Gene, protein, recombinant expression vector, recombinant bacterium and application of fish interferon

Abstract

The invention relates to a fish interferon gene, a protein, a recombinant expression vector, a recombinant bacterium and application, and belongs to the technical field of fish molecular immunology, the cDNA nucleotide sequence of the fish interferon gene is as shown in SEQ ID NO.1, and the amino acid sequence of the protein coded by the gene is as shown in SEQ ID NO.2. An engineering strain is constructed, a recombinant protein of fish interferon is obtained in vitro, it is found that the recombinant protein can significantly improve the phagocytic ability of macrophages of humpback perch, and it is found that the recombinant protein can significantly enhance the immunologic function of humpback perch for resisting vibrio harveyi infection after overexpression or interference expression of a gene of the interferon of humpback perch. The immune preparation can be developed, and the practical application value is good.

Description

Technical Field

[0001] The invention belongs to the technical field of fish molecular immunology, and particularly relates to a gene, protein, recombinant expression vector, recombinant bacteria and application of fish interferon. Background Art

[0002] Humpback perch ( Cromileptes altivelis As one of the precious economic fish species in the southern coastal areas of China, Vibrio harveyi has delicious meat and high edible and ornamental value, which is deeply loved by consumers. However, in recent years, various diseases caused by bacteria, viruses and parasites have continued to break out in the aquaculture population of silver pomfret, causing huge economic losses. Vibrio harveyi ) is one of the main pathogens. The innate immune system is the first line of defense for fish against pathogenic infections, so the study of the fish immune system is of great significance. At present, there are few studies on the mechanism of action of the humpback seabass immune system, and little is known about the humpback seabass immune-related genes. The interferon system is an important part of the innate immune system. In order to further understand the functional characteristics of fish IFNγrel, it is necessary to improve the protein level research on the basis of genetic level research. Therefore, it is necessary to study the methods and means of humpback seabass IFNγrel in preventing and treating fish diseases and develop useful immune preparations, which are of great reference value for the prevention and treatment of fish diseases.

[0003] Interferon (IFN) is a glycoprotein with broad-spectrum antiviral, anti-tumor and immunomodulatory functions. At present, fish IFN is divided into four types: type I, type II, type III, and type IV based on the characteristics of gene structure, gene locus, interacting receptors, and biological functions. Among them, type II IFN, namely IFNγ, is a type of dimerized soluble cytokine, which is mainly secreted by T lymphocytes and NK cells and has antiviral and immunomodulatory effects. IFNγ is also a multifunctional cytokine that can promote macrophage activation, increase antigen presentation, activate the innate immune system, and regulate cell proliferation and apoptosis.

[0004] In mammals, there is only one type of type II interferon, IFNγ. Unlike mammals, fish have two IFNγ genes (IFNγ1 and IFNγ2). IFNγ2 is homologous to mammalian IFNγ, while IFNγ1 has very low homology to higher vertebrates, so it is also named interferon-related factor (IFNγrelated molecule, IFNγrel). IFNγrel was first expressed in zebrafish ( Danio Rerio ), green puffer fish ( Tetraodon nigirovirdis )、Atlantic salmon ( Salmo salar ), rainbow trout ( Oncorhynchus mykiss )、Channel Catfish( Ictalurus punctatus ),carp( Cyprinus carpio ),goldfish( Carassius auratus ), Japanese crucian carp ( Carassius auratus langsdorfii ),grass carp( Ctenopharyngodon idella ) and Japanese eel ( Anguilla japonica ) and other fish. The structure of the IFNγ gene is different from that of the IFNγrel gene. The C-terminus of the IFNγrel gene lacks a nuclear localization signal domain, which makes it lose the ability to induce chemokines. Under immunogen stimulation, the expression levels of zebrafish IFNγ and IFNγrel genes in various tissues are different, indicating that their functions may be different. The receptor members of mammalian type II interferon are IFNγR1 and IFNγR2. The function of IFNγR1 is to bind to the ligand, and the function of IFNγR2 is to perform signal transduction. In bony fish, IFNγR1 is divided into two genes, IFNγR1-1 and IFNγR1-2, also named CRFB17 and CRFB13. IFNγR2 is homologous to CRFB6 of bony fish and has similar functions. Studies have shown that IFNγrel of zebrafish and grass carp does not bind to CRFB6, indicating that IFNγrel may have specificity in signal transduction. In addition, studies have found that mandarin fish ( Siniperca chuatsi ) and Arapaima ( Arapaima gigas ) can activate downstream gene expression through the mediation of CRFB17, indicating that teleost IFNγrel can exert immunomodulatory function through the receptor CRFB17. Fish interferon induces the expression of ISGs through a JAK-STAT signaling pathway similar to that of mammals to establish a host antiviral defense system. Therefore, fish IFNγrel can also participate in the body's antiviral immunity. Fish IFNγrel also participates in the body's antibacterial immune response. However, compared with the antiviral immune response, research on the participation of fish IFNγrel in the body's antibacterial immune response is relatively scarce. Summary of the invention

[0005] In view of the deficiencies of the prior art, the technical problem to be solved by the present invention is to provide a gene, protein, engineered bacteria and application of fish interferon. The present invention constructs a humpback sea bass IFNγrel recombinant plasmid and transfers it into an expression strain, uses IPTG to induce the expression of the humpback sea bass IFNγrel recombinant protein, optimizes the expression conditions, purifies and obtains the target protein, and further verifies that the prepared humpback sea bass IFNγrel recombinant protein can improve the phagocytic ability of macrophages and enhance the body's anti-bacterial function, so it has good practical application value.

[0006] In order to solve the above technical problems, the present invention provides a fish interferon gene, the cDNA nucleotide sequence of the fish interferon gene is as shown in SEQ ID NO.1: .

[0007] The amino acid sequence of the fish interferon is shown in SEQ ID NO.2: MSSCCASLYLLVLLGVALASGIPCQFAGNLKDTTPDSIVDVLNKQAEIGSNPLFNSVIKSINTSCQRKVHLMNVTLDVYTRIFTSILQHNQHQDKTRTPLLDQLSDQESSQVVSVVTELQKNMEKLKRRLSHVSHEREDLLSKLNRIDVDDPVVQRKALAQFKEVYQAASVIGYPSCGHTHSSSAERR.

[0008] The cDNA nucleotide sequence of the mature protein gene of the fish interferon is shown in SEQ ID NO.3: attccatgccagtttgctgggaacctgaaagacacccctgactccattgtagatgtgctgaacttgaagcaggcagaaattggcagtaatcctctcttcaattcggtcatcaagagcatcaacacc tcctgccagagaaaagtacatctgatgaacgtcactctggatgtctacactcgaatcttcaccagcatcttgcagcacaaccagcaccaagacaagaccaggacacctctgctggaccagctgtct gaccaggaaagctctcaggtggtgtcggttgtgacggagctccaaaagaatatggagaagctgaagagacgcctgagccatgtgagccacgagagagaggacctgctcagcaagctgaacagaata gatgtcgatgaccccgtggttcagaggaaagctctggctcagttcaaggaggtctaccaggcggcctctgtgattggctaccccagctgtggccacacccactcctcgtccgctgagcgacgttga.

[0009] The amino acid sequence of the fish interferon mature protein is shown in SEQ ID NO.4: IPCQFAGNLKDTPDSIVDVLNLKQAEIGSNPLFNSVIKSINTSCQRKVHLMNVTLDVYTRIFTSILQHNQHQDKTRTPLLDQLSDQESSQVVSVVTELQKNMEKLKRRLSHVSHEREDLLSKLNRIDVDDPVVQRKALAQFKEVYQAASVIGYPSCGHTHSSSAERR.

[0010] A recombinant expression vector contains the gene of fish interferon or the gene of mature protein of fish interferon.

[0011] A recombinant bacterium contains a gene of fish interferon or a gene of a mature protein of fish interferon.

[0012] A biological preparation contains the mature protein of the fish interferon and can improve the phagocytic ability of humpback seabass macrophages.

[0013] An interfering preparation is prepared by using the gene of fish interferon as a template and can overexpress the humpback seabass interferon gene to improve the antibacterial ability of the humpback seabass.

[0014] The present invention also provides the application of the fish interferon gene, the recombinant expression vector and the recombinant bacteria in preparing a biological preparation for improving the phagocytic ability of humpback seabass macrophages.

[0015] The present invention also provides application of the fish interferon gene in preparing a biological preparation for improving the antibacterial ability of humpback seabass.

[0016] The present invention provides a gene of fish interferon and a method for recombinantly expressing the protein encoded by the gene, which specifically comprises extracting RNA from the head and kidney tissue of humpback seabass, reversely transcribing the RNA into cDNA, and then using the cDNA as a template and the following sequence as a primer to obtain the nucleotide sequence of the IFNγrel gene by PCR, wherein the sequence of the primer is: Ca IFNγrel-F1: 5'-ggatccgccaccATTCCATGCCAGTTTGCTG-3' (SEQ ID NO. 5); Ca IFNγrel-R1: 5'-gaattcACGTCGCTCAGCGGAC-3', (SEQ ID NO. 6).

[0017] The IFNγrel gene nucleotide sequence obtained by PCR without the signal peptide was connected to the pMD19-T vector and transformed into Escherichia coli DH5α. The recombinant was sequenced and identified. After the sequencing was correct, it was named Ca IFNγrel-Tsimple.

[0018] The above plasmids were extracted and used Bam HI and Eco After digestion with RⅠ restriction endonuclease, the 64-564 bp fragment was recovered; pET-28a plasmid was extracted and Bam HI and Eco After RⅠ digestion, the 64-564 bp recovered fragment was ligated to pET-28a using T4 ligase to construct a recombinant plasmid; the recombinant plasmid was confirmed to contain the IFNγrel gene by gene sequencing and was named pET28a- Ca IFNγrel; the above recombinant pET28a- Ca The IFNγrel plasmid was transferred into the E. coli BL21 expression strain by conventional methods, followed by induction culture and purification to obtain a recombinant protein having the amino acid sequence of SEQ ID NO.4 in the sequence table.

[0019] At the same time, the following sequences were used as primers to amplify the 1-564 bp fragment of the IFNγrel gene using the above method, and the 1-564 bp fragment recovered by enzyme digestion was ligated to the pCN3 vector in the same way to construct p Ca The IFNγrel recombinant plasmid can express a recombinant protein having the amino acid sequence in SEQ ID NO.2 in the fish body.

[0020] Ca IFNγrel-F2: 5'-gatatcgccaccATGTCTTCATGCTGCGCA-3' (SEQ ID NO. 7); Ca IFNγrel-R2: 5'-gatatcACGTCGCTCAGCGGAC-3' (SEQ ID NO. 8).

[0021] The beneficial effects of the present invention compared with the prior art are as follows: the humpback seabass IFNγrel protein of the present invention can significantly improve the phagocytic ability of macrophages. The humpback seabass IFNγrel of the present invention can improve the anti-bacterial infection ability of fish, can be used as an immunopotentiator, and has application value in the preparation of antiviral drugs, antibacterial drugs and anti-inflammatory agents, and the prevention and treatment of fish diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the predicted analysis result of the full-length protein structure of humpback sea bass IFNγrel; Figure 2 This is the electrophoresis diagram of the recombinant protein of humpback seabass IFNγrel purified by Ni column affinity in the embodiment of the present invention; wherein M is the standard molecular weight protein; 1 represents rIFNγrel; the molecular weight of rIFNγrel is 25.0 kDa; Figure 3 The result diagram of IFNγrel improving the phagocytic ability of macrophages in the embodiment of the present invention; Figure 4 The embodiment of the present invention is a graph showing the changes in the number of bacteria in the liver, spleen and head kidney at various time points after the experimental fish overexpressed IFNγrel; Figure 5 The embodiment of the present invention is a graph showing the changes in the number of bacteria in the liver, spleen and head kidney at various time points after the expression of IFNγrel was interfered in experimental fish. DETAILED DESCRIPTION

[0023] The technical solution of the present invention is further explained below by examples, but the technical solution of the present invention is not limited in any form by the examples.

[0024] Humpback seabass IFNγrel, the nucleotide sequence of the humpback seabass IFNγrel gene cDNA is as shown in SEQ ID NO.1, the amino acid sequence of the humpback seabass IFNγrel gene is as shown in SEQ ID NO.2, the nucleotide sequence of the humpback seabass IFNγrel mature protein is as shown in SEQ ID NO.3, and the amino acid sequence of the humpback seabass IFNγrel mature protein is as shown in SEQ ID NO.4.

[0025] The method for preparing the humpback seabass IFNγrel gene recombinant protein is carried out in the following steps: 1. Construction of recombinant vector. RNA was extracted from the head and kidney tissues of humpback sea bass, and reverse transcribed into cDNA. Then, the cDNA was used as a template and the primers Ca IFNγrel-F1 / R1, the nucleotide sequence encoding the mature protein of IFNγrel (SEQ ID NO.3) was obtained by PCR, and the primers Ca IFNγrel-F2 / R2, the nucleotide sequence of IFNγrel gene cDNA (SEQ ID NO.1) was obtained by PCR, and the sequence of the primers was: Ca IFNγrel-F1: 5'-ggatccgccaccATTCCATGCCAGTTTGCTG-3' (SEQ ID NO. 5); Ca IFNγrel-R1: 5'-gaattcACGTCGCTCAGCGGAC-3' (SEQ ID NO. 6).

[0026] Ca IFNγrel-F2: 5'-gatatcgccaccATGTCTTCATGCTGCGCA-3' (SEQ ID NO. 7); Ca IFNγrel-R2: 5'-gatatcACGTCGCTCAGCGGAC-3' (SEQ ID NO. 8).

[0027] The specific operation steps are as follows: Ca The IFNγrel gene (31-158 amino acids) was connected to the pMD19-T vector and transformed into Escherichia coli DH5α. The recombinants were sequenced and identified. After the sequencing was correct, they were named Ca IFNγrel-Tsimple.

[0028] Extract the above recombinant plasmid and use Bam HI and EcoAfter digestion with RⅠ restriction endonuclease, the 64-564 bp fragment was recovered; pET-28a plasmid was extracted and Bam HI and Eco After RⅠ digestion, the above 501 bp recovered fragment was ligated with it using T4 ligase to construct a recombinant plasmid; the recombinant plasmid was verified to contain IFNγrel by gene sequencing and was named pET28a- Ca IFNγrel. The 1-564 bp fragment (1-188 amino acids; Figure 1 ) was connected to pCN3 to obtain p Ca IFNγrel recombinant plasmid.

[0029] 2. Inducible expression and purification of recombinant protein rIFNγrel In order to express the humpback sea bass rIFNγrel recombinant protein, pET28a- Ca IFNγrel was introduced into E. coli BL21 and the strain was stored at -80°C. The strain was then inoculated into LB liquid medium and cultured at 37°C until OD 600 ≈0.6. Then, the cells were induced with 0.1 mM IPTG at 16°C for 30 h and then the cells were collected. Then, the cells were resuspended in 10 mM imidazole buffer, ultrasonically broken and lysed, and the target protein was obtained by Ni column affinity purification. The recombinant protein after purification and dialysis can be found in Figure 2 , which is consistent with the expected protein size. That is, the humpback seabass rIFNγrel recombinant protein was obtained, the amino acid sequence of which is shown in SEQ ID NO.4, length: 167 amino acids, type: amino acid, chain type: single chain, characteristics: molecular weight of 25.0 kDa, isoelectric point of 8.48.

[0030] Example 1: Recombinant protein r Ca IFNγrel can significantly enhance the phagocytic activity of humpback seabass macrophages: Humpback sea bass macrophages were extracted from the head kidney tissue, and 500 μL of humpback sea bass macrophage suspension was inoculated in 12-well plates (5×10 6 cells / well) and incubated at 26°C for 2 h to allow macrophages to adhere to the wall. The culture medium was discarded, the cells were washed three times with sterile PBS, and recombinant protein r was added to each well at a final concentration of 20 μg / mL. CaIFNγrel and BSA (as control group), and then add 30 μL of green fluorescent microspheres to each well and incubate at 26°C in the dark for 2 h. After incubation, discard the supernatant, wash the cells 3 times with PBS, digest the adherent cells with trypsin, and resuspend the cells with culture medium. Centrifuge the cell suspension at 4°C for 10 min, collect the cells, and resuspend the cells with 300 μL of culture medium. Finally, count the cells using a flow cytometer. Use FlowJo V10 for data analysis.

[0031] The results showed that compared with the control group, Ca The ability of IFNγrel-treated macrophages to phagocytose fluorescent microspheres was significantly increased (37.3% and 60.7%, respectively; e.g. Figure 3 ). This result indicates that humpback seabass IFN-γrel can enhance the phagocytic ability of macrophages.

[0032] Experimental Example 2: The humpback seabass IFNγrel of the present invention can significantly improve the anti-bacterial infection ability of the humpback seabass For research Ca IFNγrel overexpression induced antibacterial immunity in vivo. We used an endotoxin-free plasmid extraction kit (Tiangen, China) to extract p Ca IFNγrel was endotoxin-free and diluted to 200 μg / mL with PBS. In addition, 60 humpback sea bass were divided into 3 groups (20 fish / group) and injected intramuscularly with 100 μL of p Ca IFNγrel, pCN3 or PBS (as a control group). Five days after immunization, 5 fish were randomly selected from each group and aseptically dissected to collect head kidney tissue. RNA from the head kidney tissue was then extracted and converted into cDNA, which was used as a template for PCR detection to confirm the expression of the plasmid. Subsequently, the remaining fish were intraperitoneally injected with 100 μL of Vibrio harveyi (2×10 6 CFU / mL). At 6, 9 and 12 hours after injection, spleens and head kidneys of 5 fish in each group were collected aseptically. Finally, the extracted tissues were ground, diluted and spread on LB solid medium with ampicillin. The bacterial load of each group was counted by plate counting method.

[0033] To further determine Ca IFNγrel is involved in the antibacterial effect of humpback seabass. We used siRNA (small interfering RNA) technology to interfere with the fish body. Ca Specifically, we used T7 RiboMAX™ Express RNAi System (Promega, USA) to design primers for synthesizing siCaIFN-γrel, namely si CaIFNγrel-P1 / si Ca IFNγrel-P2 and si Ca IFNγrel-P3 / si Ca IFNγrel-P4, then prepare si Ca We randomly divided 60 fish into three groups (20 fish / group) and injected 15 μg si Ca IFNγrel, 15 μgsi Ca IFNγrel-C (control siRNA) and 100 μL PBS (control group). Twelve hours after siRNA injection, 5 fish from each group were extracted and confirmed as described above. Ca IFNγrel was knocked down. Then, 45 fish were intraperitoneally injected with 100 μL of Vibrio harveyi (2×10 6 CFU / mL). 6, 12 and 24 h after injection, the bacterial load in the spleen and head kidney of each group of fish was analyzed using the plate count method as described above.

[0034] The results showed that compared with the control group, overexpression of p Ca IFNγrel can effectively reduce the bacterial load in fish (such as Figure 4 ). Spleen: 6, 9 and 12 hours after challenge, injected with p Ca The bacterial load of fish in the IFNγrel group was approximately 4.8, 9.6, and 3.4 times lower than that in the control group (e.g. Figure 4 ). Head kidney: 6, 9 and 12 hours after the challenge, inject p Ca The bacterial counts in IFNγrel-treated fish were approximately 1.4-fold, 12.4-fold, and 1.8-fold lower than those in the control group (e.g. Figure 4 Consistent with this, compared with the control group, the knockdown of si Ca After IFNγrel, the bacterial load in fish increased significantly in both examined tissues at each time point (e.g. Figure 5 ). In contrast, si Ca The bacterial load of IFNγrel-C treated fish was almost the same as that of the control group (e.g. Figure 5 These results suggest that humpback sea bass Ca IFNγrel can enhance the body's antibacterial function.

Claims

1. A gene for fish interferon, characterized in that: The cDNA nucleotide sequence of the fish interferon gene is as shown in SEQ ID NO.

1.

2. The protein of fish interferon encoded by the gene according to claim 1, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO.

2.

3. A recombinant expression vector, characterized in that: The recombinant expression vector contains the gene of the fish interferon according to claim 1.

4. A recombinant bacterium, characterized in that: The recombinant bacteria contain the gene of fish interferon.

5. A biological agent, characterized in that: The biological preparation contains the fish interferon protein according to claim 2, and the biological preparation can improve the phagocytic ability of humpback seabass macrophages.

6. An interfering preparation, characterized in that The interfering preparation is prepared using the gene of the fish interferon described in claim 1 as a template, and can overexpress the gene of humpback seabass interferon.

7. Use of the gene of fish interferon according to claim 1 in the preparation of a biological agent for improving the phagocytic ability of humpback seabass macrophages.

8. Use of the fish interferon gene according to claim 1 in the preparation of a biological agent for improving the antibacterial ability of humpback seabass.

Images