A nucleic acid aptamer capable of specifically binding to african swine fever p30 protein and application thereof
By using SELEX technology to screen nucleic acid aptamers that bind to ASFV p30 protein with high specificity, the problems of high cost and low specificity of existing detection methods have been solved, and ASFV antigen detection has been simplified and its sensitivity improved.
Patent Information
- Application Number
- CN202210926063.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2021-12-16
- Filing Date
- 2022-08-03
- Publication Date
- 2025-11-11
- Estimated Expiration
- 2042-08-03
AI Technical Summary
Existing methods for detecting African swine fever virus (ASFV) are costly, have low specificity and sensitivity, are not easy to commercialize and mass-produce, and antibody instability affects clinical applications.
SELEX technology was used to screen nucleic acid aptamers that specifically bind to the ASFV p30 protein. Anti-ASFV drugs and reagents were prepared by labeling amino acids and their derivatives, peptides, proteins, vitamins, hormones, nucleotides, biotin, digoxigenin, fluorescent substances, nanoluminescent materials, enzymes, or colloidal gold.
It provides a highly specific and affinity-based ASFV antigen detection technology, which simplifies the preparation process, reduces costs, and improves the sensitivity and reliability of detection.
Smart Images

Figure CN116265582B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular immunology technology, specifically relating to a nucleic acid aptamer that can specifically bind to the African swine fever p30 protein and its application. Background Technology
[0002] African swine fever (ASF) is caused by African swine fever virus (ASFV). ASFV is mainly transmitted through three routes: domestic pig / pig, domestic pig / soft tick / wild boar, and domestic pig / soft tick. The main target cells of the virus are monocytes and alveolar macrophages. Soft ticks (African ticks) are the main transmission vectors and reservoir hosts of the virus. ASFV is the only member of the African swine feverviridae family and the African swine fevervirus genus. Its genome encodes 151–167 proteins, and mature viral particles contain 54 structural proteins. Among them, the p30 protein is a protein produced in the early stage of viral infection. It is a protein of approximately 30 kDa encoded by the CP204L gene. Due to its strong immunogenicity and ability to induce a strong immune response, p30 is often used as a diagnostic antigen.
[0003] Existing methods for detecting ASFV suffer from various drawbacks, including high cost, low specificity and sensitivity, and difficulty in commercialization and large-scale testing. In particular, antibody-based methods are limited in their clinical application due to antibody instability and complex, time-consuming preparation processes. Summary of the Invention
[0004] The purpose of this invention is to provide a nucleic acid aptamer that can specifically bind to the African swine fever p30 protein and its application, thereby overcoming the shortcomings of the prior art.
[0005] The present invention first provides a nucleic acid aptamer, the sequence of which is as follows: 5′-AACCGCCCAAATCCCTAAGAGTC-(N)42-TGTGCGTGTGTAGTGTGTCTGTG-3′; wherein the sequence of (N)42 is shown in SEQ ID NO: 1 (CGTGCCGCCGTACTGCCCCCGACTAGAGACACACACCAACCC) or SEQ ID NO: 2 (CGTGCCCGCCTCAATACCGCACCATTACACACACAGCGCCAC).
[0006] Furthermore, the nucleic acid aptamer is bound to amino acids and their derivatives, polypeptides, proteins, vitamins, hormones, nucleotides, biotin, digoxigenin, fluorescent substances, nanoluminescent materials, enzymes, or colloidal gold.
[0007] Furthermore, the present invention provides the application of the described nucleic acid aptamer in the preparation of anti-ASFV drugs.
[0008] Furthermore, the present invention provides the application of the described nucleic acid aptamer in the preparation of ASFV-binding reagents.
[0009] Furthermore, the present invention also provides a drug containing the aforementioned nucleic acid aptamer.
[0010] This invention utilizes SELEX technology to screen nucleic acid aptamers from a nucleic acid library using ASFV p30 protein as the binding antigen. Subsequently, through aptamer secondary structure prediction, aptamer affinity determination, and aptamer specificity detection, two nucleic acid aptamers with the highest binding affinity and good specificity were identified, and their core sequences are shown in SEQ ID No: 1 and SEQ ID No: 2, respectively. The ASFV p30 protein-specific nucleic acid aptamers screened and prepared in this invention exhibit excellent specificity and affinity, providing important technical support for further research on ASFV antigen detection technology. Attached Figure Description
[0011] Figure 1 : Predicted secondary structure diagram of nucleic acid aptamers, where a, b, c and d are the secondary structures of p30-ASFV-1, p30-ASFV-10, p30-ASFV-13 and p30-ASFV-46, respectively.
[0012] Figure 2 Nucleic acid aptamer specificity identification diagram, in which the dissociation equilibrium constant of p30-ASFV-13 is KD=5.211nM; the dissociation equilibrium constant of p30-ASFV-46 is KD=3.896nM.
[0013] Figure 3 Nucleic acid aptamer affinity identification diagram.
[0014] Figure 4 : Sandwich ELISA assay for aptamer sensitivity identification. Detailed Implementation
[0015] Nucleic acid aptamers (or simply aptamers) are single-stranded DNA or RNA fragments capable of specifically binding to a variety of target substances. They can be obtained through systematic evolution of ligands by exponential enrichments (SELEX) technology. Compared with antibodies, nucleic acid aptamers have advantages such as a wide range of target substances they can bind to (viruses, bacteria, cells, proteins, peptides, heavy metal ions, etc.), low immunogenicity, good stability, low cost, rapid and simple preparation, easy labeling, and small molecular weight. Therefore, nucleic acid aptamers have broad application prospects in biomolecular detection, disease diagnosis and treatment, and drug residue detection. Aptamers will become a powerful tool in the field of biological and chemical molecular detection and disease treatment.
[0016] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; unless otherwise specified, the materials used in the examples are conventional biochemical reagents that can be purchased from the market.
[0017] The specific sources of experimental materials described in the embodiments of this invention are as follows:
[0018] 1. The protein screening kit was purchased from Onptop Biotechnology Co., Ltd.
[0019] The protein screening kit mainly includes the following materials: carboxyl magnetic beads, real-time PCR Mix, initial screening library with the sequence 5′-CCTATGCGTGCTACCGTGAA-N(42)-GCTATGCGTGGAGTGCTGAA-3′, ordinary PCR Mix, ePCR microdroplet generating oil, micro-volume nucleic acid dialysis membrane, etc.
[0020] 2. The ASFV p30 protein gene was synthesized by Shanghai Sangon Biotech Co., Ltd., and recombinant ASFV-p30, ASFV-p72, ASFV-p54, and ASFV-CD2v proteins with His tags were obtained by prokaryotic expression at the Qingdao National Animal Health Products Engineering Center.
[0021] 3. Two mouse anti-ASFV p30 protein monoclonal antibodies (1C3 and 10B10) were kindly provided by Harbin Veterinary Research Institute, and the His protein was purchased from Shanghai Sangon Biotech Co., Ltd.
[0022] 4. Nitrocellulose membrane (NC membrane) was purchased from HRP-Streptavidin; TMB colorimetric solution and TMB colorimetric stop solution were purchased from Shanghai Beyotime Biotechnology Co., Ltd.
[0023] 5. The ECL luminescence kit was purchased from Affinity Biosciences, and ethyl [3-(dimethylamino)propyl]carbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS) were purchased from Sigma-Aldrich.
[0024] Example 1: Screening for ASFV p30 protein-specific nucleic acid aptamers
[0025] 1.1 Chromatographic purification of ASFV p30 protein
[0026] The ASFV p30 protein was coupled to Ni-NTA medium using the histidine (His) tag on the recombinant protein. Immobilizing the recombinant ASFV p30 protein in Ni-NTA medium allows for subsequent aptamer screening. The specific steps for immobilizing the p30 protein in Ni-NTA medium are as follows: 1 mL of ASFV p30 protein was thawed at 4°C and set aside. A 1 mL Ni-NTA chromatography column was used, the preservation solution was discarded, and the Ni-NTA column was washed with 5-10 mL of ddH2O to remove residual solution. The thawed recombinant ASFV p30 protein was loaded into the chromatography column containing Ni-NTA medium. The column was then incubated at 25°C on a shaker at 180 rpm for approximately 4 hours.
[0027] 1.2 Screening of ASFV p30 protein aptamers
[0028] Using stringent screening conditions yields nucleic acid aptamers with high specificity and high affinity. During the screening process, the incubation time between ssDNA and recombinant protein is progressively reduced, the ASFV p30 protein concentration is decreased, the number of washes is increased, and negative screening steps are incorporated. The specific SELEX protocol for screening nucleic acid aptamers is shown in Table 1.
[0029] Table 1: SELEX Screening Protocol for ASFV p30 Protein Aptamers
[0030] Filtering order Recombinant protein Number of washes after incubation Negative screening 1~3 20μg 3 + 4~6 17.5μg 4 - 7~10 15μg 5 + 11~14 12.5μg 6 - 15~20 10μg 7 + 20~30 10μg 8 +
[0031] Note: (+) indicates that a negative filtering step is added at the beginning of the filtering process; (-) indicates that a negative filtering step is not added at the beginning of the filtering process.
[0032] 1.3 Negative screening of nucleic acid aptamers
[0033] Because nucleic acid aptamer libraries contain extremely abundant nucleic acid sequences, including sequences that can bind to Ni-NTA media, a negative selection process is required before binding the recombinant protein to the nucleic acid aptamer library. This process involves incubating the library with a blank control Ni-NTA medium to remove some nucleic acid ligands that are affinityless for Ni-NTA media, thereby improving the efficiency of target molecule screening and the specificity of nucleic acid aptamers. The negative selection steps are as follows:
[0034] ① cDNA single-stranded library preparation: Mix 25 μL of aptamer library (150 μM) with 200 μL of coupling buffer. Heat at 98 °C for 10 min, then cool at 4 °C for later use.
[0035] ② Washing of Ni-NTA media: Using a pre-assembled Ni-NTA media chromatography column, discard the storage solution. Wash the Ni-NTA media with 5-10 volumes of ddH2O to remove residual solution.
[0036] ③ Column loading of single-stranded libraries: Load the aptamer library onto the Ni-NTA medium, adding 2 mL of coupling buffer and stirring with a glass rod until the Ni-NTA medium is completely suspended. Shake at 120 rpm for 2 hours at room temperature.
[0037] ④ Collection of starting library for screening: Collect the flow-through from the chromatography column, and simultaneously wash the Ni-NTA medium with 2 mL of coupling buffer as shown in Table 1, continuously collecting the flow-through. This flow-through is then used as the starting library for screening.
[0038] 1.4 Forward screening of nucleic acid aptamers
[0039] Due to the His tag on the ASFV p30 protein, the recombinant protein can be coupled to Ni-NTA medium. The recombinant ASFV p30 protein is immobilized in Ni-NTA medium, allowing for subsequent aptamer screening. The forward screening steps for nucleic acid aptamers are shown below.
[0040] ① Take the assembled chromatography column and set it aside. Tighten the bottom outlet of the chromatography column, load the recombinant protein-Ni-NTA complex into the chromatography column, open the outlet, and use the coupling buffer to rinse the chromatography column according to the number of times in Table 1. Discard the buffer.
[0041] ② For the first round of screening, 25 μL (150 μM) of the primary nucleic acid aptamer library (synthesized by Shanghai Bioengineering Co., Ltd.) was directly incubated with Ni-NTA medium. In other screening steps, the prepared secondary nucleic acid aptamer library and conjugate were mixed thoroughly and incubated at room temperature for 1 hour.
[0042] ③ Removal of non-specific nucleic acid aptamers: Wash the chromatography column with coupling buffer as required in Table 1 to remove non-specifically bound single-stranded libraries.
[0043] ④ Construction of secondary nucleic acid aptamer library: Elute the single-stranded DNA-ASFV p30 protein complex using 3-4 column volumes of elution buffer (50mM EDTA, 10mM PBS solution), and simultaneously recover the ssDNA from the collected solution.
[0044] a. Add all the collected solution to a final volume of 20% isopropanol to increase the recovery rate of ssDNA. After mixing, load the liquid onto the adsorption column in multiple portions, centrifuge at 12000 rpm for 1 min, and then discard the waste liquid.
[0045] b. To effectively remove impurities such as proteins from the sample, add 700 μL of 80% anhydrous ethanol to the collection tube for rinsing, centrifuge at 12000 rpm for 1 min, discard the waste liquid, and repeat the washing once.
[0046] c. Centrifuge at 12000 rpm for 2 minutes to remove residual liquid. Place at room temperature for 10-15 minutes to air dry.
[0047] d. Collect ss DNA. Transfer the adsorption column to a clean EP tube, add 30–80 μL of preheated sterile ddH2O, incubate at room temperature for 10 min, then centrifuge at 12,000 rpm for 2 min to collect the single-stranded library of nucleic acid aptamers. (The filtrate can be added back to the adsorption column and centrifuged again to improve the recovery rate of ss DNA.)
[0048] ⑤ PCR amplification was performed to obtain a secondary selection library. The recovered solution was labeled, and PCR was performed using the collected ss DNA as a template to prepare the secondary selection library. The PCR reaction system is shown below, with the upstream primer being 5'-CCTATGCGTGCTACCGTGAA-3' and the downstream primer being 5'-TTCAGCACTCCACGCATAGC-3'.
[0049] Table 2: Single-stranded DNA library amplification system
[0050] reagents Volume (μL) Premix Taq 10 Upstream primer (100mM) 1 Downstream primer (100mM) 1 cDNA 3 <![CDATA[DdH2O]]> 5 Total volume 20
[0051] After preparing the 20 μL system, the PCR reaction program was as follows: 94℃, 5 min; 94℃, 30 s, 55℃, 30 s, 72℃, 20 s, 35 cycles; 72℃, 5 min; 4℃ to terminate the reaction.
[0052] The PCR-amplified library was recovered using agarose gel electrophoresis to purify the library fragments. The recovered solution was heated in a water bath at 95°C for 10 min, and then completely cooled at 4°C. This yielded ssDNA, which was used for the next stage of library screening.
[0053] ⑥ Repeat the above steps for a total of 30 rounds of screening. Add the Ni-NTA of the conjugated ASFV p30 protein to the chromatography column. First, wash the conjugation complex multiple times with buffer, then add 10 μL of the secondary library prepared in the previous round for binding. Afterward, add a negative screening step every 3 rounds until the 20th round. By reducing the concentration of the recombinant protein and increasing the number of elutions, highly specific and high-affinity nucleic acid aptamers can be obtained. Detailed screening system is shown in Table 2.
[0054] ⑦ After completing 30 rounds of SELEX screening, the obtained PCR amplification products were subjected to agarose gel electrophoresis and recovered. The recovered ssDNA was then used for subsequent cloning and sequencing.
[0055] Example 2: Sequencing of ASFV p30 protein aptamers
[0056] The steps for preparing Escherichia coli DH5α competent cells are as follows:
[0057] ① Bacterial cell activation: Streak frozen Escherichia coli DH5α strain onto LB agar plates and incubate overnight at 37°C.
[0058] ② Scale-up culture: Select healthy DH5α single colonies from solid LB plates and add them to 3 mL of LB liquid medium. Incubate at 37°C with shaking until OD reaches 100%. 600 The inoculum was approximately 0.6. The inoculum was inoculated into 250 mL of LB liquid medium at a 1:100 ratio and cultured until the OD value reached [value missing]. 600 The value is around 0.5 to 0.6. The culture medium just begins to become turbid.
[0059] ③ Bacterial cell collection: Transfer the bacterial solution to a sterile test tube and centrifuge at 4000 rpm for 10 min at 4℃.
[0060] ④ Remove the upper layer of culture medium and invert the test tube onto sterile filter paper to absorb any remaining culture medium.
[0061] ⑤ Resuspend the cells in pre-cooled 0.1M CaCl2 solution.
[0062] ⑥ Centrifuge at 4000 rpm for 10 min at 4℃ to recover the cells. Invert the test tube to remove excess culture medium.
[0063] ⑦ Resuspend the cells in pre-cooled 0.1M CaCl2 solution, add glycerol solution and mix well. Aliquot the cells into centrifuge tubes and store at -80℃ for later use.
[0064] Table 3: Nucleic Acid Aptamer Library-pMD-19T Vector Construction System
[0065] reagents volume Glue recycling purpose segment 1μg pMD-19T 3μL Solution I Bring the volume to 10 μL Total volume 10μL
[0066] The steps of cloning and sequencing are as follows:
[0067] Prepare the 10 μL system described above and incubate overnight at 16°C. After agarose gel electrophoresis, transform the vector into the host DH5α.
[0068] Recombinant vector transformation experiment:
[0069] ① Take competent DH5α cells and dissolve them on ice.
[0070] ② Add the connected system to competent DH5α cells and place it on ice for 30 min.
[0071] ③ Heat shock at 42℃ for 90 seconds, then place on ice for 10 minutes.
[0072] ④ Centrifuge the bacterial cells at 8000 rpm and discard the supernatant. Add 1 mL of fresh LB medium and gently agitate the bacterial cells at the bottom of the centrifuge tube.
[0073] ⑤ Place the bacterial cells in a shaker at 37°C and incubate at 200 rpm for 1 hour to revive the bacterial cells.
[0074] ⑥ Centrifuge the revived bacterial cells at 8000 rpm for 1 min to precipitate the cells, and discard part of the culture medium.
[0075] ⑦ Use the remaining culture medium to suspend the bacterial cells, and spread the suspended bacterial cells onto LB agar plates containing ampicillin. Incubate the plates at 37°C upright for 1 hour, then invert for overnight.
[0076] Sequencing: Single colonies were picked from the plate and added to 1 mL of LB broth containing ampicillin. The culture was incubated at 37°C and 200 rpm until the medium became just turbid. PCR amplification was performed on the bacterial culture, and PCR-positive single colonies were selected for sequencing. The samples were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing using universal primers M13F. The sequencing results were manually compared and analyzed.
[0077] During the screening process, the screening pressure was increased to obtain high-performance nucleic acid aptamers. After 10 rounds of screening, the resulting library from the 10th round was cloned and sequenced to obtain the full-length nucleic acid sequences in the library. In this invention, 50 positive single clones were randomly selected, and the sequencing results were analyzed. As shown in Table 4, repetitive sequences appeared among these 50 sequences, indicating that these sequences were enriched during the SELEX screening process. The cloning and sequencing results yielded 4 non-repetitive nucleic acid aptamer sequences, among which p30-ASFV-1 and p30-ASFV-10 sequences appeared most frequently.
[0078] Table 4: First-generation sequencing of nucleic acid aptamers
[0079]
[0080] Example 3: Prediction of Secondary Structure of Nucleic Acid Aptamers
[0081] The sequencing results were analyzed using bioinformatics methods. The obtained sequences were subjected to sequence alignment analysis using ClustalX software, and further analysis was performed using online software (http: / / unafold.rna.albany.edu / ?q=mfold, with conditions set to 26℃, Na...). + Concentration 150mM, Mg 2+ The secondary structures of the screened nucleic acid aptamers were predicted and analyzed at a concentration of 1 mM. The secondary structures of four frequently occurring nucleic acid aptamers were predicted sequentially using the online Mfold software, and the results are as follows: Figure 1 As shown in the diagram, the prediction results indicate that nucleic acid aptamers possess many common nucleic acid secondary structures—stem-loop structures—which are frequently found in tRNA as recognition structures. This suggests that stem-loop structures in the secondary structure of nucleic acid aptamers are the primary form for recognizing target molecules. Comparison of the Gibbs free energies of the four aptamer nucleotides reveals that aptamer p30-ASFV-10 has the lowest Gibbs free energy, indicating greater stability compared to the other aptamers. Observation of the secondary structure prediction diagrams for these four aptamers shows that p30-ASFV-1, p30-ASFV-10, and p30-ASFV-13 have similar structures, potentially recognizing the same recognition site of the target molecule. However, p30-ASFV-46 exhibits significant differences in its secondary structure compared to other nucleic acid aptamers, suggesting it may recognize a different site on the target molecule.
[0082] Example 4: Detection of ASFV p30 protein aptamer affinity
[0083] The binding of target molecules to nucleic acid aptamers can be considered a chemical dynamic equilibrium. Nucleic acid aptamers and target molecules continuously bind and dissociate until the rates of binding and dissociation reach equilibrium. The amounts of nucleic acid aptamers, target molecules, and the complex remain in balance. The affinity of nucleic acid aptamers can be characterized using the dissociation constant. Based on the ELONA method, a quantitative amount of target molecules is immobilized in enzyme-labeled wells and incubated with nucleic acid aptamers. Measuring the dissociation constant of the binding between the nucleic acid aptamer and the target molecule can be used to characterize the affinity of the nucleic acid aptamer. The experimental steps are as follows:
[0084] ① Coating of antigen: Dissolve recombinant protein in 50mM carbonate coating buffer to a final concentration of 10μg / mL, add 100μL of protein solution to a 96-well microplate, and incubate overnight at 4°C.
[0085] ② Blocking: On the second day, discard the coating solution, wash three times with PBST on a horizontal shaker, add 150 μL to each well, and block with 1% BSA for 1 h.
[0086] ③ Incubate with biotin-labeled nucleic acid aptamers: Discard the blocking solution, wash three times with PBST on a horizontal shaker, add 100 μL of PBS solution containing 1, 5, 10, 15, and 20 nM aptamers; incubate at 37°C for 2 h.
[0087] ④ Incubation of streptavidin-labeled horseradish peroxide: Wash three times with PBST, add 100 μL of SM-HRP secondary antibody diluted 1:500 to 1:1000 to each well, and incubate at 37°C and 100 rpm for 1 h on a constant temperature shaker. After incubation, add 200 μL of PBST washing buffer to each well and shake at 37°C on a constant temperature shaker. Wash a total of 5 times.
[0088] ⑤ Color development: Add 100 μL of TMB substrate and develop color for 20 min in the dark. Then add 2 M H2SO4 to terminate the reaction and measure the absorbance at 450 nm. To reduce experimental error, three replicates were set up for each sample.
[0089] KD values were measured using the ELONA method. With a fixed concentration of recombinant ASFV p30 protein, absorbance was measured at 450 nm for different concentrations of aptamers p30-ASFV-1, p30-ASFV-10, p30-ASFV-13, and p30-ASFV-46. 450 A nonlinear fitting curve was established using the ordinate as the vertical axis, and the KD value was calculated. The results are as follows: Figure 2As shown, the dissociation constants (KD) between p30-ASFV-13 and p30-ASFV-46 and the target molecule are both in the nanomolar range. The dissociation constant of p30-ASFV-13 is 5.211 nM, and that of p30-ASFV-46 is 3.896 nM. This indicates that these two aptamers have a high affinity for the recombinant ASFV p30 protein, with p30-ASFV-46 having a higher affinity than p30-ASFV-13. Figure 2 ).
[0090] Example 5: Detection of ASFV p30 protein aptamer specificity
[0091] Enzyme-linked immunosorbent assay (ELISA) is a fundamental detection technique in immunology, medicine, and biochemistry. ELISA operates based on antigen-antibody interactions combined with photometric visualization and is typically performed in microtiter plates. It aims to detect and quantify minute amounts of antigens, such as proteins, peptides, hormones, or antibodies, in liquid samples. With the emergence of novel molecular recognition elements such as nucleic acid aptamers, Drolet et al. systematically analyzed the potential of nucleic acid aptamers to replace or supplement antibodies in ELISA, promoting the development of enzyme-linked oligonucleotide assays (ELONA). Therefore, the specificity of nucleic acid aptamers is characterized based on ELONA by immobilizing different target molecules. The experimental steps for specific identification of the ASFV p30 protein nucleic acid aptamer are shown below:
[0092] ① Antigen coating: Dissolve the recombinant protein to 10 μg / mL with 50 mM carbonate coating buffer, add 100 μL per well to a 96-well microplate, and incubate overnight at 4°C. The different proteins coated were ASFV-p30, ASFV-p72, ASFV-p54, and ASFV-CD2v.
[0093] ② Blocking: On the second day, discard the coating solution, wash three times with PBST on a horizontal shaker, add 150 μL to each well, and block with 1% BSA for 1 h.
[0094] ③ Incubate with biotin-labeled nucleic acid aptamers: Discard the blocking solution, wash three times with PBST on a horizontal shaker, add 100 μL of PBS solution containing 20 nM aptamers, and incubate at 37°C for 2 h.
[0095] ④ Incubation of streptavidin-labeled horseradish peroxide: Wash three times with PBST, add 100 μL of SM-HRP secondary antibody diluted 1:500 to 1:1000 to each well, and incubate at 37°C and 100 rpm for 1 h on a constant temperature shaker. After incubation, add 200 μL of PBST washing buffer to each well and shake at 37°C on a constant temperature shaker. Wash a total of 5 times.
[0096] ⑤ Color development: Add 100 μL of TMB substrate and develop color for 20 min in the dark. Then add 2 M H2SO4 to terminate the reaction and measure the absorbance at 450 nm. To reduce experimental error, three replicates were set up for each sample.
[0097] Example 5: Gel retardation verification of the binding of nucleic acid aptamers to recombinant proteins
[0098] Electrophoretic mobility shift assay (EMSA), also known as gel retardation assay, is a commonly used affinity electrophoresis technique used to study protein-DNA or RNA interactions. To verify whether an interaction exists between recombinant proteins and nucleic acid aptamers, this study used EMSA to verify the interaction between nucleic acid aptamers and recombinant ASFV p30 protein. The experimental steps are as follows:
[0099] 20 μg of recombinant ASFV p30 protein was incubated with 20 μM nucleic acid aptamers p30-ASFV-13 and p30-ASFV-46 in 20 mM phosphate buffer (pH 7.0) for 2 h. A 5% TAE-PAGE gel was prepared as shown in Table 5, and after solidification, electrophoresis was performed in 1×TAE solution. The samples incubated with the nucleic acid aptamers and recombinant ASFV p30 protein were mixed with non-denaturing loading buffer and loaded onto the gel. Electrophoresis was performed at 120 V for 40 min. After electrophoresis, the gel was stained with SYBR Green I for 30 min, and the results were observed using a gel imaging system.
[0100] Table 5: Formulation of 5% TAE-PAGE Gel
[0101]
[0102]
[0103] The ELONA method was used to specifically identify two aptamers, p30-ASFV-13 and p30-ASFV-46. BSA was used as a blank control to rule out false positives. Negative controls were recombinant ASFV-p72, ASFV-p54, and ASFV-CD2v. These two proteins are from different species, were expressed in prokaryotes in the laboratory, and both carry histidine tags. All four aptamers obtained from sequencing were tested. Results are as follows: Figure 3 As shown, BSA, ASFV-p72, ASFV-p54, and ASFV-CD2v showed no specific recognition. Since ASFV-p72, ASFV-p54, and ASFV-CD2v all contain histidine tags, this indicates that the nucleic acid aptamers do not specifically recognize histidine tags. The results show that the nucleic acid aptamers p30-ASFV-13 and p30-ASFV-46 can specifically recognize the recombinant ASFV p30 protein.
[0104] Example 6: Aptamer-based sandwich ELISA for the determination of ASFV p30 protein
[0105] (1) The concentration of purified mouse anti-ASFV p30 protein monoclonal antibody (1C3) was determined by NanoDrop 2000, diluted to 4 μg / mL and coated into 96-well plates, 100 μL per well, incubated at 37℃ for 1 h, and washed 3 times with PBST for 3 min each time.
[0106] (2) Discard the washing solution and add 100 μL of blocking solution to each well, and incubate at 37°C for 1 h;
[0107] (3) ASFV p30 protein was diluted with diluent to 10 μg / mL, 7.5 μg / mL, 5 μg / mL, 2.5 μg / mL, 1 μg / mL, 0.5 μg / mL, and 0.25 μg / mL and added to the sealed wells, 100 μL per well. PBS control wells were also set up. The mixture was incubated at 37℃ for 1 h and washed 3 times with PBST for 3 min each time.
[0108] (4) Dilute the biotin-labeled aptamer p30-ASFV-46 to 100 nM, denature at 95℃ for 5-8 min, and then quickly incubate on ice for 15 min. Add the treated aptamer to the test wells, 100 μL per well. Add mouse anti-ASFV p30 monoclonal antibody (10B10) diluted 1:400 to the positive control wells. PRRSV, CSFV, PRV and PCV2 are used as negative controls. Cell supernatant and PBS are used as blank controls. Incubate at 37℃ for 1 h. Wash 3 times with PBST for 3 min each time.
[0109] (5) Add HRP-labeled streptavidin to the biotin-labeled aptamer test wells and add HRP-labeled goat anti-mouse IgG to the control wells incubated with mouse anti-ASFV p30 monoclonal (10B10). All were diluted 1:1500 times, 100 μL per well, and incubated at 37°C for 45 min. Wash three times with PBST for 3 min each time.
[0110] (6) Add 100 μL of TMB single-component colorimetric solution to each well, develop color in the dark for 15 min, and measure OD. 450 The result is as follows Figure 4 As shown, a positive result is defined as an OD value ≥ negative control OD value × 2.1. Therefore, the lowest detection limit of aptamer p30-ASFV-46 for ASFV p30 protein is 0.25 μg / mL, which is superior to the lowest detection limit of mouse anti-ASFV p30 monoclonal antibody (10B10) of 0.5 μg / mL.
[0111] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A nucleic acid aptamer, characterized in that, The sequence of the nucleic acid aptamer is SEQ ID NO: 1 or SEQ ID NO:
2.
2. The use of the nucleic acid aptamer according to claim 1 in the preparation of a detection reagent for binding African swine fever virus.