A circular RNA targeting and inhibiting fish rhabdovirus replication, and its preparation method and application

By preparing circular RNA (SCRV-circRNA-1) targeting inhibiting fish rhizovirus, strongly binding to SCRV-N protein, the efficient prevention and control of fish rhizovirus was solved, and the viral titer and mRNA expression were significantly reduced, vaccines and drugs were provided, and aquaculture benefits and ecological protection were improved.

CN119709759BActive Publication Date: 2025-08-22SHANGHAI OCEAN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510243928.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-03
Publication Date
2025-08-22
Estimated Expiration
2045-03-03

AI Technical Summary

Technical Problem

Fish rhabdovirus has caused serious economic losses to the aquaculture industry, and the existing technology lacks effective prevention and control measures.

Method used

A circular RNA (SCRV-circRNA-1) targeted to inhibit the replication of fish rhabdomyoviruses was designed and prepared, which inhibits the viral replication process through strong binding to the SCRV-N protein.

Benefits of technology

Significantly reduce viral titer and mRNA expression levels, provide fish ramellavirus vaccines and antiviral drugs, reduce the risk of virus transmission, improve breeding benefits, reduce the use of antibiotics, and protect the ecological environment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119709759B_ABST
    Figure CN119709759B_ABST
Patent Text Reader

Abstract

The present invention relates to a circular RNA for targeted inhibition of fish rhabdovirus replication, as well as its preparation method and application. The circular RNA is SCRV-circRNA-1, whose nucleotide sequence is shown in SEQ ID NO:1. The circular RNA is prepared by cyclizing linear SCRV-circRNA-1 with T4 RNA ligase 1, followed by removal of residual linear RNA in the reaction system using RNase R. SCRV-circRNA-1 has strong binding ability with SCRV-N protein, can effectively inhibit the replication of SCRV virus, and can be used in the field of aquaculture to prepare vaccines, antiviral drugs, and other biological immune products for fish rhabdovirus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and particularly relates to a circular RNA for targeted inhibition of fish rhabdovirus replication, and a preparation method and application thereof. Background Art

[0002] Fish rhabdoviruses are a class of pathogens that pose a serious threat to farmed fish. They belong to the Rhabdoviridae family and possess single-stranded, negative-sense RNA genomes. These viruses, with their rapid spread and high mortality rates, pose a serious threat to a wide range of farmed fish. There are numerous types of fish rhabdoviruses, including but not limited to Siniperca chuatsi rhabdovirus (SCRV), infectious pancreatic necrosis virus (IPNV), and viral hemorrhagic septicemia virus (VHSV). These viruses vary in their genomic structure, host range, and pathological symptoms, but all share the common characteristic of rapid transmission in fish and significant economic losses.

[0003] Fish rhabdoviruses are often sensitive to environmental factors, such as temperature and pH, which affect their stability and infectivity. They can induce metabolic reprogramming in host cells to meet the needs of viral replication and trigger a series of immune responses in the host. Viral diseases caused by fish rhabdoviruses cause severe economic losses to aquaculture fish. Therefore, the development of effective prevention and control measures, such as vaccines, antiviral drugs, and biological immune products, is crucial to ensuring the sustainable development of the aquaculture industry.

[0004] In recent years, circular RNA (circRNA), a novel non-coding RNA molecule, has demonstrated its importance in regulating gene expression, participating in RNA-protein interactions, and serving as a disease biomarker. CircRNAs possess a unique closed circular structure that exhibits greater stability and a longer half-life within cells compared to linear RNA. Summary of the Invention

[0005] The present invention aims to solve the above problems and provides a circular RNA for inhibiting the replication of fish rhabdoviruses, as well as a preparation method and application thereof.

[0006] The present invention adopts the following technical solution: a circular RNA that targets and inhibits the replication of fish rhabdovirus, wherein the circular RNA is SCRV-circRNA-1, and its nucleotide sequence is shown in SEQ ID NO: 1.

[0007] A method for preparing circular RNA that targets and inhibits the replication of fish rhabdoviruses, comprising the following steps:

[0008] (1) Analyze the viral SCRV genome sequence and design primers SCRV-circRNA-1-F and SCRV-circRNA-1-R for annealing to form a double-stranded DNA template. T7 RNA polymerase and the double-stranded DNA template are used for T7 RNA transcription to obtain linear RNA, which is then purified by ethanol precipitation.

[0009] (2) Circularization: Use T4 RNA ligase 1 to circularize the purified linear RNA and purify it;

[0010] (3) RNase R enzyme was used to remove the residual linear RNA, and the circularized RNA was purified again by ethanol precipitation to obtain SCRV-circRNA-1.

[0011] Furthermore, the nucleotide sequence of the primer SCRV-circRNA-1-F in step (1) is shown in SEQ ID NO: 2, and the nucleotide sequence of the primer SCRV-circRNA-1-R is shown in SEQ ID NO: 3.

[0012] The application of a circular RNA that targets and inhibits the replication of fish rhabdovirus can reduce the SCRV virus titer and mRNA expression level during post-exposure and pre-exposure prevention.

[0013] The application of circular RNA that targets and inhibits the replication of fish rhabdovirus is used in the preparation of vaccines and antiviral drugs for fish rhabdovirus SCRV.

[0014] SCRV-circRNA-1-F: 5'-AACACCAAATCATCAGGA-3',

[0015] SCRV-circRNA-1-R: 5'-ACAGAGATAGCGGACCAC-3'.

[0016] SCRV enters the cytoplasm through endocytosis, releasing infectious negative-strand ribonucleoprotein (RNP) complexes composed of negative-strand leader RNA, N protein, and P protein, initiating the transcription and replication phases of the viral life cycle. RNA polymerase recognizes the negative-strand RNP complex and initiates primary transcription, producing six different types of RNA, including an uncapped positive-strand leader RNA and five mRNAs, which are translated into N, P, M, G, and L proteins, respectively. The initially synthesized N and P proteins bind to the newly transcribed positive-strand leader RNA to form new positive-strand RNP complexes, which are specialized for viral genome replication. During replication, the N protein plays a key role in packaging the full-length negative-sense genomic RNA into new RNP complexes, while the P protein acts as a cofactor for the L protein, assisting in scanning and processing the RNA template to ensure accuracy and efficiency. Therefore, the correct formation of the RNP complex is crucial for the proper replication and transcription of SCRV. In the present invention, a circular RNA molecule capable of binding to the SCRV-N protein was initially designed, then optimized using Alphafold3 software and verified through interaction experiments such as RNA-pulldown. Finally, a circular RNA molecule with strong binding ability to the SCRV-N protein was designed and named SCRV-circRNA-1. RNA pulldown molecular interaction experiments demonstrated that SCRV-circRNA-1 has a strong binding ability to the SCRV-N protein.

[0017] The advantages of the present invention are as follows: the circular RNA molecule SCRV-circRNA-1 prepared by the present invention has a strong binding ability with the SCRV-N protein. The SCRV-circRNA-1 can significantly reduce the viral titer by more than 90% in cell culture and reduce the SCRV virus mRNA level in both post-exposure treatment and pre-exposure prevention of SCRV. It can be used in the aquaculture industry to prepare vaccines, antiviral drugs and other biological immune products for fish rhabdoviruses, providing a new disease prevention and control technical means for the fish farming industry and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Schematic diagram of the cyclization process of SCRV-circRNA-1 of the present invention.

[0019] Figure 2 Schematic diagram of the direct interaction between SCRV-circRNA-1 and SCRV-N protein of the present invention.

[0020] Figure 3 This is a gel electrophoresis analysis diagram of SCRV-circRNA-1 and linear RNA of the present invention.

[0021] Figure 4 This is a diagram showing the effect of SCRV-circRNA-1 of the present invention on the treatment after SCRV virus exposure.

[0022] Figure 5 This is a diagram showing the effect of SCRV-circRNA-1 of the present invention on pre-exposure prevention of SCRV virus.

[0023] Figure 6 This is the effect of the SCRV-circRNA-1 of the present invention on the expression level of SCRV virus mRNA during post-exposure treatment.

[0024] Figure 7 This is a diagram showing the effect of SCRV-circRNA-1 of the present invention on the expression level of SCRV virus mRNA during pre-exposure prevention.

[0025] Figure 8 Schematic diagram of SCRV-circRNA-1 stability detection of the present invention. DETAILED DESCRIPTION

[0026] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the present invention is further described below in conjunction with specific embodiments. This embodiment is implemented under the premise of the technical solution of the present invention, and provides a detailed implementation method and specific operation process, but the scope of protection of the present invention is not limited to the following embodiments.

[0027] Carp epithelial cells (EPCs) were grown adherently in cell culture medium in a 5% CO2, 28°C incubator. EPCs were cultured in Medium 199 (Invitrogen) supplemented with 10% fetal bovine serum, 100 U / ml penicillin, and 100 mg / ml streptomycin. During viral culture, the cells were maintained in Medium 199 supplemented with only 2% fetal bovine serum.

[0028] The Siniperca chuatsi Rhabdovirus (SCRV) of the present invention is stored in the National Aquatic Animal Pathogen Bank.

[0029] Example 1: Preparation of SCRV-circRNA-1:

[0030] The nucleotide sequence is GGGACGAGAAAAAAGAAACCAAUAUACAGAUUAUCAAGAUUAUUGGAUUUCUUUUCUCUCGACAUUCAAAAUGUAAGCUUGGUACCGAGCUCGG.

[0031] (1) First, primer SCRV-circRNA-1-F, sequence of SEQ ID NO: 2 and primer SCRV-circRNA-1-R, sequence of SEQ ID NO: 3 were annealed to form a double-stranded DNA template. The specific steps are as follows: SCRV-circRNA-1-F 10 μL (100 μM), SCRV-circRNA-1-R 10 μL (100 μM), annealed according to the following procedure, 95 ° C for 5 min, 94 ° C-46 ° C (cooling at a rate of 1 ° C / min), 46 ° C-26 ° C (cooling at a rate of 2 ° C / min), stored at 4 ° C, T7 RNA polymerase and the DNA template formed by annealing above were used to perform T7 RNA transcription of linear RNA. The specific steps are as follows: DNA template 1 μg, T7 transcription buffer 2 μL, NTP mixture (10 mM) 4 μL, T7 RNA polymerase (1 kU / μl) 0.1 μL, add nuclease-free pure water to 20 μL, and incubate at 37°C for 120 minutes;

[0032] (2) After the reaction is completed, the transcribed linear RNA is purified using the ethanol precipitation method. The specific steps are as follows: first, add 160 μL of nuclease-free pure water to expand the reaction volume to 180 μL, then add 20 μL of 3M sodium acetate (pH 5.2) or 20 μL of 5M ammonium acetate and mix thoroughly; add an equal volume of phenol / chloroform mixture (1:1) and extract once (vortex mix for 20-30 seconds, then centrifuge at 14000g for 5-10 minutes to collect the supernatant), then extract with chloroform 1-2 times (vortex mix for 20-30 seconds each time, then centrifuge at 14000g for 5-10 minutes to collect the supernatant). Precipitate the RNA with double the volume of anhydrous ethanol and incubate at -20℃ for at least 30 minutes. Then centrifuge at 14000g for 5-10 minutes at 4℃ to precipitate the RNA. Discard the supernatant, wash the precipitate with 500 μL of pre-chilled 70% ethanol, and resuspend and dissolve the RNA with 20 μL of nuclease-free pure water;

[0033] (3) Use T4 RNA ligase 1 to circularize the purified linear RNA. The specific steps are as follows: take 20 μM linear RNA, 2 μL T4 RNA ligase buffer, 1 μL 1 mM ATP, and 1 μL T4 RNA ligase 1, add nuclease-free pure water to 20 μL, incubate at 37°C for 1 hour, and purify the circularized RNA according to the above-mentioned ethanol precipitation method.

[0034] (4) Use RNase R enzyme to remove the residual linear RNA in the above reaction system. Take 20 μL of the above purified RNA and 3 μL of RNase R enzyme buffer, add nuclease-free pure water to 30 μL, incubate at 37°C for 30 minutes, and then purify the circularized RNA according to the above ethanol precipitation method to finally obtain the purified SCRV-circRNA-1.

[0035] The process of SCRV-circRNA-1 from linear to circular Figure 1 As shown by Figure 1 It can be seen that the linear RNA is formed by reverse splicing of the linker sequence 1 (SEQ ID NO: 4, AAGCUUGGUACCGAGCUCGG) and the linker sequence 2 (GGGACG). During the preparation process, the residual linear RNA in the reaction system was removed by RNase R enzyme. Figure 3 As can be seen from the gel electrophoresis diagram, after the linear RNA is treated with RNase R, the RNA band disappears, while the circular RNA band still exists after RNase R treatment, and the concentration is similar to the RNA concentration before RNase R treatment, indicating that circular RNA has been successfully synthesized in the present invention.

[0036] Depend on Figure 2 It can be seen that the SCRV-circRNA-1 prepared by the present invention has a strong binding ability with the SCRV-N protein. Therefore, it can be seen that SCRV-circRNA-1 has the potential to target and inhibit the replication of SCRV virus.

[0037] Example 2: Effect of SCRV-circRNA-1 on SCRV virus titer during post-exposure treatment and pre-exposure prophylaxis:

[0038] 1. Effect of post-exposure therapy on viral titer: EPC cells in the logarithmic growth phase were obtained, digested with trypsin, and then diluted with cell culture medium (without double antibody) to a cell density of 2.5×10 5 cells / ml to form a cell suspension, and the above cell suspension was added to a 12-well cell culture plate at 1 ml / well. Then, the SCRV virus solution was added to the cell culture plate containing the EPC cell suspension at an MOI of 0.01 / well. At the same time, a negative control was set up and the cells were cultured in a cell culture incubator with a CO2 volume content of 5% and a temperature of 28°C.

[0039] After culturing the cells for 24 hours, the supernatant was discarded, the cells were rinsed with sterile PBS, and then 1 ml of cell culture medium was added per well. The synthesized SCRV-circRNA-1 was then transfected into the EPC cells using Lipofectamine™ 3000 transfection reagent (Thermo Fisher Scientific). 48 hours after transfection, the cell supernatant of each well was collected. Cell maintenance medium was used to maintain the cells at 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 Serially dilute the cell supernatant obtained in the previous step to obtain gradient concentration virus dilutions;

[0040] EPC cells in the logarithmic growth phase were obtained and digested with trypsin solution. The cells were then diluted with cell culture medium (without double antibody) to a cell density of 2.5×10 5 cells / ml to form a cell suspension. The cell suspension was added to a 96-well cell culture plate at 0.1 ml / well, and the cell culture plate was placed in a cell culture incubator with a CO2 volume content of 5% and a temperature of 28°C. After culturing the cells for 24 hours, the culture medium in the 96-well cell culture plate was removed and the cell suspension was added to a 96-well cell culture plate at 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 Virus dilutions of varying concentrations, obtained by serial dilution, were added to the cell culture plates containing cells at a rate of 0.1 ml per well, with triplicate wells for each concentration. After 48 hours of cell culture, cytopathic effects were observed and recorded, and viral titers were calculated.

[0041] The results are as follows Figure 4 It is known.

[0042] 2. Effect of pre-exposure prophylaxis on viral titer: EPC cells in the logarithmic growth phase were obtained. The cells were digested with trypsin and then diluted with cell culture medium to a cell density of 2.5×10 5 The cell suspension was added to a 12-well cell culture plate at 1 ml / well and cultured in a cell culture incubator with a CO2 volume content of 5% and a temperature of 28°C.

[0043] After 24 hours of cell culture, the supernatant in the above 12-well cell culture plate was discarded, and the cells were rinsed with sterile PBS, and then cell culture medium was added at 1 ml / well. The synthesized SCRV-circRNA-1 was transfected into the above EPC cells using Lipofectamine™ 3000 transfection reagent (Thermo Fisher). 24 hours after transfection, the supernatant in the above cell culture plate was discarded and rinsed with sterile PBS. SCRV virus venom was added to the cell culture plate with EPC cells at MOI = 0.01 / well, and a negative control was set up at the same time. The cells were cultured in a CO2 incubator with a CO2 volume content of 5% and a temperature of 28°C. After 48 hours of culture, the cell supernatant of each well was collected and the cells were maintained at 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 The cell supernatant obtained by serial dilution was used to obtain the gradient concentration virus dilution solution;

[0044] EPC cells in the logarithmic growth phase were obtained and digested with trypsin solution, and then diluted with cell culture medium to a cell density of 2.5×10 5 cells / ml to form a cell suspension. The cell suspension was added to a 96-well cell culture plate at 0.1 ml / well, and the cell culture plate was placed in a cell culture incubator with a CO2 volume content of 5% and a temperature of 28°C. After culturing the cells for 24 hours, the culture medium in the 96-well cell culture plate was removed and the cell suspension was added to a 96-well cell culture plate at 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 The virus dilutions of different concentrations obtained by serial dilution were added to the cell culture plate containing cells at 0.1 ml / well, and each concentration was repeated 3 wells. After 48 hours of cell culture, the cytopathic effect was observed and recorded and the virus titer was calculated. The results are as follows Figure 5 shown.

[0045] In order to verify the effect of SCRV-circRNA-1 in inhibiting viral replication, we first detected the therapeutic effect of SCRV-circRNA-1 on cells after SCRV virus exposure. Figure 4It can be seen that compared with the control group, the SCRV virus titer in cells transfected with SCRV-circRNA-1 was significantly reduced, with the virus titer reduced by more than 90%. At the same time, the preventive effect of SCRV-circRNA-1 before SCRV virus exposure was also tested, and it was found that it could also significantly reduce the virus titer. Figure 5 It can be seen that the SCRV virus titer was reduced by about 90% compared with the control group.

[0046] In summary, SCRV-circRNA-1 is suitable for post-exposure treatment and pre-exposure prevention of fish rhabdoviruses, and can significantly reduce the viral titer by more than 90% in cell culture.

[0047] Example 3: Effect of SCRV-circRNA-1 on SCRV virus mRNA expression level:

[0048] 1. Effect of SCRV-circRNA-1 on SCRV mRNA expression during post-exposure therapy: EPC cells in the logarithmic growth phase were digested with trypsin and then diluted with cell culture medium (without double antibody) to a cell density of 2.5×10 5 cells / ml to form a cell suspension. The above cell suspension was added to a 12-well cell culture plate at 1 ml / well, and then the SCRV virus solution was added to the cell culture plate containing the EPC cell suspension at an MOI of 0.01 / well. A negative control was also set up. The cells were cultured in a cell culture incubator with a CO2 volume content of 5% and a temperature of 28°C.

[0049] After culturing the above cells for 24 hours, the supernatant in the cell culture plate was discarded, the plates were rinsed with sterile PBS, and then cell culture medium was added at 1 ml / well; the synthesized SCRV-circRNA-1 was then transfected into the above EPC cells.

[0050] 48 hours after cell transfection, the supernatant from the cell culture plate was discarded and the cells were rinsed once with sterile PBS. Then, 1 ml of Trizol lysis buffer was added to each well and lysed at room temperature for 10 minutes. RNA was then extracted using a total RNA extraction kit (Cornwell). Total RNA was reverse transcribed using a full-length cDNA single-strand synthesis kit (Novozymes). SCRV virus N gene mRNA levels were then measured using a universal high-sensitivity dye-based quantitative PCR detection kit and primers (SCRV-N-RT-1F: 5'-AACACCAAATCATCAGGA-3', SCRV-N-RT-1R: 5'-ACAGAGATAGCGGACCAC-3').

[0051] The results are as follows Figure 6 shown.

[0052] 2. Effect of SCRV-circRNA-1 on SCRV mRNA expression during pre-exposure prophylaxis:

[0053] EPC cells in the logarithmic growth phase were taken and digested with the corresponding digestion solution, and then diluted with cell culture medium to a cell density of 2.5×10 5 The cell suspension was added to a 12-well cell culture plate at 1 ml / well and cultured in a cell culture incubator with a CO2 volume content of 5% and a temperature of 28°C.

[0054] After 24 hours of cell culture, the supernatant in the 12-well cell culture plate was discarded, the cells were rinsed with sterile PBS, and then 1 ml of cell culture medium was added per well. The synthesized SCRV-circRNA-1 was transfected into the EPC cells. 24 hours after transfection, the supernatant in the cell culture plate was discarded and the cells were rinsed with sterile PBS. SCRV virus venom was added to the cell culture plate containing EPC cells at an MOI of 0.01 per well. A negative control was also set up and the cells were cultured in a CO2 incubator with a CO2 volume content of 5% and a temperature of 28°C.

[0055] After culturing the cells for 48 hours, the supernatant in the cell culture plate was discarded and the cells were rinsed with sterile PBS. Then, 1 ml of Trizol lysis buffer was added to each well and lysed at room temperature for 10 minutes. RNA was then extracted using a total RNA extraction kit (Kangwei Century). The total RNA was reverse transcribed using a highly efficient second-generation full-length cDNA single-strand synthesis kit (Novozymes). The mRNA level of the SCRV virus N gene was then detected using a universal high-sensitivity dye-based quantitative PCR detection kit and primers (SCRV-N-RT-1F: 5'-AACACCAAATCATCAGGA-3', SCRV-N-RT-1R: 5'-ACAGAGATAGCGGACCAC-3'). The results are shown in Figure 2. Figure 7 shown.

[0056] Depend on Figure 6 It can be seen that during treatment after SCRV virus exposure, SCRV-circRNA-1 significantly reduced the level of SCRV virus mRNA (N gene), and the mRNA expression of the SCRV-N gene in cells transfected with SCRV-circRNA-1 was reduced by about 80% compared with the control group.

[0057] Depend on Figure 7It can be seen that in pre-exposure prevention of SCRV virus, SCRV-circRNA-1 can also significantly reduce the level of SCRV virus mRNA (N gene). The mRNA level of SCRV-N gene in cells transfected with SCRV-circRNA-1 was reduced by more than 90% compared with the control.

[0058] In summary, SCRV-circRNA-1 has excellent therapeutic effects after SCRV virus exposure and preventive effects before exposure, and both have the ability to significantly reduce SCRV virus mRNA levels, further confirming the therapeutic potential of SCRV-circRNA-1 in controlling SCRV virus replication.

[0059] Therefore, the SCRV-circRNA-1 of the present invention can be used in the preparation of vaccines, antiviral drugs, and other biological immune products for fish rhabdoviruses in the aquaculture industry. SCRV-circRNA-1 can inhibit the replication and proliferation of the fish rhabdovirus SCRV by specifically binding to it, effectively blocking the spread of SCRV in a variety of economically farmed fish, greatly reducing the risk of outbreaks of fish viral diseases caused by SCRV infection, effectively protecting the healthy cultivation of a variety of economically farmed fish, and thus significantly improving the yield and economic benefits of fish farming.

[0060] Furthermore, because this circular RNA can significantly reduce the outbreak of viral diseases in fish, it can also reduce the occurrence of later complications such as bacterial diseases caused by these viral diseases. The treatment of bacterial diseases mainly relies on the extensive use of antibiotics, which can bring many negative consequences. Therefore, by reducing the occurrence of viral diseases in fish, the risk of bacterial disease outbreaks is reduced, and thus the use of antibiotics is reduced. This has important practical and social significance for protecting the ecological environment, reducing drug residues, and lowering the risk of the emergence of drug-resistant strains.

[0061] Example 4: Detection of SCRV-circRNA-1 stability:

[0062] Detection method: EPC cells in the logarithmic growth phase were taken. The cells were digested with the corresponding digestion solution and then diluted with cell culture medium to a cell density of 2.5×10 5 The cell suspension was added to a 12-well cell culture plate at 1 ml / well and cultured in a cell culture incubator with a CO2 volume content of 5% and a temperature of 28°C.

[0063] After 24 hours of cell culture, the supernatant from the 12-well cell culture plate was discarded, the cells were rinsed with sterile PBS, and then 1 ml of cell culture medium was added per well. The synthesized SCRV-circRNA-1 was transfected into the EPC cells, with five replicate wells transfected. At 24, 36, 48, 60, and 72 hours after transfection, cells from one well were selected, the supernatant was discarded, the cells were rinsed with sterile PBS, and 1 ml of Trizol lysis buffer was added for lysis at room temperature for 10 minutes. RNA was then extracted using a total RNA extraction kit (Cornwell).

[0064] Total RNA was reverse transcribed using a full-length cDNA single-strand synthesis kit (Novozymes). SCRV-circRNA-1 levels were then detected using a universal high-sensitivity dye-based quantitative PCR detection kit and primers (SCRV-circRNA-1-RT-1F: 5'-GGGACGAGAAAAAAGAAAC-3', SCRV-circRNA-1-RT-1R: 5'-CCGAGCTCGGTACCAAGCTT-3'). The results are shown in Figure 2. Figure 8 shown.

[0065] Depend on Figure 8 The results showed that the relative levels of synthesized SCRV-circRNA-1 were detected 24h, 36h, 48h, 60h, and 72h after transfection into EPC cells. SCRV-circRNA-1 showed almost no degradation trend within 48h of transfection, began to degrade after 60h of transfection, and was approximately 40%-50% degraded after 72h of transfection. Therefore, it can be seen that the half-life of SCRV-circRNA-1 in EPC cells is approximately 72h, which shows good stability.

[0066] The basic principles, main features, and advantages of the present invention are shown and described above. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The above embodiments and descriptions are merely illustrative of the principles of the present invention. Various changes and modifications may be made to the present invention without departing from the spirit and scope of the present invention. Such changes and modifications are intended to fall within the scope of the present invention. The scope of protection claimed in the present invention is defined by the appended claims and their equivalents.

Claims

1. A circular RNA that targets and inhibits the replication of fish rhabdovirus, characterized in that: The circular RNA is SCRV-circRNA-1, and its nucleotide sequence is shown in SEQ ID NO:

1.

2. Use of the circular RNA for targeted inhibition of fish rhabdovirus replication as claimed in claim 1 in the preparation of antiviral drugs for fish rhabdovirus SCRV.

Citation Information

Patent Citations

  • Monopterus albus rhabdovirus Cr-ERV and RT-PCR detection primer and application thereof

    CN109182277A