Wheat stripe rust effect protein gene Pst4593 and application thereof

Abstract

The invention discloses a wheat stripe rust effect protein gene Pst4593 and application thereof, and belongs to the technical field of gene engineering. A nucleotide sequence of an open reading frame of the wheat stripe rust effect protein gene Pst4593 is shown as SEQ ID NO: 1, the gene positively regulates pathogenicity of stripe rust to wheat, silence of the wheat stripe rust effect protein gene Pst4593 can improve resistance of wheat to stripe rust, and relative expression quantities of wheat related defense genes TaPR1, TaPR2 and TaPR5 are remarkably improved. The wheat stripe rust effect protein gene Pst4593 is related to induced expression of stripe rust aspirator, and the protein coded by the wheat stripe rust effect protein gene Pst4593 also has lipase activity and can influence pathogenicity of stripe rust. The invention provides a disease-resistant germplasm resource for the cultivation of the stripe rust-resistant wheat variety.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and relates to a wheat stripe rust effector protein gene Pst_4593 and its applications. Background Art

[0002] Wheat stripe rust is one of the most important wheat diseases. It has the characteristics of wide spread and high frequency of epidemics, which affects the growth and development of wheat and causes a reduction in yield. Puccinia striiformis f. sp tritici , Pst) is an airborne disease of wheat caused by wheat stripe rust. As a biotrophic obligate parasitic fungus, wheat stripe rust needs to infect the host and absorb host nutrients to complete its life activities. Wheat stripe rust absorbs nutrients from host cells by producing an infection structure called haustoria to maintain its growth and development. Its infection process includes the invasion period, hyphal expansion period and disease period. 14 days after wheat stripe rust infection, summer spores appear on the surface of the host leaves, completing an infection cycle. Due to the characteristics of wheat stripe rust parasitism, its toxicity mutates frequently, and new physiological subspecies are prone to appear, resulting in the loss of resistance of many disease-resistant varieties. Therefore, it is of great significance to explore new wheat disease-resistant gene resources and accelerate the creation and cultivation of new wheat stripe rust-resistant varieties.

[0003] Effector proteins are a type of exogenous protein molecules secreted by pathogens. Through plant-pathogen interactions, they can change the structure and defense pathways of host plant cells, thereby promoting the successful infection and colonization of host plants by pathogens or triggering host defense responses. Pathogens secrete effector proteins, enter host plant cells, affect different plant disease resistance-related genes, inhibit the host's immune response, and thus help the colonization and infection of pathogens. Lipase, also known as triacylglycerol acyl hydrolase, can hydrolyze triglycerides and is commonly found in animals, plants, and microorganisms. When a disease occurs, lipid homeostasis in the host is lost, which shows that lipids play an important role in maintaining the health of the host. The lipase secreted by pathogens can enhance its pathogenicity by decomposing the host's lipids. Therefore, it is very important to identify effector proteins with lipase structures for the breeding of wheat stripe rust-resistant varieties. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides a wheat stripe rust effector protein gene Pst_4593 And its application. Wheat stripe rust effector protein gene Pst_4593 The nucleotide sequence of the open reading frame is shown in SEQ ID NO: 1. This gene positively regulates the pathogenicity of stripe rust to wheat and silences the wheat stripe rust effector protein gene. Pst_4593The wheat stripe rust resistance can be improved. The wheat stripe rust effector protein Pst_4593 encoded by the gene contains a phospholipase domain, has lipase activity, and can affect the pathogenicity of the stripe rust. The invention provides a disease-resistant germplasm resource for the cultivation of wheat stripe rust-resistant varieties.

[0005] To achieve the technical purpose of the present invention, on the one hand, the present invention provides a wheat stripe rust effector protein gene Pst_4593 , the wheat stripe rust effector protein gene Pst_4593 The nucleotide sequence of the open reading frame is shown in SEQ ID NO: 1. Pst_4593 It has a specific fragment as shown in SEQ ID NO:2.

[0006] On the other hand, the present invention claims protection for the wheat stripe rust effector protein gene Pst_4593 wheat stripe rust effector protein gene Pst_4593 Application of a specific fragment of in breeding wheat stripe rust resistant varieties, the wheat stripe rust effector protein gene Pst_4593 Related to wheat stripe rust immune regulation, wheat stripe rust effector protein gene Pst_4593 Positively regulate the pathogenicity of stripe rust to wheat. Silence the wheat stripe rust effector protein gene Pst_4593 or silencing the wheat stripe rust effector protein gene Pst_4593 Specific fragments of wheat stripe rust, improve wheat stripe rust resistance, improve wheat stripe rust resistance including improving TaPR1 Gene, TaPR2 Gene, TaPR5 Relative expression levels of wheat defense genes such as genes.

[0007] Specifically, the present invention converts the wheat stripe rust effector protein gene Pst_4593 After germination and sowing of silenced plants, it was found that the wheat stripe rust effector protein gene Pst_4593 The number of diseased spores on the leaves of wheat in the silenced plants was significantly less than that in the wild-type control plants, indicating that the wheat stripe rust effector protein gene Pst_4593 Silencing expression can improve plant resistance to wheat stripe rust.

[0008] Specifically, the present invention identifies the wheat stripe rust effector protein gene Pst_4593 Expression of wheat defense genes silenced in wheat plants TaPR1 , TaPR2 , TaPR5 The expression of wheat defense genes TaPR1 , TaPR2 , TaPR5 Significantly upregulated expression, proving the silencing of wheat stripe rust effector protein genes Pst_4593 Can enhance disease resistance of wheat.

[0009] Specifically, the present invention analyzes the effector protein gene of wheat stripe rust Pst_4593 The area and burst of reactive oxygen around the infection point of wheat plants infected with stripe rust were found to be Pst_ 4593 The reactive oxygen accumulation area in the silenced plants was significantly higher than that in the wild type, indicating that silencing the wheat stripe rust effector protein gene Pst_4593 Enhanced wheat disease resistance. Wheat stripe rust effector protein gene Pst_4593 The length of stripe rust hyphae and the infection area in the silenced plants were significantly lower than those in the control Fielder, indicating that silencing the effector protein gene of wheat stripe rust Pst_ 4593 The growth and development of stripe rust in transgenic wheat was inhibited and its pathogenicity was significantly weakened.

[0010] Furthermore, the present invention screened and cloned a wheat stripe rust effector protein gene from the haustoria transcriptome sequencing. Pst_4593 , the wheat stripe rust effector protein gene Pst_4593 Related to the induced expression of stripe rust haustoria. The wheat stripe rust effector protein gene Pst_4593 The encoded protein has lipase activity and affects the pathogenicity of stripe rust.

[0011] Specifically, the present invention detected the lipase activity of wheat stripe rust effector protein Pst_4593 and found that the negative control GST and GST+Ebelactone A had no lipase activity, while Pst_4593 △sp -GST showed higher lipase activity, and after adding lipase inhibitor Pst_4593 △sp -GST's lipase activity was significantly reduced, indicating that the wheat stripe rust effector protein Pst_4593 has lipase activity.

[0012] In addition, the present invention claims a method for breeding a wheat rust-resistant variety, silencing the wheat stripe rust effector protein gene Pst_4593 Or silencing wheat stripe rust effector protein gene Pst_4593 It has been verified that the transgenic wheat obtained by the method of the present invention exhibits resistance to the main epidemic race CYR32 of stripe rust.

[0013] In order to fully understand the technical solution of the present invention without objection, it is necessary to supplement that the wheat stripe rust effector protein of the present invention is represented by a non-italic font "Pst_4593", and the wheat stripe rust effector protein gene is represented by an italic font " Pst_4593Of course, those skilled in the art can clearly and completely understand the meaning and expression of the relevant genes and their encoded proteins based on the description of the present invention.

[0014] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages: Wheat stripe rust effector protein gene provided by the present invention Pst_4593 Positively regulate the pathogenicity of stripe rust to wheat, silence the gene or silence the specific fragment of the gene, and improve the resistance of wheat to stripe rust. Pst_4593 After germination and sowing of silenced plants, it was found that the wheat stripe rust effector protein gene Pst_4593 The number of diseased spores on the leaves of wheat in the silenced plants was significantly less than that in the wild-type control plants, indicating that the wheat stripe rust effector protein gene Pst_4593 Silencing expression can improve the plant's resistance to wheat stripe rust. The present invention uses RNA interference technology to silence the wheat stripe rust effector protein gene Pst_4593 After gene silencing, the growth and development of stripe rust were inhibited, the pathogenicity of stripe rust was reduced, and the wheat-related defense genes TaPR1 , TaPR2 , TaPR5 The relative expression level of wheat stripe rust effector protein gene was significantly increased, which improved the disease resistance of wheat. Pst_4593 Positively regulates the pathogenicity of stripe rust to wheat.

[0015] The present invention screened and cloned a wheat stripe rust effector protein gene from haustoria transcriptome sequencing Pst_4593 The wheat stripe rust effector protein Pst_4593 encoded by the gene contains a phospholipase domain and has lipase activity. The present invention detects the lipase activity of the wheat stripe rust effector protein Pst_4593 and finds that the negative control GST and GST+Ebelactone A have no lipase activity, while Pst_4593 △sp -GST showed higher lipase activity, and after adding lipase inhibitor Pst_4593 △sp -GST's lipase activity was significantly reduced, indicating that the wheat stripe rust effector protein Pst_4593 has lipase activity.

[0016] The present invention uses genetic engineering technology to silence the wheat stripe rust effector protein gene in wheat plants Pst_ 4593 , enhance the resistance of wheat to stripe rust pathogens. It has been verified that the transgenic wheat obtained by the method of the present invention shows resistance to the main epidemic race CYR32 of stripe rust fungi. The present invention provides a new technical idea for breeding wheat stripe rust resistant varieties from the perspective of molecular biology, and lays a foundation for genetic improvement of wheat stripe rust resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present invention.

[0018] Figure 1 wheat stripe rust effector protein gene Pst_4593 DNA molecular detection diagram of silenced wheat plants L8, L9, L10, L11, L12, and L13. M is DNA Marker; Fielder is the wild-type wheat variety; ddH2O is the water control group.

[0019] Figure 2 wheat stripe rust effector protein gene Pst_4593 The results of phenotypic identification of expression-silenced wheat plants L2, L11 and Fielder 14 days after inoculation with the physiological race CYR32 of the rust fungus.

[0020] Figure 3 wheat stripe rust effector protein gene Pst_4593 Effector protein gene expression in wild-type wheat plants and wheat stripe rust Pst_4593 Analysis of expression status in silenced wheat plants. Pst_4593 -RNAi#L2, Pst_4593 -RNAi#L11 are the effector protein genes of two T1 wheat stripe rust strains Pst_4593 Expression silenced wheat plants.

[0021] Figure 4 wheat stripe rust effector protein gene Pst_4593 Expression in silenced wheat plants. Figure 4 A in the wheat defense gene TaPR1 Effector protein gene expression in wild-type wheat plants and wheat stripe rust Pst_4593 Expression in silenced wheat plants; Figure 4 B in the figure is a wheat defense gene TaPR2 Effector protein gene expression in wild-type wheat plants and wheat stripe rust Pst_4593 Expression in silenced wheat plants; Figure 4 C in the expression is a wheat defense gene TaPR5 Effector protein gene expression in wild-type wheat plants and wheat stripe rust Pst_ 4593 Expression in silenced wheat plants.

[0022] Figure 5 wheat stripe rust effector protein gene Pst_4593 Figure 2. The burst of active oxygen around the infection site of silenced plants infected with stripe rust. SV stands for substomatal sac; H2O2 is active oxygen.

[0023] Figure 6 wheat stripe rust effector protein gene Pst_4593 Statistical graph of the area of ​​active oxygen around the infection point after the silenced plants were infected with stripe rust.

[0024] Figure 7 wheat stripe rust effector protein gene Pst_4593 Statistical graph of hypha length and hyphae infection area of ​​stripe rust after expression silenced plants were infected with stripe rust. Figure 7 A in the figure is the mycelial development diagram at different stages of stripe rust infection; Figure 7 B in the figure is a statistical diagram of hyphae length at different stages of stripe rust infection; Figure 7 C in the figure is a statistical chart of mycelial infection area at different stages of stripe rust infection; IH represents primary mycelium; HMC represents haustorium mother cell; H represents haustorium.

[0025] Figure 8 Pst_4593 △sp Western-blot detection and Coomassie brilliant blue staining. Figure 8 A in the figure is the wheat stripe rust effector protein Pst_4593 △sp Western-blot detection diagram; Figure 8 B in the figure is the effector protein of wheat stripe rust Pst_4593 △sp Coomassie blue staining of; GST is GST-tagged protein; △sp Indicates the removal of the gene signal peptide fragment; Pst_4593 △sp -GST is the wheat stripe rust effector protein Pst_4593 fused with GST-tagged protein △sp ;Pst_4593 △sp (G199A)-GST is the 199th glycine (G) in the wheat stripe rust effector protein Pst_4593, which was mutated to alanine (A); Pst_4593 △sp (D255A)-GST is the 255th aspartic acid (D) in the wheat stripe rust effector protein Pst_4593, which was mutated to alanine (A); Pst_4593 △sp (H276A)-GST is a protein in which the histidine (H) at position 276 in the wheat stripe rust effector protein Pst_4593 is mutated to alanine (A).

[0026] Fig. 9This is the result of the lipase activity test of wheat stripe rust effector protein Pst_4593. GST and GST+Ebelactone A are negative controls; Pst_4593 △sp -GST+Ebelactone A is a fusion protein with lipase inhibitor added. DETAILED DESCRIPTION

[0027] The technical scheme of the present invention is described below in conjunction with the embodiments, but the present invention is not limited to the following embodiments. The experimental methods and detection methods described in each embodiment are conventional methods unless otherwise specified; the reagents and materials described are all commercially available unless otherwise specified.

[0028] Example 1 This example provides wheat stripe rust effector protein gene Pst_4593 amplification and sequencing.

[0029] Design of effector protein gene of wheat stripe rust Pst_4593 The full-length primers include the forward primer Pst_ 4593 -F (5' ATGCAATCGCCTAACTTTTGCT 3') and reverse primer Pst_4593 -R (5'TCAGAATCCCTTGTCCGGAGA 3'). The wheat stripe rust effector protein gene was amplified using the cDNA of wheat Shuiyuan 11 (provided by Northwest Agriculture and Forestry University) as a template Pst_4593 And sequenced, we found that wheat stripe rust effector protein gene Pst_ 4593 The nucleotide sequence is shown in SEQ ID NO:1.

[0030] Example 2 This example provides wheat stripe rust effector protein gene Pst_4593 Cultivation of silenced expression plants and identification of disease resistance.

[0031] Built on Gateway technology Pst_4593 -Recombinant vector of RNAi transgenic material, Pst_4593 Interference fragment (gene Pst_4593 The specific fragment of the nucleotide sequence is shown in SEQ ID NO:2) was connected to the pDonor221 intermediate vector by BP reaction, and then connected to the PC336 vector (provided by Northwest Agriculture and Forestry University) by LR reaction to obtain a recombinant vector. After sequencing was correct, the recombinant vector was transferred into the Agrobacterium strain EHA105. The wheat variety Fielder callus was used as the transformation recipient, and the wheat stripe rust effector protein gene was transformed into the wheat stripe rust effector protein gene by Agrobacterium infection method. Pst_4593The silencing vector is introduced into the recipient material, and the T0 generation transgenic plant material is produced through screening, pre-regeneration, regeneration, rooting and other steps. After cultivation, the T1 generation wheat stripe rust effector protein gene is collected Pst_4593 DNA was extracted from leaves of silenced wheat plants L8, L9, L10, L11, L12, and L13 and positive identification was performed. The results were as follows: Figure 1 .Depend on Figure 1 It can be seen that wheat stripe rust effector protein gene Pst_ 4593 The expression-silenced plants L8, L9, L10, L11, L12, and L13 were all positive plants after testing.

[0032] The effector protein gene of wheat stripe rust in T1 generation Pst_4593 After soaking and germination of silenced plants, they were sown in 15×15×12 cm pots. Wild-type material Fielder was sown as a control. In the incubator, the plants were cultured at a temperature difference of 16℃ / 10℃ and a light / dark cycle of 16 h / 8 h. When the second leaf of the seedlings was flat, they were inoculated with the physiological subspecies of stripe rust CYR32. The plants were kept moisturized in a dark room at 16℃ for 24 h, and then moved to normal light for culture. Phenotypic photos and statistics were taken after 14 days. The experimental results are shown in the table. Figure 2 .

[0033] Depend on Figure 2 It can be seen that wheat stripe rust effector protein gene Pst_4593 The number of diseased spores on the leaves of wheat in the silenced plants was significantly less than that in the wild-type control plants, indicating that the wheat stripe rust effector protein gene Pst_4593 Silencing expression can improve the plant's resistance to wheat stripe rust.

[0034] Example 3 This example provides wheat stripe rust effector protein gene Pst_4593 Expression profile analysis.

[0035] Real-time fluorescence quantitative PCR technology was used to analyze the effector protein gene of wheat stripe rust Pst_4593 Expression in the control plant Fielder and the silenced plant. Pst_4593 The expression-silenced wheat plants L2 and L11 were used as experimental materials, and the wheat variety Fielder was used as the control. Wheat leaves were collected at different time points (24, 48, and 120 h) after inoculation with the physiological race CYR32 of stripe rust. Its cDNA was used as a template, and the wheat stripe rust elongation factor gene was used as an internal reference gene (PstEF-F: 5'TTCGCCGTCCGTGATATGAGACAA 3' and PstEF-R: 5'ATGCGTATCATGGTGGTGGAGTGA 3'). Pst_4593Real-time fluorescence quantitative PCR was performed using specific primers (qPCR-Pst_4593-F: 5'AGGTTACATTGCCCGAGTC 3' and qPCR-Pst_4593-R: 5'ACCAAGTTCCGCATCCC 3'). Pst_4593 The nucleotide sequence of the specific fragment is shown in SEQ ID NO: 2. The reaction conditions are: 95°C pre-denaturation for 3 min; 95°C for 15 sec, 60°C for 30 sec, 72°C for 45 sec, and 40 cycles. Each reaction was repeated 3 times. The Ct values ​​and their average values ​​and standard deviations of the repeated Ct values ​​were generated by the quantitative PCR instrument by manually adjusting the baseline. The Ct values ​​were averaged and 2 -△△CT Effector protein genes of wheat stripe rust Pst_4593 The relative expression level ( Figure 3 ).

[0036] Depend on Figure 3 It can be seen that wheat stripe rust effector protein gene Pst_4593 Expression of wheat stripe rust effector protein gene in silenced wheat plants at different time periods after inoculation with stripe rust race CYR32 Pst_4593 The relative expression level of wheat stripe rust effector protein gene was significantly lower than that of wheat variety Fielder. Pst_4593 Successfully silent.

[0037] Example 4 This example provides a method for expressing wheat defense genes in wild-type wheat plants and wheat stripe rust effector protein genes. Pst_4593 Expression in silenced wheat plants.

[0038] Wheat leaves were collected at different time points (24, 48, and 120 h) after inoculation with stripe rust race CYR32, and its cDNA was used as a template and wheat elongation factor gene as an internal reference gene (TaEF-F: 5' TGGTGTCATCAAGCCTGGTATGGT 3' and TaEF-R: 5' ACTCATGGTGCATCTCAACGGACT 3'). TaPR1 , TaPR2 , TaPR5 Real-time fluorescence quantitative PCR was performed with specific primers. The reaction conditions were: 95℃ pre-denaturation for 3 min; 95℃ 15 sec, 60℃ 30 sec, 72℃ 45 sec, 40 cycles. Each reaction was repeated 3 times, and the Ct values ​​and their average values ​​and standard deviations of each repeat were generated by the quantitative PCR instrument by manually adjusting the baseline. The Ct values ​​were averaged and 2 -△△CT Methods Calculate the relative expression of wheat defense genes ( Figure 4 ).

[0039] Gene TaPR1 Specific primers: TaPR1-F: 5' GAGAATGCAGACGCCCAAGC 3'; TaPR1-R: 5' CTGGAGCTTGCAGTCGTTGATC 3'.

[0040] Gene TaPR2 Specific primers: TaPR2-F: 5' AGGATGTGCTTCCATGTTTGCCG 3'; TaPR2-R: 5' AAGTAGATGCGCATGCCGTTGATG 3'.

[0041] Gene TaPR5 Specific primers: TaPR5-F: 5' CAAGCAGTGGTATCAACGCAGAG 3'; TaPR5-R: 5'GTGAAGCCACAGTGTGTTCTTGATGTT 3'.

[0042] Depend on Figure 4 It is known that wheat defense genes TaPR1 , TaPR2 , TaPR5 Effector protein gene in wheat stripe rust Pst_ 4593 The expression of the wheat stripe rust effector protein gene was significantly upregulated in the silenced wheat plants. Pst_4593 Can enhance disease resistance of wheat.

[0043] Example 5 In this example, the effector protein gene of wheat stripe rust was statistically analyzed. Pst_4593 After the silenced plants were infected by stripe rust, the area and burst of active oxygen around the infection point were measured to identify the disease resistance of the silenced plants.

[0044] Wheat leaves were collected at different time points (24, 48, and 120 hours) after inoculation with stripe rust physiological race CYR32, cut into small pieces, and placed in a centrifuge tube containing DAB staining solution with the morphological upper end facing upward. After being placed under strong light for 5 hours, the leaves were taken out and immersed in decolorizing solution. The decolorizing solution was replaced every 24 hours until the leaves became transparent. The wheat leaves were then immersed in chloral hydrate solution and fixed for 24 hours before being preserved in 30% glycerol. During observation, an Olympus fluorescence microscope was used to observe and count the active oxygen area near the infection point in the leaf tissue ( Figure 5 , Figure 6), the observation of the substomatal sac will be used as the basis for determining the infection point.

[0045] The decolorized and transparent wheat leaves were stained with wheat germ agglutinin (WGA, which can specifically bind to the small molecule glycoprotein on the chitin of the fungal cell wall. WGA coupled with fluorescein was used to stain the infected leaves, and the hyphae structure could be clearly observed under fluorescence. The GFP fluorescence channel of the Olympus fluorescence microscope was used to observe the hyphae structure of stripe rust and to count the hyphae length and infection area ( Figure 7 The length of hyphae was calculated based on the distance from the top of the longest hyphae to the top of the substomatal capsule. 30 to 50 infection points were counted for each tissue sample, repeated three times, and the statistical data were analyzed for significant differences.

[0046] Depend on Figure 5 and Figure 6 It can be seen that wheat stripe rust effector protein gene Pst_4593 The reactive oxygen accumulation area in the silenced plants was significantly higher than that in the wild type, indicating that silencing the wheat stripe rust effector protein gene Pst_4593 Enhanced wheat disease resistance. Figure 7 It can be seen that wheat stripe rust effector protein gene Pst_4593 The length of stripe rust hyphae and the infection area in the silenced plants were significantly lower than those in the control Fielder, indicating that silencing the effector protein gene of wheat stripe rust Pst_4593 The growth and development of stripe rust in transgenic wheat was inhibited and its pathogenicity was significantly weakened.

[0047] Example 6 This example provides the detection of lipase activity of wheat stripe rust effector protein Pst_4593.

[0048] Construction of a gene containing wheat stripe rust effector protein Pst_4593 BamH Ⅰ and Sal Ⅰ were selected as restriction sites, and the effector protein gene of wheat stripe rust was cloned into pGEX-4T-1 vector and its mutant recombinant vector. Pst_4593The nucleotide sequence of the pGEX-4T-1 gene was obtained by using primers designed by homologous recombination. The cDNA of the summer spores of the physiological race CYR31 of wheat stripe rust was used as a template for amplification. The amplified products were detected by agarose gel electrophoresis. The gel containing the target DNA fragment was cut out, and the target gene fragment was recovered by gel. Subsequently, BamH Ⅰ and Sal Ⅰ were selected as restriction sites for double restriction digestion of pGEX-4T-1. The restriction digestion was carried out at 37℃ for 4h, and the restriction vector was separated by agarose gel electrophoresis. The gel containing the target vector was cut out, and the restriction vector was recovered by gel. The vector was constructed using the OneStep Cloning Kit (Vazyme). After reacting in a metal bath at 37℃ for 30min, it was placed on ice for 5min and transformed into the Escherichia coli DH5α strain (purchased from Shanghai Weidi Biotechnology Co., Ltd.). After transformation, the monoclonal colonies grown were picked for positive identification, and the positive plaques were picked into the corresponding antibody LB liquid culture medium and shaken at 37℃ for 12h, and then the plasmid was extracted and sequenced. The pGEX-4T-1 vector contains a GST tag. The Pst_4593 purified protein was obtained using a GST tag protein purification kit (purchased from Shanghai Biotech Biotechnology Co., Ltd.), and then stained with Coomassie Brilliant Blue and detected by Western-Blot ( Figure 8 The protein concentration was measured using a BCA protein concentration assay kit (purchased from Shanghai Biotech Biotechnology Co., Ltd.), and finally the lipase (LPS) activity kit (purchased from Shanghai ELISA Biotechnology Co., Ltd.) was used to assay the enzyme activity of wheat stripe rust effector protein Pst_4593. The copper soap method was used, with GST and GST+Ebelactone A as negative controls (Ebelactone A is a lipase inhibitor), and the absorbance of the system at 710 nm was measured using an ELISA reader to calculate the enzyme activity ( Fig. 9 ).

[0049] Depend on Figure 8 It can be seen that in Western-blot detection, a single protein band appeared at 61KD, which was similar to Pst_4593 △sp -GST fusion proteins are of the same size, indicating that the target protein is of high purity. Fig. 9 It can be seen that the negative control GST and GST+Ebelactone A have no lipase activity, while Pst_4593 △sp -GST showed higher lipase activity, and after adding lipase inhibitor Pst_4593 △sp -GST's lipase activity was significantly reduced, indicating that the wheat stripe rust effector protein Pst_4593 has lipase activity.

[0050] In summary, the present invention screened and cloned a wheat stripe rust effector protein gene from haustoria transcriptome sequencing. Pst_4593 The nucleotide sequence of its open reading frame is shown in SEQ ID NO: 1. The wheat stripe rust effector protein Pst_4593 encoded by the gene contains a phospholipase domain and has lipase activity. The present invention uses RNA interference technology to silence the wheat stripe rust effector protein gene Pst_4593 After gene silencing, the growth and development of stripe rust were inhibited, the pathogenicity of stripe rust was reduced, and the wheat-related defense genes TaPR1 , TaPR2 , TaPR5 The relative expression level of wheat stripe rust effector protein gene was significantly increased, which improved the disease resistance of wheat. Pst_4593 Positively regulates the pathogenicity of stripe rust to wheat.

[0051] The embodiments described above are part of the embodiments of the present invention, rather than all of the embodiments. The detailed description of the embodiments of the present invention is not intended to limit the scope of the invention claimed for protection, but merely represents selected embodiments of the present invention. All other embodiments obtained without creative work and related deductions and substitutions made by ordinary technicians in the field under the conditions of the concept of the present invention belong to the scope of protection of the present invention.

Claims

1. A wheat stripe rust effector protein gene Pst_4593 , characterized in that, The wheat stripe rust effector protein gene Pst_4593 The nucleotide sequence of the open reading frame is shown in SEQ ID NO:

1.

2. Wheat stripe rust effector protein gene Pst_4593 A specific fragment, characterized in that The wheat stripe rust effector protein gene Pst_4593 The nucleotide sequence of the specific fragment is shown in SEQ ID NO:

2.

3. The wheat stripe rust effector protein gene according to claim 1 Pst_4593 Or the wheat stripe rust effector protein gene according to claim 2 Pst_4593 The use of a specific fragment of in breeding wheat varieties resistant to stripe rust is characterized in that: The wheat stripe rust effector protein gene Pst_4593 Related to immune regulation of wheat resistance to stripe rust.

4. The use according to claim 3, characterized in that: The wheat stripe rust effector protein gene Pst_4593 Positively regulates the pathogenicity of stripe rust to wheat.

5. The use according to claim 3, characterized in that: The wheat stripe rust effector protein gene Pst_4593 Associated with the induced expression of the haustoria of stripe rust.

6. The use according to claim 3, characterized in that: The wheat stripe rust effector protein gene Pst_4593 The encoded protein has lipase activity and affects the pathogenicity of stripe rust.

7. The use according to claim 3, characterized in that: Silencing the wheat stripe rust effector protein gene Pst_ 4593 or silencing the wheat stripe rust effector protein gene Pst_4593 Specific fragments of the gene can improve wheat's resistance to stripe rust.

8. The use according to claim 7, characterized in that: The method of improving the resistance of wheat to stripe rust includes increasing the relative expression level of wheat defense genes.

9. The use according to claim 8, characterized in that: The wheat defense genes include TaPR1 Gene, TaPR2 Gene, TaPR5 Gene.

10. A method for breeding wheat rust-resistant varieties, characterized in that: Silencing the wheat stripe rust effector protein gene of claim 1 Pst_4593 or silencing the wheat stripe rust effector protein gene of claim 2 Pst_4593 specific fragments.

Images