Application of wheat WRKY transcription factor gene TaWRKY1

Abstract

The invention discloses application of a wheat WRKY transcription factor gene TaWRKY1, and belongs to the technical field of gene engineering. A nucleotide sequence of an open reading frame of the gene TaWRKY1 is shown as SEQ ID NO: 1, and the gene TaWRKY1 is infected by stripe rust to induce expression in interaction of wheat and stripe rust, and plays a negative regulation role in wheat stripe rust resistance. A TaWRKY1 gene editing mutant plant is created by using an agrobacterium tumefaciens-mediated genetic transformation method, the sporulation quantity on wheat leaves of the gene editing mutant is obviously reduced, and the allergic necrosis is increased, which indicates that the edited gene TaWRKY1 can improve the resistance of wheat to stripe rust. The invention provides a disease-resistant germplasm resource for the cultivation of the stripe rust-resistant wheat variety.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology and relates to wheat WRKY transcription factor gene TaWRKY1 application. Background Art

[0002] Wheat stripe rust is an important disease in wheat production, affecting the yield and quality of wheat. Puccinia striiformis f. sp tritici , Pst) is a fungal disease caused by wheat. The disease may occur from wheat seedling to maturity, mainly harming wheat leaves, followed by leaf sheaths and stems, and also infecting spikes, glume and awns. Wheat stripe rust is mainly spread by air currents. Summer spores spread to wheat fields with air currents and infect healthy wheat plants. In addition, seed infection is also an important way for the disease to spread. Because stripe rust has the characteristics of transparasitism, its toxicity mutates frequently, and new physiological subspecies are prone to appear, resulting in the loss of resistance of many disease-resistant varieties. Therefore, it is of great significance to explore new wheat disease-resistant gene resources and accelerate the creation and cultivation of new wheat stripe rust-resistant varieties.

[0003] Transcription factors are a class of proteins that can recognize and bind to specific regions of DNA, making them the start site of transcription and initiating or inhibiting the transcription of genes associated with them. As one of the largest transcription factor families in plants, WRKY transcription factors are widely involved in the response of plants to biotic, abiotic and hormonal stresses, and play an important role in plant stress resistance, plant defense response to pathogen attacks, growth and development regulation, and regulation of related gene expression. Therefore, studying how WRKY transcription factors play a disease-resistant role in the interaction between wheat and stripe rust and revealing the mechanism of action of transcription factors in resistance to stripe rust is of great significance for improving and breeding wheat varieties resistant to stripe rust. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides a wheat WRKY transcription factor gene TaWRKY1 Application of Gene TaWRKY1 The nucleotide sequence of the open reading frame is shown in SEQ ID NO: 1, and the amino acid sequence of the transcription factor TaWRKY1 encoded by the gene is shown in SEQ ID NO: 2. TaWRKY1 Induced by wheat stripe rust infection, plays a negative regulatory role in wheat stripe rust resistance, gene editing of the gene TaWRKY1 , and can improve the resistance of wheat to stripe rust. The invention provides a disease-resistant germplasm resource for the cultivation of wheat stripe rust-resistant varieties.

[0005] To achieve the technical purpose of the present invention, on the one hand, the present invention provides a wheat WRKY transcription factor gene TaWRKY1 Application of genes in breeding wheat varieties resistant to stripe rustTaWRKY1 The nucleotide sequence of the open reading frame is shown in SEQ ID NO: 1. TaWRKY1 Encodes the transcription factor TaWRKY1, the amino acid sequence of the transcription factor TaWRKY1 is shown in SEQ ID NO:2.

[0006] Furthermore, genes TaWRKY1 Induced by wheat stripe rust infection, plays a negative regulatory role in wheat stripe rust resistance, gene editing of the gene TaWRKY1 , improving wheat's resistance to stripe rust.

[0007] Specifically, the present invention analyzes genes TaWRKY1 The expression profiles of genes infected by different stripe rust species revealed that TaWRKY1 During the interaction between wheat and stripe rust, the gene was induced to express by stripe rust infection. TaWRKY1 The transcription factor TaWRKY1 encoded by it may be involved in the immune regulatory pathway of wheat resistance to stripe rust.

[0008] Specifically, the present invention edits the gene based on CRISPR / Cas9 gene editing technology. TaWRKY1 , created using Agrobacterium-mediated wheat genetic transformation technology TaWRKY1 Gene-edited plants. The T2 positive strains of gene-edited plants were inoculated with the virulent stripe rust race CYR31, and the phenotypes were observed 14 days later. Compared with the wild-type control plants, TaWRKY1 The spore production on the leaves of wheat of the T2 positive lines Line61, Line64 and Line67 of the gene-edited plants was significantly reduced, and the hypersensitive necrosis increased, indicating that the edited genes TaWRKY1 Enhanced wheat resistance to stripe rust.

[0009] Specifically, the present invention constructs an overexpression gene TaWRKY1 The transgenic plants were inoculated with the avirulent race CYR23 of stripe rust and the gene was analyzed. TaWRKY1 The relative expression of the gene in the overexpressing transgenic plants was found to be TaWRKY1 The relative expression level of the overexpressed gene was significantly increased, and the spore production was significantly increased. TaWRKY1 The resistance of plants to stripe rust is weakened, and the gene TaWRKY1 Negative regulation of wheat resistance to stripe rust.

[0010] On the other hand, the present invention claims a method for breeding wheat varieties resistant to stripe rust, gene editing gene TaWRKY1 ,Gene TaWRKY1 The nucleotide sequence of the open reading frame is shown in SEQ ID NO:1.

[0011] Furthermore, the method for breeding wheat stripe rust resistant varieties includes constructing a gene editing vector and transforming the gene editing vector into wheat embryos to obtain wheat stripe rust resistant varieties. TaWRKY1 , the gene editing vector is Cas9.

[0012] In order to fully understand the technical solution of the present invention without objection, it is necessary to add that the wheat WRKY transcription factor gene of the present invention is represented by italic font “ TaWRKY1 " indicates that the wheat WRKY transcription factor protein is represented by the non-italic font "TaWRKY1". Of course, a person skilled in the art can clearly and completely understand the meaning and expression of the relevant genes and their encoded proteins based on the description of the present invention.

[0013] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages: (1) Genes provided by the present invention TaWRKY1 The invention induces expression by infection with wheat stripe rust. TaWRKY1 The expression profiles of genes infected by different stripe rust species revealed that TaWRKY1 During the interaction between wheat and stripe rust, the gene was induced to express by stripe rust infection. TaWRKY1 The transcription factor TaWRKY1 encoded by it may be involved in the immune regulatory pathway of wheat resistance to stripe rust.

[0014] (2) Genes provided by the present invention TaWRKY1 It plays a negative regulatory role in wheat resistance to stripe rust. The present invention constructs an overexpression gene TaWRKY1 The transgenic plants were inoculated with the avirulent race CYR23 of stripe rust and the gene was analyzed. TaWRKY1 The relative expression of the gene in the overexpressing transgenic plants was found to be TaWRKY1 The relative expression level of the overexpressed gene was significantly increased, and the spore production was significantly increased. TaWRKY1 The resistance of plants to stripe rust is weakened, and the gene TaWRKY1 Negative regulation of wheat resistance to stripe rust.

[0015] (3) The present invention edits the gene based on CRISPR / Cas9 gene editing technology TaWRKY1 , created using Agrobacterium-mediated wheat genetic transformation technology TaWRKY1 Gene-edited plants. The T2 positive strains of gene-edited plants were inoculated with the virulent stripe rust race CYR31, and the phenotypes were observed 14 days later. Compared with the wild-type control plants, TaWRKY1The spore production on the leaves of wheat of the T2 positive lines Line61, Line64 and Line67 of the gene-edited plants was significantly reduced, and the hypersensitive necrosis increased, indicating that the edited genes TaWRKY1 Enhanced wheat resistance to stripe rust.

[0016] (4) The present invention provides a new technical idea for breeding wheat stripe rust-resistant varieties from the perspective of molecular biology, laying a foundation for genetic improvement of wheat stripe rust resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present invention.

[0018] Figure 1 For gene TaWRKY1 Expression profile analysis diagram. ** indicates P Value < 0.01.

[0019] Figure 2 for TaWRKY1 PCR positive plant detection results of gene-edited plants. L61, L64 and L67 are TaWRKY1 T2 positive lines of gene-edited plants Line61, Line64 and Line67; P is the final vector TaWRKY1 -Cas9; WT is the wild-type control Fielder; H is the negative control H2O; M is a DNA Marker.

[0020] Figure 3 for TaWRKY1 Schematic diagram of the editing process of gene-edited plants. TaWRKY1 -gRNA is gene TaWRKY1 Target sequence; Target is gene TaWRKY1 Target sequences; WT-3A, WT-3B and WT-3D are three wild-type wheat plants; TaWRKY1 -KO-3A, TaWRKY1 -KO-3B and TaWRKY1 -KO-3D are three T2 generation wheat TaWRKY1 Gene-edited plants; +1bp and -4bp represent the editing conditions of the gene-edited plants.

[0021] Figure 4 for TaWRKY1 Gene editing vector diagram. Target1 and Target2 are TaWRKY1The two target sgRNAs of the gene; TaU6 is the promoter for Target1 and Target2; Cas9 is the core element of the gene editing system, encoding the Cas9 protein; ZmUbi is the maize ubiquitin promoter that activates Cas9 expression.

[0022] Figure 5 for TaWRKY1 The phenotypic results of gene-edited plants after inoculation with stripe rust CYR31. Fielder is a wild-type wheat variety; CYR31 is the physiological subspecies of stripe rust CYR31; TaWRKY1 -KO for TaWRKY1 Gene-edited plants.

[0023] Figure 6 for TaWRKY1 The phenotypic results of the overexpressing transgenic plants after inoculation with stripe rust race CYR23. Fielder is the wild-type wheat variety; CYR23 is the stripe rust race CYR23; TaWRKY1 -OE is TaWRKY1 Overexpression transgenic plants, L69, L78, and L82 are T1 generation positive lines Line69, Line78, and Line82 of overexpression transgenic plants, respectively.

[0024] Figure 7 for TaWRKY1 Gene expression in transgenic plants and wild-type plants TaWRKY1 expression of. TaWRKY1 -OE#L69, TaWRKY1 -OE#L78, TaWRKY1 -OE#L82 are the T1 generation positive lines Line69, Line78 and Line82 of overexpressing transgenic plants. DETAILED DESCRIPTION

[0025] The technical scheme of the present invention is described below in conjunction with the embodiments, but the present invention is not limited to the following embodiments. The experimental methods and detection methods described in each embodiment are conventional methods unless otherwise specified; the reagents and materials described are all commercially available unless otherwise specified.

[0026] Example 1 This example provides wheat WRKY transcription factor gene TaWRKY1 Expression profile analysis.

[0027] Fielder wheat varieties cultivated in normal soil were used as materials. The stripe rust physiological species CYR23 and physiological species CYR33 were inoculated on the second leaf of wheat at the two-leaf and one-heart stage by the smearing method and kept in the dark for 24 h. Water was set as the control group. The inoculated leaves were collected at 24 h, 48 h, 72 h, 96 h and 120 h after inoculation and frozen at -80℃. Total RNA of the collected samples was extracted and reverse transcriptase was used to reverse transcribe the total RNA into the first chain of cDNA. The reverse transcription reaction conditions were: 42℃, incubation for 1 h; 95℃, heating for 5 min. Using cDNA as a template, the wheat elongation factor gene TaEF As the internal reference gene, the gene TaWRKY1 The specific fragments were subjected to real-time fluorescence quantitative PCR, and the reaction conditions were: pre-denaturation: 95℃, 3 min; denaturation: 95℃, 30 sec; annealing: 60℃, 30 sec; extension: 72℃, 30 sec; 40 cycles. The reaction was repeated 3 times, and the Ct value and its average value and standard deviation of each repeat were generated by the quantitative PCR instrument by manually adjusting the baseline. The Ct value was averaged and 2 -△△CT Methods Calculation of Genes TaWRKY1 The relative expression level ( Figure 1 ).

[0028] TaEF Internal reference gene primers: TaEF -F:TGGTGTCATCAAGCCTGGTATGGT; TaEF -R:ACTCATGGTGCATCTCAACGGACT.

[0029] TaWRKY1 Gene-specific fragment primers: TaWRKY1 -qRT-F: AAGAAGAGCCGGGCATCG; TaWRKY1 -qRT-R:TCGTTCATGCGGCTCAGC.

[0030] Depend on Figure 1 It is known that genes TaWRKY1 During the interaction between wheat and stripe rust, the gene was induced to express by stripe rust infection. TaWRKY1 The transcription factor TaWRKY1 encoded by it may be involved in the immune regulatory pathway of wheat resistance to stripe rust.

[0031] Example 2 This example provides wheat WRKY transcription factor gene TaWRKY1 isolated clones.

[0032] Using the cDNA synthesized by reverse transcription in Example 1 as a template, gene TaWRKY1 The specific primers were used to amplify the DNA fragments using a common PCR instrument. The common PCR reaction conditions were as follows: pre-denaturation: 95°C, 5 min; denaturation: 95°C, 30 sec; annealing: 52°C, 30 sec; extension: 72°C, 2 min; 35 cycles. The amplified DNA fragments were sequenced. If the sequencing was correct, the fragment containing the gene was obtained. TaWRKY1 DNA fragment with open reading frame, gene TaWRKY1 The nucleotide sequence of the open reading frame is shown in SEQ ID NO: 1. TaWRKY1 The amino acid sequence of the encoded wheat WRKY transcription factor TaWRKY1 is shown in SEQ ID NO:2.

[0033] Example 3 This example provides a gene TaWRKY1 Creation of mutant plants, analysis of editing status and identification of disease resistance.

[0034] Designing genes in the wheat genome TaWRKY1 Two editing targets were synthesized and annealed to obtain fragments Target-1 and Target-2. The intermediate vector sgRNA was cut with BtgZ1, and then the cut vector was connected to the synthetic fragment Target-1 with T4 ligase. The connection product was transformed into Escherichia coli DH5α. When it grew to the point where plaques could be picked, the monoclonal positive colonies were detected and sent for sequencing by shaking. The monoclonal colonies with correct sequencing were cultured and plasmids were extracted. The vector sgRNA-Target-1 was cut with Bsa1, and then the cut vector was connected to the fragment Target-2 with T4 ligase. The connection product was transformed into Escherichia coli in the same way as above, and sent for sequencing by shaking. The monoclonal colonies with correct sequencing were cultured and plasmids were extracted to obtain the intermediate vector sgRNA-Target-1-Target-2. The intermediate vector sgRNA-Target-1-Target-2 was then connected to the final Cas9 by LR reaction, and the above steps of Escherichia coli transformation and plasmid extraction were continued to obtain the final vector. TaWRKY1 -Cas9. The final vector TaWRKY1 -Cas9 was introduced into Agrobacterium EHA105, which infected young embryos of wheat with Fielder as the recipient variety, and was created using Agrobacterium-mediated genetic transformation technology TaWRKY1 Gene editing materials, and the positive plants of the materials were cultured and planted to the T2 generation, and the T2 generation plants were tested for PCR positive plants ( Figure 2 , Figure 3 , Figure 4 ).

[0035] The T2 generation seeds were sown in 7×7×8 cm pots, with 9 seeds per pot, and the wild type material Fielder was sown at the same time. When the material grew to two leaves and one heart, the affinity race CYR31 was inoculated on the second leaf, and cultured in the dark at 12℃ for 24 hours, and then moved to normal growth conditions (16 hours of light, 14℃; 8 hours of darkness, 10℃ for one growth cycle) for culture, and the phenotype was observed after 14 days ( Figure 5 ).

[0036] Gene editing target design: TaWRKY1 -Target-1-F:ACTTGGAACAACACGAGGAGCGAC; TaWRKY1 -Target-1-R:AAACGTCGCTCCTCGTGTTGTTCC; TaWRKY1 -Target-2-F:ACTCGCATGAACGAGGAGAACCAG; TaWRKY1 -Target-2-R:AAACCCGAAGCCGGCAGCTCTTGC.

[0037] Primers for detecting gene-edited positive plants: NOS-F: AAGCACATACGTCAGAAACATTAT; NOS-R: TGGGTGAGATTCCTTGAAGTTGAGTA.

[0038] Depend on Figure 2 It can be seen that TaWRKY1 The T2 positive lines of gene-edited plants Line61, Line64 and Line67 were successfully transformed with the final vector TaWRKY1 -Cas9. Figure 3 It can be seen that TaWRKY1 Gene-edited plants TaWRKY1 -KO-3A, TaWRKY1 -KO-3B and TaWRKY1 -KO-3D all target genes as expected TaWRKY1 Modified by Figure 5 Compared with the wild-type control plants, TaWRKY1 The spore production on the leaves of wheat of the T2 positive lines Line61, Line64 and Line67 of the gene-edited plants was significantly reduced, and the hypersensitive necrosis increased, indicating that the edited genes TaWRKY1 Enhanced wheat resistance to stripe rust.

[0039] Example 4 This example provides a geneTaWRKY1 Creation of overexpression transgenic wheat and identification of its disease resistance.

[0040] Based on Example 2, the gene TaWRKY1 The overexpression recombinant vector was constructed into the overexpression vector pANIC-6E through Gateway reaction. TaWRKY1 -OE. Then the successful overexpression recombinant vector will be constructed TaWRKY1 -OE was introduced into Agrobacterium EHA105, and the overexpression recombinant vector was transformed into TaWRKY1 -OE was transformed into wheat (Fielder) to obtain the gene TaWRKY1 Overexpression transgenic plants. The overexpression transgenic plants were added to the T1 generation. When the material grew to two leaves and one heart, the non-compatible race CYR23 was inoculated on the second leaf, cultured in the dark at 12℃ for 24 hours, and then moved to normal growth conditions (16 hours of light, 14℃; 8 hours of darkness, 10℃ for one growth cycle). The phenotype was observed after 14 days ( Figure 6 The leaves of the overexpressing transgenic wheat and the Fielder wild-type wheat were collected, RNA was extracted and reverse transcribed into cDNA, and the gene expression in the wild-type wheat and transgenic plants was analyzed. TaWRKY1 The expression of Figure 7 ).

[0041] Primers for constructing overexpression recombinant vector: TaWRKY1 -OE-F:GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGACAAGGGCCACCTCGGT; TaWRKY1 -OE-R: GGGGACCACTTTGTACAAGAAAGCTGGGTCTACCCATACGATGTTCCAGATTACGCTGATTACAAGGACGACGATGACAAGTTGGGTCTCGCTGTTGGTGTTGTTG.

[0042] Depend on Figure 6 and Figure 7 It can be seen that overexpression of transgenic wheat genes TaWRKY1 The relative expression level of the overexpression transgenic plants was significantly increased, indicating that the overexpression transgenic plants were successfully constructed. Compared with the wild-type control wheat, the spore production on the leaves of the overexpression transgenic wheat was significantly increased. TaWRKY1 The resistance of the plants to stripe rust was weakened, indicating that the gene TaWRKY1 It plays a negative regulatory role in wheat's defense response against stripe rust.

[0043] The embodiments described above are part of the embodiments of the present invention, but not all of them. The detailed description of the embodiments of the present invention is not intended to limit the scope of the invention claimed for protection, but only represents selected embodiments of the present invention. All other embodiments obtained without creative work and related deductions and substitutions made by ordinary technicians in the field under the conditions of the concept of the present invention belong to the scope of protection of the present invention.

Claims

1. Wheat WRKY transcription factor genes TaWRKY1 The application of the method in breeding wheat varieties resistant to stripe rust is characterized in that: The gene TaWRKY1 The nucleotide sequence of the open reading frame is shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that: The gene TaWRKY1 Encodes the transcription factor TaWRKY1, and the amino acid sequence of the transcription factor TaWRKY1 is shown in SEQ ID NO:

2.

3. The use according to claim 1, characterized in that: The gene TaWRKY1 Expression was induced by wheat stripe rust infection.

4. The use according to claim 3, characterized in that: The gene TaWRKY1 It plays a negative regulatory role in wheat resistance to stripe rust.

5. The use according to claim 1, characterized in that: Gene editing of the gene TaWRKY1 , improving wheat's resistance to stripe rust.

6. A method for breeding wheat varieties resistant to stripe rust, characterized in that: Gene editing genes TaWRKY1 , the gene TaWRKY1 The nucleotide sequence of the open reading frame is shown in SEQ ID NO:

1.

7. The method for breeding wheat stripe rust resistant varieties according to claim 6, characterized in that: The method comprises constructing a gene editing vector and transforming the gene editing vector into wheat immature embryos to obtain a wheat rust-resistant variety.

8. The method for breeding wheat stripe rust resistant varieties according to claim 7, characterized in that: The gene editing vector is used to edit genes TaWRKY1 ; The gene editing vector is Cas9.

Images