020, with a deposit registration number of CGMCC No. 20437 and a classification name of Corynebacterium glutamicum. Corynebacterium glutamicum CGMCC20437 contains an L-isoleucine synthesis pathway.

[0066] The cultivation of Corynebacterium glutamicum in Examples 1-5 was carried out at 32°C.

[0067] Example 1: Construction of a recombinant vector containing a point mutation in the promoter region of the NCgl0780 gene

[0068] According to the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, a pair of primers for amplifying the promoter region of the pyridoxal phosphate aminotransferase encoding gene NCgl0780 were designed and synthesized, and a mutation was introduced into the promoter of the NCgl0780 gene of Corynebacterium glutamicum CGMCC 20437 (sequencing confirmed that the wild-type NCgl0780 gene promoter was retained on the chromosome of the strain) (denoted as pNCgl0780, whose sequence is SEQ ID No. 1) by allele replacement. The mutation was to mutate the GCACG at positions 158-162 in the nucleotide sequence (SEQ ID No. 1) of the promoter region of the NCgl0780 gene to CTGCGC, and the mutated promoter was denoted as pNCgl0780. * , whose sequence is SEQ ID No.2.

[0069] The vector was constructed using NEBuilder recombination technology. The primers were designed as follows (synthesized by Shanghai Invitrogen). The nucleotides in bold font are the mutation positions:

[0070] P1: 5′- CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG GAGATGAGGTTTCTTTTGAG-3′,

[0071] P2:

[0072] P3:

[0073] P4: 5′- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC CTCATCTGAC AACACCAAC-3′.

[0074] Construction method: Using Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed with primers P1 and P2, P3 and P4, respectively, to obtain two DNA fragments (NCgl0780 Up and NCgl0780 Down) of the NCgl0780 gene coding region with mutant nucleotides and sizes of 560 bp and 755 bp, respectively.

[0075] The two DNA fragments (NCgl0780 Up and NCgl0780 Down) were separated and purified by agarose gel electrophoresis, and then ligated with the pK18mobsacB vector (BioVector, which contains a kanamycin resistance marker) that had been digested with enzymes (Xbal I / BamH I) and purified using NEBuilder enzyme (NEB) at 50°C for 30 min. The ligated product was transformed into DH5α and the resulting monoclonal clone was identified by PCR using M13 primers (M13F: 5′-TGT AAA ACG ACG GCC AGT-3′, M13R: 5′-CAG GAA ACA GCTATG ACC-3′) to obtain the positive recombinant vector pK18-pNCgl0780. * . Cut the correct recombinant vector pK18-pNCgl0780 * The recombinant vector pK18-pNCgl0780 containing the correct point mutation was sent to a sequencing company for sequencing identification. * Save for later use.

[0076] Recombinant vector pK18-pNCgl0780 * Containing the DNA fragment shown in SEQ ID No.3, which is a recombinant vector obtained by replacing the fragment (small fragment) between the Xbal I and BamHI recognition sites of the pK18mobsacB vector with the DNA fragment shown at positions 37-1237 of SEQ ID No.3 in the sequence list, while keeping the other sequences of the pK18mobsacB vector unchanged.

[0077] Recombinant vector pK18-pNCgl0780 * Containing the mutated promoter pNCgl0780 shown in SEQ ID No.2 * .

[0078] Example 2: Construction of promoter pNCgl0780 * Engineered strain driving NCgl0780 gene expression

[0079] Construction method: The allelic replacement vector (pK18-pNCgl0780 *) was transformed into Corynebacterium glutamicum CGMCC 20437 and ATCC13032 by electroporation, and then cultured in a culture medium. The culture medium components are shown in Table 1. Single colonies produced by the culture were selected and cultured on a culture medium containing 15% sucrose (sucrose concentration was 15 g / L, and other components and concentrations were shown in Table 1). Single colonies produced by the culture were cultured on a culture medium containing kanamycin and a culture medium without kanamycin, respectively. The strains that grew on the culture medium without kanamycin but did not grow on the culture medium containing kanamycin were selected for further PCR identification using the following primers (synthesized by Shanghai Invitrogen Company):

[0080] P5: 5′-AAAAACTTAA AATAGTATGG-3′,

[0081] P6: 5′-TATTTGATCC CCCATTGATT-3′.

[0082] The obtained PCR amplification products (240 bp) were sequenced, and through sequence comparison, the strains with promoter sequence mutations were positive strains with successful allelic replacement, and were named YPI-p0780-1 and YPI-p0780-2, respectively.

[0083] The recombinant bacteria YPI-p0780-1 and YPI-p0780-2 are obtained by replacing the wild-type NCgl0780 gene promoter (SEQ ID No. 1) in Corynebacterium glutamicum CGMCC 20437 and Corynebacterium glutamicum ATCC13032 strains with the mutated promoter pNCgl0780 shown in SEQ ID No. 2. * The obtained strains had NCgl0780 genes in them all derived from pNCgl0780 * Drive expression.

[0084] Table 1. Composition of culture medium (the rest is water)

[0085] Element concentration sucrose 10g / L Polypeptone 10g / L Beef extract 10g / L Yeast powder 5g / L Urea 2g / L Sodium chloride 2.5g / L Agar powder 20g / L pH 7.0

[0086] Example 3: Construction of pNCgl0780 and pNCgl0780 on the genome * Engineered strain driving NCgl0780 gene expression

[0087] The vector was constructed using NEBuilder recombination technology. Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, three pairs of upstream and downstream homology arm fragments and two expression cassettes (i.e., NCgl0780 gene promoter) were designed and synthesized. p The primers NCgl0780 drive the expression cassette of NCgl0780 gene, recorded as pNCgl0780-NCgl0780; the mutant NCgl0780 gene promoter pNCgl0780* drives the expression cassette of NCgl0780 gene, recorded as pNCgl0780*-NCgl0780), and the two expression cassettes were introduced into Corynebacterium glutamicum CGMCC 20437 and Corynebacterium glutamicum ATCC13032 by homologous recombination.

[0088] The primers were designed as follows (synthesized by Shanghai Invitrogen):

[0089] P7:

[0090] P8:

[0091] P9:

[0092] P10:

[0093] P11:

[0094] P12:

[0095] Construction method: Corynebacterium glutamicum ATCC13032 or YPI-p0780-1 is used as a template, and primers P7 / P8, P9 / P10, and P11 / P12 are used for PCR amplification to obtain an upstream homology arm fragment of 860 bp (the sequence is shown in SEQ ID No.4), a NCgl0780 gene and its promoter fragment of 1453 bp (the sequence is shown in SEQ ID No.5, and the 21st to 269th positions of SEQ ID No.5 are shown as pNCgl0780, the 270th to 1433rd positions are shown as the NCgl0780 gene, and the 21st to 1433rd positions are shown as the expression cassette pNCgl0780-NCgl0780) or a NCgl0780 gene and its mutant promoter NCgl0780* fragment of 1454 bp (the sequence is shown in SEQ ID No.6, and the 21st to 270th positions of SEQ ID No.6 are shown as pNCgl0780 *, positions 271-1434 show the NCgl0780 gene, positions 21-1434 show the expression cassette pNCgl0780*-NCgl0780) and a downstream homology arm fragment of 817 bp (the sequence is shown in SEQ ID No. 7).

[0096] After the PCR reaction, the three fragments amplified from each template were recovered by electrophoresis using a column DNA gel recovery kit. The three recovered fragments were connected to the pK18mobsacB vector (which contained kanamycin resistance as a selection marker) purified after Xbal I / BamH I digestion using NEBuilder enzyme (NEB) at 50°C for 30 minutes. The single clones grown after the ligation product was transformed into DH5α were identified by PCR using M13 primers (M13F: 5′-TGT AAA ACG ACG GCC AGT-3′, M13R: 5′-CAG GAA ACA GCT ATG ACC-3′) to obtain positive integration vectors (recombinant vectors), which were pK18-pNCgl0780OE, pK18-pNCgl0780 * OE, this positive integration vector contains a kanamycin resistance marker, and recombinants with the vector integrated into the genome can be obtained through kanamycin screening.

[0097] The correctly sequenced integration vectors (pK18-pNCgl0780OE, pK18-pNCgl0780 * OE) were electroporated into Corynebacterium glutamicum CGMCC 20437 and ATCC13032, respectively, and cultured in a culture medium. The composition of the culture medium is shown in Table 1. The single colonies produced by the culture were identified by PCR using P13 / P14 primers. The strains that amplified a fragment of 1413 bp by PCR were pNCgl0780 positive strains, and the strains that could not amplify the fragment were the original strains; the strains that amplified a fragment of 1414 bp by PCR were pNCgl0780 positive strains. * The positive strains, those without amplified fragments, were the original strains. The positive strains were cultured on a medium containing 15% sucrose, and the single colonies produced by the culture were further identified by PCR using P15 / P16 primers. The bacteria with a size of 1440 bp were the expression cassettes pNCgl0780-NCgl0780 or pNCgl0780. *-NCgl0780 was integrated into the positive strain of the target genome. The transformed bacteria obtained with Corynebacterium glutamicum CGMCC 20437 as the starting bacteria were named YPI-p0780-3 (without mutation point) and YPI-p0780-4 (with mutation point); the transformed bacteria obtained with Corynebacterium glutamicum ATCC13032 as the starting bacteria were named YPI-p0780-5 (without mutation point) and YPI-p0780-6 (with mutation point).

[0098] The recombinant bacteria YPI-p0780-003 and YPI-p0780-005 contain double copies of the NCgl0780 gene expression cassette shown in SEQ ID No.1; specifically, the recombinant bacteria YPI-p0780-003 and YPI-p0780-005 are obtained by inserting the expression cassette pNCgl0780-NCgl0780 shown in the 21st to 1433rd positions of SEQ ID No.5 into the poxB site in the genomes of Corynebacterium glutamicum CGMCC 20437 and ATCC13032, respectively, while keeping the other nucleotides in the genomes of Corynebacterium glutamicum CGMCC 20437 and ATCC13032 unchanged. The recombinant bacteria containing double copies of the NCgl0780 gene can significantly and stably increase the expression level of the NCgl0780 gene.

[0099] Recombinant strains YPI-p0780-004 and YPI-p0780-006 contain pNCgl0780 * -NCgl0780 expression cassette; specifically, the recombinant bacteria YPI-p0780-004 and YPI-p0780-006 are respectively inserted into the poxB site of the genome of Corynebacterium glutamicum CGMCC 20437 and ATCC13032 into the expression cassette pNCgl0780 shown in positions 21-1434 of SEQ ID No.6 * -pNCgl0780, a recombinant bacterium obtained by keeping other nucleotides in the genome of Corynebacterium glutamicum CGMCC 20437 and ATCC13032 unchanged.

[0100] The PCR identification primers are as follows:

[0101] P13: 5′-GCCAGAAAT GGTTGCGTGA-3′,

[0102] P14: 5′-CCCCACCGTG ATCAACACC-3′,

[0103] P15: 5′-TTGGTGTTGT CAGATGAGGT-3′,

[0104] P16: 5′-TCAAACGTAA TGCGGATCAG-3′.

[0105] Example 4: Construction of vector pNCgl0780 or pNCgl0780 * Engineered strain driving NCgl0780 gene expression

[0106] The NEBuilder recombination technology was used to construct the vector. Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, a pair of amplification vectors pNCgl0780 and pNCgl0780 were designed and synthesized. * The primers for the NCgl0780 gene driven by the PCR product are designed as follows (synthesized by Shanghai Invitrogen Company):

[0107] P17: 5′- GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCC AAAA ACTTAAAATA GTATG-3′ (the underlined nucleotide sequence is the sequence on pXMJ19),

[0108] P18: 5′- ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAAC CTATAGTTTC TTAATCCCC-3′ (the underlined nucleotide sequence is the sequence on pXMJ19).

[0109] Construction method: Corynebacterium glutamicum ATCC13032 and YPI-p0780-1 were used as templates, and primers P17 / P18 were used for PCR amplification to obtain NCgl0780 promoter and its gene fragment (sequence as shown in SEQ ID No.8) 1483 bp and pNCgl0780 * The promoter and its gene fragment (sequence as shown in SEQ ID No.9) of 1484 bp were amplified by electrophoresis and purified and recovered by a column DNA gel recovery kit. The recovered DNA fragment was connected with the shuttle vector pXMJ19 (BioVector, which contains chloramphenicol resistance as a selection marker) recovered by EcoR I / KpnI digestion using NEBuilder enzyme (NEB) at 50°C for 30 min. The single clone grown after the ligation product was transformed into DH5α was identified by PCR with M13R(-48)(5′-AGCGGATAAC AATTTCACAC AGGA-3′) / P18 primers to obtain the positive overexpression vector pXMJ19-pNCgl0780 (containing the pNCgl0780 promoter) and pXMJ19-pNCgl0780. * (containing pNCgl0780 * Promoter), the vector was sent for sequencing. Because the vector contains a chloramphenicol resistance marker, chloramphenicol can be used to screen whether the vector has been transformed into the strain.

[0110] The correctly sequenced pXMJ19-pNCgl0780 and pXMJ19-pNCgl0780 were * The vectors were electrotransformed into Corynebacterium glutamicum CGMCC 20437 and ATCC13032, respectively, and cultured in a culture medium. The composition of the culture medium is shown in Table 1. The single colony produced by the culture was identified by PCR using primer M13R(-48)(5′-AGCGGATAAC AATTTCACAC AGGA-3′) / P18. The PCR amplified fragment containing a size of 1483 bp was a pXMJ19-pNCgl0780 positive strain. The modified strain obtained by using Corynebacterium glutamicum CGMCC20437 as the starting bacteria was named YPI-p0780-7 (without mutation point), and the modified strain obtained by using Corynebacterium glutamicum ATCC13032 as the starting bacteria was named YPI-p0780-9 (without mutation point); the PCR amplified fragment containing a size of 1484 bp was pXMJ19-pNCgl0780 positive strain. * The positive strains, the modified strain obtained with Corynebacterium glutamicum CGMCC 20437 as the starting strain was named YPI-0780-8 (including the mutation point), and the modified strain obtained with Corynebacterium glutamicum ATCC13032 as the starting strain was named YPI-0780-10 (including the mutation point).

[0111] The recombinant bacteria YPI-p0780-7 and YPI-p0780-9 were obtained by introducing the recombinant vector pXMJ19-pNCgl0780 into Corynebacterium glutamicum CGMCC 20437 and ATCC13032, respectively, and both contained the expression cassette pNCgl0780-NCgl0780;

[0112] The recombinant strains YPI-p0780-8 and YPI-p0780-10 were respectively transformed with the recombinant vector pXMJ19-pNCgl0780 * The recombinant bacteria obtained by introducing into Corynebacterium glutamicum CGMCC 20437 and ATCC13032 all contain the expression cassette pNCgl0780 * -NCgl0780.

[0113] Example 5: Construction of an engineered strain with pNCgl0780-NCgl0780 gene deleted from the genome

[0114] The vector was constructed using NEBuilder recombination technology. According to the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers for amplifying the fragments at both ends of the NCgl0780 gene expression cassette were synthesized as upstream and downstream homology arm fragments. The primers were designed as follows (synthesized by Shanghai Invitrogen):

[0115] P19:

[0116] P20:

[0117] P21:

[0118] P22: 5′- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC GCCAAGAAGAACAAC GAAA-3′.

[0119] Construction method: Corynebacterium glutamicum ATCC13032 was used as a template, and primers P19 / P20 and P21 / P22 were used for PCR amplification to obtain a 670 bp upstream homology arm fragment of NCgl0780 and a 644 bp downstream homology arm fragment of NCgl0780.

[0120] The amplified product was subjected to electrophoresis and purified using a column DNA gel recovery kit. The recovered DNA fragment was connected to the pK18mobsacB vector (which contains kanamycin resistance as a selection marker) purified after Xbal I / BamHI digestion using NEBuilder enzyme (NEB) at 50°C for 30 minutes. The single clone grown after transformation of the ligation product was identified by PCR using M13 primers to obtain the positive knockout vector pK18-ΔNCgl0780. The recombinant vector pK18-ΔNCgl0780 contains 1274 bp of Up-Down DNA of ΔNCgl0780 (the sequence is shown in SEQ ID No.10).

[0121] The vector was sent for sequencing, and the knockout vector pK18-ΔNCgl0780 with correct sequencing was electrotransformed into Corynebacterium glutamicum CGMCC 20437 and Corynebacterium glutamicum ATCC 13032, and cultured in a culture medium. The composition of the culture medium is shown in Table 1. The single colonies produced by the culture were identified by PCR using the following primers (synthesized by Shanghai Invitrogen Company):

[0122] P23: 5′-CATC CTGGGGCTGG AGTAG-3′,

[0123] P24: 5′-GCCAAGAAGA ACAACGAAA-3′.

[0124] The strains that simultaneously amplified the bands of 1200 bp and 2364 bp by the above PCR were positive strains, and the strains that only amplified the band of 1200 bp were original strains. The positive strains were screened on 15% sucrose medium and cultured on medium containing kanamycin and medium without kanamycin, respectively. The strains that grew on medium without kanamycin but did not grow on medium containing kanamycin were selected for further PCR identification using P23 / P24 primers, and the strains that amplified the band of 1200 bp were positive strains in which the promoter region and coding region of the NCgl0780 gene were knocked out. The positive strain NCgl0780 fragment was amplified again by P23 / P24 primer PCR and sequenced, and the correctly sequenced strains were named YPI-p0780-11 (the NCgl0780 gene expression cassette on the genome of Corynebacterium glutamicum CGMCC 20437 was knocked out) and YPI-p0780-12 (the NCgl0780 gene expression cassette on the genome of Corynebacterium glutamicum ATCC 13032 was knocked out).

[0125] Example 6, L-isoleucine fermentation experiment

[0126] The strains constructed in the above examples and the original strains Corynebacterium glutamicum CGMCC 20437 and Corynebacterium glutamicum ATCC 13032 were verified by shake flask fermentation. The specific culture medium is as follows, each strain was repeated three times, and the results are shown in Table 3.

[0127] Slant culture: Take the -80℃ stored strain and inoculate it on the activated slant (see Table 1 for the composition of the culture medium), culture it at 30℃ for 24h, and subculture it once;

[0128] Shake flask seed culture: Use an inoculation loop to scrape a ring of slant seeds and inoculate it into a 500mL Erlenmeyer flask filled with 30mL seed culture medium, seal it with nine layers of gauze, and culture it at 37℃, 200rpm for 7-10h;

[0129] Shake flask fermentation culture: inoculate 10-15% of the volume of the seed culture solution into a 500 mL Erlenmeyer flask (final volume 30 mL) filled with fermentation medium (see Table 1 for medium composition, excluding agar powder), seal with nine layers of gauze, and culture at 37°C, 200 r / min with shaking. During the fermentation process, the pH value was maintained at 7.0-7.2 by adding ammonia water; 60% (m / v) glucose solution was added to maintain the fermentation; the fermentation period was 24 h.

[0130] Table 2, shake flask fermentation medium formula (the rest is water)

[0131]

[0132] The results are shown in Table 3. The mutant promoter pNCgl0780 obtained by mutating the wild-type promoter pNCgl0780 in Corynebacterium glutamicum * The production of L-isoleucine can be increased by either increasing the copy number of the expression cassette pNCgl0780-NCgl0780 or introducing the expression cassette pNCgl0780 * -pNCgl0780, are also helpful to improve the production of L-isoleucine, while knocking out the expression cassette is not conducive to the accumulation of L-isoleucine.

[0133] Table 3. L-isoleucine fermentation experimental results

[0134]

[0135] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A DNA molecule comprising the following A1) or A2): A1) a DNA molecule containing the nucleotide sequence of SEQ ID No. 2; A2) A DNA molecule having 75% or more identity with the nucleotide sequence defined in A1) and having promoter function.

2. Biomaterial, characterized in that: The biological material comprises any one of the following B1) to B3): B1) an expression cassette containing the DNA molecule; B2) a recombinant vector containing the expression cassette described in B1); B3) A recombinant microorganism containing the expression cassette described in B1), or a recombinant microorganism containing the recombinant vector described in B2).

3. The biomaterial according to claim 2, characterized in that: B1) The expression cassette comprises the following b11) or b12): b11) the DNA molecule shown at positions 21 to 1433 of SEQ ID No. 5; b12) The DNA molecule shown in positions 21 to 1434 of SEQ ID No.

6.

4. Use of the DNA molecule according to claim 1 as a promoter.

5. Use of the DNA molecule according to claim 1 or the biomaterial according to claim 2 or 3 in producing L-amino acids.

6. The use according to claim 5, characterized in that: The L-amino acid is at least one of L-isoleucine, L-lysine, L-threonine and L-valine.

7. A method for producing L-amino acids, comprising: The DNA molecule of claim 1 is introduced into a biological cell capable of synthesizing the target L-amino acid, so that the DNA molecule of claim 1 drives the expression of genes in the target L-amino acid synthesis pathway in the biological cell to obtain a recombinant biological cell; and the recombinant biological cell is cultured to obtain the target L-amino acid.

8. The method according to claim 7, characterized in that: The biological cell is at least yeast, bacteria, algae or fungi that can synthesize the target L-amino acid.

9. The method according to claim 8, characterized in that: The bacterium is at least Corynebacterium glutamicum.

10. The method according to claim 8 or 9, characterized in that: The target L-amino acid is at least one of L-isoleucine, L-lysine, L-threonine and L-valine.

Images